Method for hepatitis b virus single tube rapid genotyping and application thereof

By designing specific primer and probe sets and fluorescent groups using two-dimensional PCR technology, rapid single-tube detection of 6 HBV genotypes and 13 subtypes was achieved, solving the problems of low detection accuracy and high cost in existing technologies, and providing an efficient and low-cost method for genotype and subtype identification.

CN122168800APending Publication Date: 2026-06-09SHANGHAI EAST HOSPITAL EAST HOSPITAL TONGJI UNIV SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI EAST HOSPITAL EAST HOSPITAL TONGJI UNIV SCHOOL OF MEDICINE
Filing Date
2026-04-17
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing HBV genotyping methods suffer from low accuracy, high cost, and strong equipment dependence, making it difficult to achieve rapid, simple, and accurate single-tube detection of 6 genotypes and 13 subtypes.

Method used

Using a specific primer and probe set based on two-dimensional PCR technology, combined with fluorescent groups, and a two-dimensional identification system based on fluorescence channels and melting temperature, 17 upstream primers, 11 downstream primers, and 3 probes were designed to achieve single-tube typing detection of 6 HBV genotypes and 13 subtypes.

Benefits of technology

It enables high-throughput, rapid, simple, and low-cost detection of HBV genotypes and subtypes, shortening the detection time to within 3 hours, with a sensitivity of 10~100 copies/μL, making it suitable for large-scale epidemiological surveys and clinical diagnosis, and reducing detection costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

This invention discloses a rapid single-tube typing method for hepatitis B virus (HBV) genotypes (6 types and 13 subtypes) based on two-dimensional PCR technology. The invention utilizes specific SNP site screening and tag primer and fluorescent probe design to construct a three-color fluorescent multi-Tm value two-dimensional PCR system. A single-tube reaction can detect genotypes A, B, C, D, E, and I, and 13 subtypes, with a total processing time ≤3 hours and a detection limit ≤1.0 × 10⁻⁶. 2 With a negative concordance rate of 100% and high consistency with sequencing methods, it can identify mixed infections. It is simple to operate, low in cost, and suitable for clinical and epidemiological applications.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of virus detection technology, specifically relating to a method for rapid single-tube genotyping of hepatitis B virus based on two-dimensional PCR technology and its application. Background Technology

[0002] Hepatitis B virus (HBV) is a hepatotropic DNA virus. Hepatitis B infection caused by HBV is a major public health problem worldwide. Its genome consists of double-stranded circular DNA, approximately 3.2 kb in length, and exhibits high variability. In 1988, Okamoto et al. first formally proposed the concept of HBV genotypes, classifying HBV into four genotypes (A, B, C, and D) based on a ≥8% difference in the whole genome nucleotide sequence. In 1992, Norder et al. discovered HBV genotypes E and F. In 2000, Stuyver et al. discovered HBV genotype G. In 2002, Arauz-Ruiz et al. isolated genotype H from HBV infected in Central American populations. In 2008, Tran et al. discovered HBV genotype I in Vietnam; in 2009, Tatematsu et al. discovered a new genotype from a Japanese case, which was designated as the putative genotype J. Subsequently, based on the above genotypes, each genotype was further divided into different genotypes according to the HBV whole genome nucleic acid difference ≥4% and <8% (Kim BK, Revill PA, Ahn SH. HBV genotypes: relevance to natural history, pathogenesis and treatment of chronic hepatitis B. Antivir Ther. 2011;16(8):1169-86.).

[0003] With the development of molecular biology techniques, HBV genotyping has received widespread attention as an important tool in HBV molecular epidemiology research, employing various molecular biology techniques. Currently, developed HBV genotyping methods include polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP), genotype-specific primers for single or multiplex PCR sets, oligonucleotide microarrays (DNA chips), restriction fragment quality polymorphism (RFMP), mass spectrometry (MS), PCR invader assay, real-time PCR, hybridization strips such as INNO-LiPA, reverse dot blot analysis, and sequencing. Among these, PCR-RFLP is simple to operate and inexpensive, and is widely used in HBV genotyping. However, multiple reports indicate that this method suffers from low accuracy in actual HBV genotyping. While single or multiplex PCR can distinguish between different HBV genotypes, any mutation in the genome of the sample can lead to primer-DNA hybridization mismatch, resulting in inaccurate detection results. In recent years, DNA microarrays, real-time fluorescence PCR, and dot blot hybridization techniques have been used for HBV genotyping. These techniques are highly sensitive, but their accuracy is still affected by viral genome mutations. Mass spectrometry and RFMP can also be used for HBV genotyping. These methods can detect drug-resistant variants, but their fidelity is also affected by mutations, and these methods themselves are expensive and require specialized equipment. Despite the emergence of many genotyping methods, sequencing is still considered the "gold standard" for genotyping.

[0004] Two-dimensional polymerase chain reaction (2D PCR) is a technique based on the principle of base quenching probes. By introducing homologous tag sequences at the 5' end of target gene-specific primers, and utilizing a two-dimensional identification system of "fluorescence channel (Y-axis) - melting temperature (Tm value, X-axis)," it can simultaneously detect multiple targets in a single tube, offering advantages such as speed, specificity, and high throughput. Current 2D PCR technology has been applied to HPV genotyping and HLA-B*15:02 allele identification, but single-tube genotyping methods for the 6 HBV genotypes and 13 subtypes have not yet been reported. There is an urgent need to develop a simple, rapid, accurate, and cost-effective HBV genotyping technique to meet the needs of clinical diagnosis, epidemiological surveys, and personalized treatment guidance. Summary of the Invention

[0005] This invention establishes a 2D PCR-based method for typing six genotypes and thirteen subtypes of hepatitis B virus. This method solves the problem of insufficient detection capability for rare subtypes in existing technologies and greatly shortens the time for hepatitis B virus gene detection. Based on this, this invention was completed.

[0006] In a first aspect, the present invention provides a set of specific primer-probe sets for identifying 6 genotypes and 13 subtypes of hepatitis B virus. The primer-probe set includes 17 upstream primers, 11 downstream primers, and 3 probes. The nucleotide sequences of the 17 upstream primers are SEQ ID NO. 1-17, the nucleotide sequences of the 11 downstream primers are SEQ ID NO. 18-28, and the nucleotide sequences of the 3 probes are SEQ ID NO. 29-31.

[0007] Furthermore, of the 17 upstream primers and 11 downstream primers, SEQ ID NO. 1, SEQ ID NO. 8, SEQ ID NO. 6 and SEQ ID NO. 12, and SEQ ID NO. 21, SEQ ID NO. 18, SEQ ID NO. 20 and SEQ ID NO. 19 are used for specific detection of HBV A1 gene subtypes; SEQ ID NO. 1, SEQ ID NO. 7, SEQ ID NO. 6 and SEQ ID NO. 12, and SEQ ID NO. 21, SEQ ID NO. 20 and SEQ ID NO. 19 are used for the specific detection of HBV A2 genotype; SEQ ID NO. 15, SEQ ID NO. 6 and SEQ ID NO. 12, and SEQ ID NO. 27, SEQ ID NO. 20 and SEQ ID NO. 19 are used for the specific detection of HBV A3 genotype; SEQ ID NO. 10, SEQ ID NO. 6, and SEQ ID NO. 12, along with SEQ ID NO. 23, SEQ ID NO. 20, and SEQ ID NO. 19, are used for the specific detection of HBV A5 genotypes. SEQ ID NO. 6 and SEQ ID NO. 12, along with SEQ ID NO. 20 and SEQ ID NO. 19, are used for the specific detection of HBV A genotypes. SEQ ID NO. 15, SEQ ID NO. 11, and SEQ ID NO. 12, along with SEQ ID NO. 26 and SEQ ID NO. 19, are used for the specific detection of HBV B1 genotypes; SEQ ID NO. 1, SEQ ID NO. 16, SEQ ID NO. 11 and SEQ ID NO. 12, along with SEQ ID NO. 21, SEQ ID NO. 24 and SEQ ID NO. 19, are used for the specific detection of HBV B2 genotypes; SEQ ID NO. 4, SEQ ID NO. 11, and SEQ ID NO. 12, along with SEQ ID NO. 23 and SEQ ID NO. 19, are used for the specific detection of the HBV B3 genotype. SEQ ID NO. 3, SEQ ID NO. 11, and SEQ ID NO. 12, along with SEQ ID NO. 23 and SEQ ID NO. 19, are used for the specific detection of HBV B4 genotypes. SEQ ID NO. 14, SEQ ID NO. 11, and SEQ ID NO. 12, along with SEQ ID NO. 23 and SEQ ID NO. 19, are used for the specific detection of the HBV B7 genotype. SEQ ID NO. 11 and SEQ ID NO. 12, along with SEQ ID NO. 19, are used for the specific detection of HBV B genotype; SEQ ID NO. 13, SEQ ID NO. 17 and SEQ ID NO. 12 (and SEQ ID NO. 25 and SEQ ID NO. 19) are used for the specific detection of HBV C1 genotypes; SEQ ID NO. 5, SEQ ID NO. 17, and SEQ ID NO. 12 (and SEQ ID NO. 22 and SEQ ID NO. 19) are used for the specific detection of HBV C2 genotypes; SEQ ID NO. 3, SEQ ID NO. 17 and SEQ ID NO. 12, and SEQ ID NO. 23 and SEQ ID NO. 19) are used for the specific detection of HBV C5 genotypes; SEQ ID NO. 16, SEQ ID NO. 17 and SEQ ID NO. 12 (and SEQ ID NO. 24 and SEQ ID NO. 19) are used for the specific detection of HBV C6 genotype; SEQ ID NO. 17 and SEQ ID NO. 12, along with SEQ ID NO. 19, are used for the specific detection of HBV C genotype; SEQ ID NO. 9 and SEQ ID NO. 12, along with SEQ ID NO. 28 and SEQ ID NO. 19, are used for the specific detection of HBV D genotype. SEQ ID NO. 2 and SEQ ID NO. 12, along with SEQ ID NO. 18 and SEQ ID NO. 19, are used for the specific detection of HBV E genotypes; SEQ ID NO .13, SEQ ID NO .3 and SEQ ID NO .12, along with SEQ ID NO .25, SEQ ID NO .23 and SEQ ID NO .19, are used for the specific detection of HBV I genotype.

[0008] Furthermore, the probe carries a fluorescent group selected from one or more of Alexa Fluor 488, Cy2, FAM, Alexa Fluor 555, Alexa Fluor 594, Alexa fluor 568, Cy3, TRITC, Alexa Fluor 647, HEX, DAPI and / or Alexa Fluor 350.

[0009] Preferably, the fluorescent group is Alexa fluor 568, Alexa Fluor 488, or HEX.

[0010] Furthermore, in the primer-probe set, each of the 17 upstream primers is equipped with a different tag. The nucleotide sequence of the tag is homologous to the probe sequence. Different types and numbers of mutant bases are formed on the tags, so that the HBV genotypes and subtypes to be tested have different melting temperatures.

[0011] Furthermore, among the 17 upstream primers, mutant bases are introduced near the single nucleotide polymorphism sites corresponding to the HBV genotype and subtype near the 3' end of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 16 and SEQ ID NO. 17.

[0012] Furthermore, the single nucleotide polymorphism sites corresponding to the HBV genotypes and subtypes are shown below: Secondly, the present invention provides a reaction system for detecting 6 genotypes and 13 subtypes of hepatitis B virus. The reaction system contains a primer and probe set for detecting the 6 genotypes and 13 subtypes of hepatitis B virus. The primer and probe set includes 17 upstream primers, 11 downstream primers, and 3 probes. The nucleotide sequences of the 17 upstream primers are SEQ ID NO. 1-17, the nucleotide sequences of the 11 downstream primers are SEQ ID NO. 18-28, and the nucleotide sequences of the 3 probes are SEQ ID NO. 29-31.

[0013] Furthermore, the reaction system contains Immobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexa fluor 568, probe-Alexa fluor 488, 17 upstream primers, 11 downstream primers, and deionized water.

[0014] Furthermore, the ratio of the Imobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexa fluor 568, and probe-Alexa fluor 488 is 15~30∶3~9∶5~15∶5~15∶3~9∶1~10∶0.5~5.

[0015] Thirdly, the present invention provides a method for identifying six genotypes and thirteen subtypes of hepatitis B virus, the method being used to detect plasmid nucleic acid samples, the method comprising the following steps: S1. Prepare a reaction system containing Immobuffer solution, magnesium ion solution, dNTPs, IMMOLASE DNA polymerase, probe-HEX, probe-Alexa fluor 568, probe-Alexa fluor 488, and tagged and untagged primers for detecting 6 genotypes and 13 subtypes of hepatitis B virus to obtain a 2D PCR reaction solution. S2, add the sample to be tested to the 2D PCR reaction solution prepared in S1; S3, set the PCR amplification program as follows: 95℃ for 10 min, one cycle; 95℃ for 15 s, 61℃ for 30 s, 5 cycles; 95℃ for 15 s, 72℃ for 1 s, 61℃ for 30 s, 35 cycles; 28℃ for 10 s, one cycle; perform the PCR reaction according to the above program. S4. Set the melting curve analysis program as follows: 95℃ for 10 s, one cycle; 28℃ for 4 min, one cycle; continuously increase the temperature to 70℃ at a rate of 0.1℃ / s, continuously collecting fluorescence signals; 40℃ for 30 s, one cycle; perform melting curve analysis according to the above program to obtain melting curve data. S5. Result Interpretation: Based on the interpretation rules for the 6 HBV genotypes and 13 subtypes, interpret the melting curve data obtained in step S4 to determine the HBV genotype and subtype in the sample to be tested. The interpretation rules for the 6 HBV genotypes and 13 subtypes are shown in the table below: Furthermore, the plasmid nucleic acid sample is obtained by diluting and dissolving the nucleic acid plasmid dry powder using Immobuffer solution or deionized water.

[0016] Preferably, the plasmid nucleic acid sample is obtained by diluting and dissolving the nucleic acid plasmid dry powder with Immobuffer solution.

[0017] Furthermore, the ratio of the Imobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexa fluor 568, and probe-Alexa fluor 488 is 15~30∶3~9∶5~15∶5~15∶3~9∶1~10∶0.5~5.

[0018] Fourthly, the present invention provides a method for identifying six genotypes and thirteen subtypes of hepatitis B virus, the method being used to detect clinical samples, and the method comprising the following steps: S1, Preparation of test samples: HBV virus nucleic acid is extracted using a viral nucleic acid extraction kit, and the magnetic beads loaded with HBV virus nucleic acid are used as test samples. S2, prepare a reaction system containing Immobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexa fluor 568, probe-Alexa fluor 488, and upstream and downstream primers for detecting 6 genotypes and 13 subtypes of hepatitis B virus, and obtain 2D PCR reaction solution; S3, Add the test sample: Add the 2D PCR reaction solution obtained in step S2 to the test sample obtained in step S1. S4. Set the PCR amplification program as follows: 95℃ for 10 min, one cycle; 95℃ for 15 s, 61℃ for 30 s, 5 cycles; 95℃ for 15 s, 72℃ for 1 s, 61℃ for 30 s, 35 cycles; 28℃ for 10 s, one cycle; perform the PCR reaction according to the above program. S5. After the PCR reaction is complete, place the container containing the PCR reaction solution on the magnetic rack and magnetically attract it for 3 minutes to allow the magnetic beads to gather at the bottom of the container. S6. Set the melting curve analysis program as follows: 95℃ for 10 s, one cycle; 28℃ for 4 min, one cycle; continuously increase the temperature to 70℃ at a rate of 0.1℃ / s, continuously collecting fluorescence signals; 40℃ for 30 s, one cycle; perform melting curve analysis according to the above program to obtain melting curve data. S7. Result Interpretation: Based on the interpretation rules for the 6 HBV genotypes and 13 subtypes, interpret the melting curve data obtained in step S6 to determine the HBV genotype and subtype in the sample to be tested. The interpretation rules for the 6 HBV genotypes and 13 subtypes are shown in the table below: Furthermore, the ratio of the Imobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexa fluor 568, and probe-Alexa fluor 488 is 15~30∶3~9∶5~15∶5~15∶3~9∶1~10∶0.5~5.

[0019] Fifthly, the present invention provides the application of the specific primer-probe set as described in the first aspect in the preparation of reagents for detecting 6 genotypes and 13 subtypes of hepatitis B virus, wherein the primer-probe set comprises 17 upstream primers, 11 downstream primers and 3 probes; the nucleotide sequences of the 17 upstream primers are SEQ ID NO. 1-17, the nucleotide sequences of the 11 downstream primers are SEQ ID NO. 18-28, and the nucleotide sequences of the 3 probes are SEQ ID NO. 29-31.

[0020] In a sixth aspect, the present invention provides a kit for detecting six genotypes and 13 subtypes of hepatitis B virus based on two-dimensional PCR. The kit includes the following components: dNTPs, DNA polymerase, MgCl2, PCR reaction buffer, and the specific primer and probe set for detecting the six genotypes and 13 subtypes of hepatitis B virus as described in the first aspect of the present invention.

[0021] Furthermore, the specific primer-probe set includes 17 upstream primers, 11 downstream primers, and 3 probes; the nucleotide sequences of the 17 upstream primers are SEQ ID NO. 1-17, the nucleotide sequences of the 11 downstream primers are SEQ ID NO. 18-28, and the nucleotide sequences of the 3 probes are SEQ ID NO. 29-31.

[0022] In a seventh aspect, the present invention provides a kit for detecting six genotypes and 13 subtypes of hepatitis B virus based on two-dimensional PCR, wherein the kit contains the reaction system for detecting the six genotypes and 13 subtypes of hepatitis B virus as described in the second aspect of the present invention.

[0023] Beneficial effects The technical method provided by this invention has the following advantages: 1. High-throughput single-tube detection: Enables simultaneous differentiation of 6 HBV genotypes (A, B, C, D, E, and I) and 13 genotypes (A1, A2, A3, A5, B1, B2, B3, B4, B7, C1, C2, C5, and C6) in a single tube, eliminating the need for multiple tube reactions. This expands the application scope and detection throughput compared to existing methods, and solves the problem of insufficient detection capability for rare subtypes in existing methods. It is suitable for large-scale epidemiological surveys and clinical batch testing. 2. Fast and efficient: The entire detection process (including amplification and melting curve analysis) takes ≤3 hours, which is significantly more efficient than sequencing (24-48 hours) and PCR-RDB (4-6 hours), meeting the needs of rapid clinical diagnosis; 3. Specificity, limit of detection, and method consistency comparison: Through genotype / subtype specific primer design and hot-start system optimization, the negative sample concordance rate is 100%, and there is no cross-reactivity with HCV, HIV-1, CMV, and EBV; the limit of detection can reach 10~100 copies / μL, and it can identify mixed infection samples; the consistency comparison between single infection genotype and sequencing method is Kappa=1.0, and the overall consistency comparison is Kappa=0.841; 4. Simple operation: The operation process is greatly simplified, eliminating the need for subsequent steps such as hybridization, electrophoresis, and sequencing. Closed tube testing can avoid contamination, making it suitable for promotion and application in medical institutions and clinical laboratories at all levels, and providing accurate basis for individualized treatment and prognosis assessment of HBV infection.

[0024] 5. Low detection cost: This method uses three fluorescent probes and does not require expensive detection equipment. It only requires a conventional real-time quantitative PCR instrument to identify six HBV genotypes and thirteen genotypes, making it easy to popularize and promote in medical institutions. The cost of a single test can be controlled within 10 yuan, which is expected to significantly reduce the diagnosis and treatment costs for hepatitis B patients and reduce the waste of medical resources caused by blind treatment. Attached Figure Description

[0025] Figure 1 The 321 AF primer was adjusted. Figure A shows the primer before adjustment, with a non-specific melting valley at around 62℃; Figure B shows the primer after adjustment, with no melting valley at around 62℃.

[0026] Figure 2 The primers for 2552A-F-2 were adjusted. Figure A uses 2552A-F as the primer. Taking the detection results of type A1 plasmid as an example, the plasmid concentration is 1.0 × 10⁻⁶. 1 ~1.0×10 5copies / μL; result 1.0×10 3 ~1.0×10 5 A1 type plasmids at a concentration of copies / μL exhibit a nonspecific melting valley at approximately 58℃ in the Alexa fluor 568 fluorescence channel. Figure B shows the detection results of A1 type plasmids using primer 2552A-F-1 as an example, with a plasmid concentration of 1.0 × 10⁻⁶. 1 ~1.0×10 5 copies / μL; result 1.0×10 1 ~1.0×10 5 A1 type plasmids at copies / μL exhibited nonspecific melting valleys at approximately 58℃ in the Alexa fluor 568 fluorescence channel. Figure C shows the detection results of A3 type plasmids using 2552A-F-2 as primers, with a plasmid concentration of 1.0 × 10⁻⁶. 1 ~1.0×10 5 copies / μL; result 1.0×10 1 ~1.0×10 5 Specific melting troughs were detected in A3 type plasmids at approximately 58℃ using Alexa fluor 568 fluorescence channel at copies / μL. The detection limit of this primer in the A3 subtype reached 1.0 × 10⁻⁶. 1 Copies / μL. Figure D shows the detection results using 2552A-F-3 primers and the A3 type plasmid as an example, with a plasmid concentration of 1.0 × 10⁻⁶. 1 ~1.0×10 5 copies / μL; result 1.0×10 3 ~1.0×10 5 A1 type plasmids of copies / μL exhibit a specific melting valley at approximately 58℃ in the Alexa fluor 568 fluorescence channel. The detection limit of this primer in the A3 subtype is 1.0 × 10⁻⁶. 3 The detection sensitivity is low, with only copies / μL.

[0027] Figure 3 Using 2552A-F-2 as primers, and taking the detection results of type A1 plasmid as an example, 1.0×10 1 ~1.0×10 5 The A1 type plasmid with copies / μL showed no nonspecific melting valley at around 58℃ in the Alexa fluor 568 fluorescence channel. Other genotype plasmids also showed no nonspecific melting valley, indicating the elimination of nonspecific melting valleys.

[0028] Figure 4 The 1173 AF primer was adjusted. Figure A shows the original 1173 AF primer with a mismatched base A introduced at position 3 of the 3' end, resulting in a detection limit of 1.0 × 10⁻⁶. 2The samples showed irregular valley shapes and shallow melting valleys; Figure B shows the adjusted 1173A-F primers with a mismatched base G introduced at position 7 of the 3' end, resulting in a detection limit of 1.0 × 10⁻⁶. 1 The number of copies / μL is high, the valley shape is regular, the melting valley depth is large, and the detection sensitivity is increased.

[0029] Figure 5 The 1155G-F primers were adjusted and the primer tag was optimized. Figure A shows the 1155G-F primer before adjustment, with a mismatched C base introduced at position 6 of the 3' end. The B7 isotype plasmid concentration was 1.0 × 10⁻⁶. 2 ~1.0×10 6 The results of the copies / μL detection are shown in Figure B. No melting valley was observed in the HEX fluorescence channel at approximately 58℃, indicating that the site was not detected. Figure B shows the results after removing mismatched bases from the original primers; the concentration of the B7 isotype plasmid was 1.0 × 10⁻⁶. 2 ~1.0×10 6 The results of the copies / μL detection are shown in the figure. High concentration (1.0×10⁻⁶) 4 and 1.0×10 5 The plasmid (copies / μL) showed a melting valley in the HEX fluorescence channel at around 58℃, but the valley was relatively flat and showed fusion with adjacent valleys. The analysis indicated that the three amplification sites of the B7 subtype were allocated to the same fluorescence (HEX) channel, competing with the fluorescent probe. The 1155G-F primer tag was subsequently adjusted.

[0030] Figure 6 Adjust the 1155G-F primer tag.

[0031] Figure 7 The 2065 AF primer was adjusted and the primer tag was optimized. Figure A shows the result before adjustment, using a high-concentration C2 subtype HBV DNA sample as a template. The 2065 AF primer produced a non-specific valley at around 58℃ in the HEX fluorescence channel. Figure B shows the result after adjusting the 2065 AF primer, using the same high-concentration C2 subtype HBV DNA sample as a template. No non-specific valley was produced, and the detection result was C2 subtype.

[0032] Figure 8 The 1041C-F primer tag was adjusted. Figure A shows the detection results using the Alexa fluor 568 fluorescence channel at approximately 47°C. The melting valley is shallow, and the detection limit is 1.0 × 10⁻⁶. 4 Copies / μL; Figure B shows the tag detection results using the Alexa fluor488 fluorescence channel at approximately 62℃, with a deep melting valley and a detection limit of 1.0 × 10⁻⁶. 2 The number of copies / μL increases the detection sensitivity by 100 times.

[0033] Figure 9 Mg in the reaction system 2+ Concentration optimization, where Figure A shows Mg 2+ Melting curves for a concentration of 1.0 mM, Figure B shows the melting curves for Mg. 2+ Melting curves for a concentration of 1.2 mM, Figure C shows the melting curves for Mg. 2+ Melting curve at a concentration of 1.4 mM.

[0034] Figure 10 The dosage of 5 U / μL IMMOLASE DNA polymerase was optimized. Figure A shows the melting curve of 5 U / μL IMMOLASE DNA polymerase with 0.5 μL / person, and Figure B shows the melting curve of 5 U / μL IMMOLASE DNA polymerase with 1.0 μL / person.

[0035] Figure 11 The amount of 4×2.5 mM dNTPs added to the reaction system is shown in Figure A, which is the melting curve of 0.75 μL / person of 4×2.5 mM dNTPs, Figure B is the melting curve of 1.0 μL / person of 4×2.5 mM dNTPs, and Figure C is the melting curve of 2.0 μL / person of 4×2.5 mM dNTPs.

[0036] Figure 12 The amount of HBV-specific F tag primer added was optimized. In Figure A, 0.1 μL of 10 μM HBV-specific F tag primer was added per person; in Figure B, 0.15 μL of 10 μM HBV-specific F tag primer was added per person.

[0037] Figure 13 The optimal dosages of tagged primer 3047T-F and untagged primer 3047T-R were optimized. Figure A shows the results: using the B2 subtype plasmid as a template, adding 0.08 μL / person of 10 μM tagged primer 3047T-F and 0.08 μL / person of 100 μM untagged primer 3047T-R resulted in a non-specific melting valley at approximately 51℃ in the HEX fluorescence channel. Figure B shows the results: using the B2 subtype plasmid as a template, adding 0.06 μL / person of 10 μM tagged primer 3047T-F and 0.05 μL / person of 100 μM untagged primer 3047T-R did not result in a non-specific melting valley at approximately 51℃ in the HEX fluorescence channel. Figure C shows the results: using the D subtype plasmid as a template, adding 0.06 μL / person of 10 μM tagged primer 3047T-F and 0.05 μL / person of 100 μM untagged primer 3047T-R resulted in a non-specific melting valley at approximately 51℃ in the HEX fluorescence channel. When 0.05 μL / person of the untagged primer 3047T-R at μM was added, a specific melting valley was generated in the HEX fluorescence channel at approximately 51℃, with a detection limit of 1.0 × 10⁻⁶. 1 The number of copies / μL was sufficient to meet the detection requirements, and the detection sensitivity was not reduced.

[0038] Figure 14 The dosage of fluorescent probe was optimized. Figure A shows the melting curve of 10 μM Alexa fluor 488 fluorescent probe at 0.6 μL / person; Figure B shows the melting curve of 10 μM Alexa fluor 488 fluorescent probe at 0.2 μL / person.

[0039] Figure 15 The two-dimensional PCR reaction program was optimized. Figure A shows the melting curve of the 1041C site before optimization; Figure B shows the melting curve of the 1041C site after optimization; Figure C shows the melting curve of the HBV-specific site before optimization; and Figure D shows the melting curve of the HBV-specific site after optimization.

[0040] Figure 16 The reaction procedure was adjusted under sample adaptation. Figure A shows clinical sample No. 96. Nucleic acid elution buffer was used for nucleic acid extraction. The eluted DNA was used as a template for hepatitis B genotyping. Non-magnetic amplification was performed. After the PCR amplification procedure, the melting curve analysis procedure was performed directly. The result could only detect the melting valleys of the 1041C and 293A sites, and the melting valleys were shallow. Figure B shows the result of magnetic amplification of clinical sample No. 96. After the PCR amplification procedure, the process of "placing the PCR reaction tube on a magnetic rack and magnetically attracting it for 3 minutes to allow the magnetic beads to gather at the bottom of the tube" was added. Then the melting curve analysis procedure was performed. The result detected the melting valleys of the 1041C, 293A and HBV specific sites, and the melting valleys were deeper and the valley shape was standard, which was judged as C2 subtype.

[0041] Figure 17 The figure shows the two-dimensional PCR detection results of 6 HBV genotypes and 13 subtypes. The blue curve represents the Alexa fluor 488 fluorescence channel, the green curve represents the HEX fluorescence channel, and the orange curve represents the Alexa fluor 568 fluorescence channel. A to P are the melting curves of the 16 constructed HBV genotypes and subtypes plasmids, respectively. The arrows in the figure indicate the melting valleys containing 17 specific sites.

[0042] Figure 18 The downstream primer for the 1041C site was adjusted. Figure A shows the melting curve of 1041C-F and 1107G-F, 1127C-F, 1155G-F, and 1173A-F sites using the same downstream primer 1107G+1127C+1155G+1173A-R. Figure B shows the melting curve of 1041C-R and 1041C-F used alone.

[0043] Figure 19Summary table of detection limits for each specific site of 6 HBV genotypes and 13 genotype subtypes.

[0044] Figure 20 HBV genotype B, subtype B2.

[0045] Figure 21 HBV genotype B, subtype B4.

[0046] Figure 22 HBV genotype B2 / B4 mixed subtype.

[0047] Figure 23 HBV genotype B2 / B1 mixed subtype (TA clone sequencing 2552 site double base).

[0048] Figure 24 HBV genotype C, subtype C1.

[0049] Figure 25 HBV genotype C, subtype C2.

[0050] Figure 26 HBV genotype C type C1 / C2 mixed subtype.

[0051] Figure 27 HBV genotype B2 / A mixed type.

[0052] Figure 28 HBV genotype D.

[0053] Figure 29 Figure A shows the melting curve of specific experimental results. Figure B shows the test results of one HBV DNA negative sample. Figure B shows the test results of HCV, HIV-1, CMV, and EBV positive samples after three repeated tests. Detailed Implementation

[0054] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0055] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.

[0056] In the primer-probe set described in this invention, 499A-F (SEQ ID NO. 1), 85C-F (SEQ ID NO. 8), 436A-F (SEQ ID NO. 6), and HBV-specific-F (SEQ ID NO. 12), along with 499A+616G-R (SEQ ID NO. 21), 85C+160A-R (SEQ ID NO. 18), 436A-R (SEQ ID NO. 20), and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBVA1 gene subtypes. 499A-F (SEQ ID NO. 1), 616G-F (SEQ ID NO. 7), 436A-F (SEQ ID NO. 6), and HBV-specific-F (SEQ ID NO. 12), along with 499A+616G-R (SEQ ID NO. 21), 436A-R (SEQ ID NO. 20), and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV A2 gene subtypes. 2552A-F-2 (SEQ ID NO. 15), 436A-F (SEQ ID NO. 6), and HBV-specific-F (SEQ ID NO. 12), along with 2552A-A3-R (SEQ ID NO. 27), 436A-R (SEQ ID NO. 20), and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of the HBV A3 genotype. 1127C-F (SEQ ID NO. 10), 436A-F (SEQ ID NO. 6), and HBV-specific-F (SEQ ID NO. 12), along with 1107G+1127C+1155G+1173A-R (SEQ ID NO. 23), 436A-R (SEQ ID NO. 20), and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV A5 gene subtypes. 436A-F (SEQ ID NO. 6) and HBV-specific-F (SEQ ID NO. 12), along with 436A-R (SEQ ID NO. 20) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV A genotype. 2552A-F-2 (SEQ ID NO. 15), 321A-F (SEQ ID NO. 11), and HBV-specific-F (SEQ ID NO. 12), along with 2552A-B1-R (SEQ ID NO. 26) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV B1 genotypes. 499A-F (SEQ ID NO. 1), 1632A-F (SEQ ID NO. 16), 321A-F (SEQ ID NO. 11), and HBV-specific-F (SEQ ID NO. 12), along with 499A+616G-R (SEQ ID NO. 21), 1632A-R (SEQ ID NO. 24), and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV B2 genotypes. 1107G-F (SEQ ID NO. 4), 321A-F (SEQ ID NO. 11), and HBV-specific-F (SEQ ID NO. 12), along with 1107G+1127C+1155G+1173A-R (SEQ ID NO. 23) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV B3 genotypes. 1173A-F (SEQ ID NO. 3), 321A-F (SEQ ID NO. 11), and HBV-specific-F (SEQ ID NO. 12), along with 1107G+1127C+1155G+1173A-R (SEQ ID NO. 23) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV B4 gene subtypes. 1155G-F (SEQ ID NO. 14), 321A-F (SEQ ID NO. 11), and HBV-specific-F (SEQ ID NO. 12), along with 1107G+1127C+1155G+1173A-R (SEQ ID NO. 23) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV B7 genotypes. 321A-F (SEQ ID NO. 11) and HBV-specific-F (SEQ ID NO. 12), along with HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV B genotype. 2065A-F (SEQ ID NO. 13), 293A-F (SEQ ID NO. 17), and HBV-specific-F (SEQ ID NO. 12), along with 2065A-R (SEQ ID NO. 25) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV C1 gene subtypes. 1041C-F (SEQ ID NO. 5), 293A-F (SEQ ID NO. 17), and HBV-specific-F (SEQ ID NO. 12), along with 1041C-R (SEQ ID NO. 22) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV C2 gene subtypes. 1173A-F (SEQ ID NO. 3), 293A-F (SEQ ID NO. 17), and HBV-specific-F (SEQ ID NO. 12), along with 1107G+1127C+1155G+1173A-R (SEQ ID NO. 23) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV C5 gene subtypes. 1632A-F (SEQ ID NO. 16), 293A-F (SEQ ID NO. 17), and HBV-specific-F (SEQ ID NO. 12), along with 1632A-R (SEQ ID NO. 24) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV C6 gene subtypes. 293A-F (SEQ ID NO. 17) and HBV-specific-F (SEQ ID NO. 12), along with HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV C genotype. 3047T-F (SEQ ID NO. 9) and HBV-specific-F (SEQ ID NO. 12), along with 3047T-R (SEQ ID NO. 28) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV D genotype. 160A-F (SEQ ID NO. 2) and HBV-specific-F (SEQ ID NO. 12), along with 85C+160A-R (SEQ ID NO. 18) and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV E genotype. 2065A-F (SEQ ID NO. 13), 1173A-F (SEQ ID NO. 3), and HBV-specific-F (SEQ ID NO. 12), along with 2065A-R (SEQ ID NO. 25), 1107G+1127C+1155G+1173A-R (SEQ ID NO. 23), and HBV-specific+293A+321A-R (SEQ ID NO. 19), are used for the specific detection of HBV I genotype.

[0057] Example 1: Screening for HBV genotype and subtype-specific loci By consulting the NCBI database website (https: / / www.ncbi.nlm.nih.gov / projects / genotyping / view.cgi?db=2), 23 reference sequences for HBV genotype AH were obtained. One reference sequence for HBV genotype I was obtained by consulting the International Committee on Taxonomy of Viruses website (https: / / ictv.global / vmr). Fifteen reference sequences for HBV genotypes (A1, A2, A3, A5, C1, C2, C5, C6, B1, B2, B3, B4, B6, B7, B9) were obtained from literature reviews. These constitute a total of 39 reference sequences for the entire genome of HBV genotypes and subtypes. Their GenBank numbers are shown in Table 1.

[0058] Based on reference sequences of 39 HBV genotypes and subtypes, sequence alignment analysis was performed, identifying 17 specific single nucleotide polymorphism (SNP) sites that distinguish between 6 HBV genotypes (A, B, C, D, E, and I) and 13 genotype subtypes (A1, A2, A3, A5, B1, B2, B3, B4, B7, C1, C2, C5, and C6). These HBV-specific sites cover all genotypes and subtypes. Specific site information is shown in Table 2.

[0059] Table 1. Reference sequences of 39 HBV genotypes and subtypes (GenBank numbers) Table 2. Summary of 17 specific single nucleotide polymorphism sites for identifying HBV genotypes and subtypes. Note: The base sequence number of the "a" specific site refers to the whole genome sequence number of the A1 gene subtype (KP234050).

[0060] Example 2 Primer, tag, and probe design HBV genotype and subtype-specific upstream and downstream primers were designed using Primer Premier 5.0 software. To reduce the number of primers used, some downstream primers were shared, resulting in a total of 17 upstream primers and 11 downstream primers. To improve the specificity of PCR amplification, this invention follows the primer design principles of Amplification Arrestor Mutant System PCR (ARMS-PCR) technology, introducing mismatched bases near the 3' end of the upstream primers. The 3' ends of the 17 tag sequences were connected to the 5' ends of the 17 upstream primer sequences, forming 17 upstream primers. The 11 downstream primers were not tagged, forming 11 upstream primers. The 5' ends of the three probe sequences were labeled with the fluorescent groups Alexa fluor 488, HEX, and Alexa fluor 568, respectively, and the 3' ends were blocked with phosphate groups, resulting in a total of three fluorescent probes. The tag sequences of the 17 upstream primers each have 17 distinguishable Tm values, and the three fluorescent probes represent three fluorescence channels. The primer and probe sequences for the 6 genotypes and 13 subtypes of HBV are listed in Tables 3 and 4.

[0061] Due to the poor specificity and low sensitivity of some primer pairs, optimization and adjustments were made. Using the HBV genotype reference sequences shown in Table 1 of Example 1 as a guide, 16 plasmids containing 6 genotypes and 13 subtypes were constructed using the pUC57 vector. These 16 plasmids each contain gene fragments with HBV-specific single nucleotide polymorphism (SNP) sites for types A1, A2, A3, A5, B1, B2, B3, B4, B7, C1, C2, C5, C6, D, E, and I. Each genotype or subtype plasmid contains amplified fragments of 2-4 positive specific SNP sites, synthesized by Shanghai Sangon Biotech. The primers and primer tags of these 16 synthesized plasmids were then optimized and adjusted.

[0062] 321A is a specific site for HBV type B; primer adjustment for 321AF... The 321AF primer, which originally introduced a mismatched base A at position 4 of the 3' end, was adjusted to introduce the mismatched base A at position 3 of the 3' end. After this adjustment, the primer's specificity increased, the non-specific valley caused by the primer was eliminated, and the detection sensitivity was not significantly affected. The melting curve temperature corresponding to this primer tag is approximately 62℃ in the HEX channel. Taking the detection results of type D plasmid as an example, the plasmid concentration is 1.0 × 10⁻⁶. 3 ~1.0×10 6 copies / μL, high concentration of D-type plasmid before primer adjustment (1.0×10⁻⁶ copies / μL). 5 1.0×10 6 The primers (copies / μL) exhibited a nonspecific valley at approximately 62°C in the HEX channel. This nonspecific valley disappeared after primer adjustment. (See [link to primer description]). Figure 1 As shown.

[0063] 2552A-F-2 primer adjustment 2552A is a common positive site for both subtypes A3 and B1. A total of four upstream primers were synthesized, named 2552A-F, 2552A-F-1, 2552A-F-2, and 2552A-F-3. Primer 2552A-F introduces a mismatched base G at position 5 of its 3' end, with a primer length of 21 bp; primer 2552A-F-1 introduces a mismatched base A at position 3 of its 3' end, with a primer length of 24 bp; primer 2552A-F-2 introduces a mismatched base G at position 3 of its 3' end, with a primer length of 21 bp; and primer 2552A-F-3 introduces a mismatched base T at position 2 of its 3' end, with a primer length of 24 bp. The melting temperature of the primer tag was approximately 58℃ in the Alexa fluor 568 channel. Analysis showed that primer 2552A-F-2 (nucleotide sequence TGGCAAACTCCTTCTTTTGCA, where the double underscores are artificially introduced mutant bases) achieved a detection limit of 10 copies / μL in both subtypes A3 and B1, demonstrating excellent detection sensitivity. Furthermore, no non-specific valleys were observed in other genotypes at approximately 58℃ in the Alexa fluor 568 fluorescence channel; the non-specific valleys were eliminated. (See [link to relevant documentation]). Figure 2-3 As shown.

[0064] 1173 AF primer adjustment 1173A is a common positive specific site for types B4, C5, and I. The 1173AF primer, which initially introduced a mismatched base A at position 3 of the 3' end, was adjusted to introduce a mismatched base G at position 7 of the 3' end, resulting in increased detection sensitivity. The melting curve temperature corresponding to this primer tag is approximately 44℃ in the Alexa fluor 488 fluorescence channel. Taking type I plasmid detection results as an example, the plasmid concentration is 1.0 × 10⁻⁶. 1 ~1.0×10 5 The limit of detection was 1.0 × 10⁻⁶ copies / μL before primer adjustment. 2 The detection limit was achieved at copies / μL after primer adjustment, reaching 1.0 × 10⁻⁶. 1 copies / μL, and the melting valleys become deeper and more regular in shape, see Figure 4 .

[0065] 1155G-F primer adjustment and primer tag optimization 1155G is a specific site for the B7 subtype. To increase primer specificity, the original 1155G-F primer introduced a mismatched base C at position 6 of the 3' end, but the amplification efficiency was low and the target melting valley was not detected. The introduced mismatched base has now been removed, increasing detection sensitivity, and no non-specific valleys were observed at this position for other genotypes. A tag with HEX fluorescence channel at approximately 58°C was used. See [link to relevant documentation]. Figure 5 .

[0066] Further adjustments were made to the primer tag corresponding to 1155G-F. The tag from the HEX fluorescence channel (around 58℃) ​​was changed to the Alexa fluor 568 fluorescence channel (around 47℃). The concentration of the B7 isotype plasmid was 1.0 × 10⁻⁶. 2 ~1.0×10 5 The copies / μL detection results are as follows: Figure 6 As shown, after adjusting the primer tag, the melting valley depth increased the detection sensitivity, and the detection limit was 1.0 × 10⁻⁶. 2 copies / μL, no nonspecific valley was observed at this position for other genotypes.

[0067] 2065 AF primer adjustment and primer tag optimization 2065A is a common positive specific site for both C1 and type I. The mismatched base G introduced at position 5 of the 3' end was replaced with a mismatched base C introduced at position 6 of the 3' end, reducing the primer base count from 26 bp to 24 bp. The primer tag was changed from a tag around 58°C in the HEX fluorescence channel to a tag around 40°C in the Alexa fluor 568 fluorescence channel. After the adjustment, the detection limit for 2065AF can reach 1.0 × 10⁻⁶. 1 copies / μL, before adjustment, high-concentration C2 subtype samples will produce a nonspecific valley caused by 2065 AF at around 58℃ in the HEX fluorescence channel (see copies / μL). Figure 7 A), after adjustment, nonspecific valley is eliminated (see A). Figure 7 B).

[0068] 1041C-F primer tag adjustment 1041C is a C2 subtype-specific site. The 1041C-F primer tag was changed from a tag at approximately 47°C in the Alexa fluor 568 fluorescence channel to a tag at approximately 62°C in the Alexa fluor 488 fluorescence channel. (The last part, "1.0 × 10," appears to be an unrelated fragment and is omitted from the translation.) 2 ~1.0×10 6 Taking the detection of C2 subtype plasmid copies / μL as an example, after adjustment, the melting valley shape becomes deeper, the detection sensitivity increases, and the detection limit increases from 1.0×10. 4 copies / μL increased to 1.0×10 2 copies / μL, results as follows Figure 8 As shown.

[0069] Adjustment of downstream primer at 1041C site 1041C is a C2 subtype-specific site. In previous primer designs, to reduce the number of primers in the reaction system, a method was introduced where multiple upstream primers shared a single downstream primer. Specifically, 1041C-F shared a single downstream primer with 1107G-F, 1127C-F, 1155G-F, and 1173A-F, resulting in a target fragment length of 262 bp and low amplification efficiency. Using clinical samples of the C2 subtype as templates, the HBV DNA template concentration was 1.0 × 10⁻⁶. 7 IU / mL, serially diluted 10-fold to 1.0×10⁻⁶ 4 IU / mL, only 1.0×10 IU / mL can be detected. 6 IU / mL and 1.0×10 7 The sample had an IU / mL concentration and a shallow melting valley (see [reference]). Figure 18 A).

[0070] To this end, a downstream primer, 1041C-R, was designed to be used alone in conjunction with 1041C-F, shortening the target fragment length to 177 bp. Taking a clinical sample of the C2 subtype as an example, the HBV DNA template concentration was 1.0 × 10⁻⁶. 7 IU / mL, serially diluted 10-fold to 1.0×10⁻⁶ 4 IU / mL, 1041C-F and 1041C-R were used as amplification primer pairs for the experiment. The results are as follows: Figure 18 As shown in B, 1.0 × 10⁻⁶ can be detected. 5 IU / mL, 1.0×10 6 IU / mL and 1.0×10 7 For samples with IU / mL, the detection sensitivity increases by about 10 times, and the melting valley is deeper.

[0071] Table 3. Upstream primer and probe sequences for single-tube detection of HBV 6 genotypes and 13 subtypes using 2D-PCR. Note:" a "The tag sequence is represented by lowercase English letters and is homologous to the fluorescent probe sequence. The lowercase underlined letters on the tag indicate mutated bases, while the uppercase double underlined letters in the upstream primer are artificially introduced mutated bases. The uppercase bold italic letters in the upstream primer indicate mismatches with target sequences of types C1, C2, and C5, and are consistent with type C6." b "Tm is the melting temperature of the tag sequence in the amplification product." c The probe is labeled with a fluorescent group at the 5' end and blocked at the 3' end with a phosphate group.

[0072] Table 4. Downstream primers for single-tube detection of HBV 6 genotypes and 13 subtypes using 2D-PCR. Note:" d "85C+160A-R is a downstream primer shared by 85C-F and 160A-F." e "HBV-specific + 293A + 321A-R is a downstream primer shared by HBV-specific-F, 293A-F, and 321A-F." f "499A+616G-R is a downstream primer shared by 499A-F and 616G-F." g "1107G+1127C+1155G+1173A-R is a downstream primer shared by 1107G-F, 1127C-F, 1155G-F and 1173A-F."

[0073] Example 3 Construction and optimization of two-dimensional PCR reaction system Using the HBV genotype reference sequences shown in Table 1 of Example 1 as a guide, 16 plasmids containing 6 genotypes and 13 subtypes were constructed using the pUC57 vector. Each of the 16 plasmids contains gene fragments with HBV-specific single nucleotide polymorphism (SNP) sites for types A1, A2, A3, A5, B1, B2, B3, B4, B7, C1, C2, C5, C6, D, E, and HBV type I. Each genotype or subtype plasmid contains nucleic acid fragments with 2-4 positive specific SNP sites for that type, synthesized by Shanghai Sangon Biotech. The 16 synthesized plasmids were used to establish a 2D PCR reaction system and optimize experimental conditions.

[0074] Magnesium ion concentration optimization experiment Using the C2 subtype plasmid as a template, the Mg in the two-dimensional PCR reaction system 2+ Concentrations of 1.0, 1.2, and 1.4 mM were set for testing. The melting curves are shown below. Figure 9 As shown, when Mg in the reaction system 2+ At a concentration of 1.2 mM, the melting valley was the deepest, with no non-specific valleys, resulting in the best outcome.

[0075] Optimization experiment of 5 U / μL IMMOLASE DNA polymerase dosage Taking the detection results of the C1 subtype plasmid in the Alexa fluor 568 fluorescence channel as an example, the plasmid concentration was 1.0 × 10⁻⁶. 1 ~1.0×10 5 The dosage of 5 U / μL IMMOLASE DNA polymerase in the reaction system was set at 0.5 μL and 1.0 μL / person, respectively. The results are as follows: Figure 10As shown, when 5 U / μL IMMOLASE DNA polymerase is added at 1.0 μL / person, the detection sensitivity is improved by more than 10 times, the melting valley is deeper, there is no non-specific valley, and the results are optimal.

[0076] Optimization experiment of 4×2.5 mM dNTPs dosage Taking the detection results of the C1 subtype plasmid in the Alexa fluor 568 fluorescence channel as an example, the plasmid concentration was 1.0 × 10⁻⁶. 1 ~1.0×10 5 The amounts of 4 × 2.5 mM dNTPs added to the reaction system were set at 0.75, 1.0, and 2.0 μL / person, respectively. The results are as follows: Figure 11 As shown, the detection sensitivity is highest, reaching 1.0 × 10⁻⁵, when 4 × 2.5 mM dNTPs are added at 1.0 μL / person. 1 The optimal result is achieved when the number of copies / μL is minimized and there are no nonspecific valleys.

[0077] Experiment on optimization of the amount of tagged and untagged primers 4.1 Optimization Experiment of HBV-Specific-F Tag Primer Dosage HBV-specific primers are specific to the hepatitis B virus, therefore all genotypes will produce a melting trough. Taking the C6 subtype plasmid as an example, the plasmid concentration is 1.0 × 10⁻⁶. 2 ~1.0×10 6 When 0.1 μL / person of 10 μM tag primer HBV-specific-F is added, the detection limit of HBV-specific-F is 1.0 × 10⁻⁶ copies / μL. 4 copies / μL (see copies / μL) Figure 12 A) When 0.15 μL / person of 10 μM HBV-specific-F tag primer is added, the limit of detection for HBV-specific-F is 1.0 × 10⁻⁶. 3 copies / μL (see copies / μL) Figure 12 B), which is 10 times more effective than adding 0.1 μL / person.

[0078] 4.2 Optimization Experiment of Tag Primer 3047T-F and Untagged Primer 3047T-R The 3047T site is a type D specific site, producing a specific melting valley at approximately 51°C in the HEX fluorescence channel. Taking the B2 subtype plasmid as an example, the plasmid concentration is 1.0 × 10⁻⁶. 1 ~1.0×10 5copies / μL. When the amounts of 10 μM tagged primer 3047T-F and 100 μM untagged primer 3047T-R added were 0.08 μL / person and 0.08 μL / person, respectively, a nonspecific melting valley was generated at approximately 51 °C in the HEX fluorescence channel (see [link to study]). Figure 13 A). To eliminate nonspecific melting valleys, the amount of 10 μM tagged primer 3047T-F was adjusted to 0.06 μL / person, and the amount of 100 μM untagged primer 3047T-R was adjusted to 0.05 μL / person. No nonspecific melting valleys were generated at approximately 51℃ in the HEX fluorescence channel, and the nonspecific valleys were eliminated (see [link to study]). Figure 13 B).

[0079] Taking the D-type plasmid as an example, the plasmid concentration is 1.0 × 10⁻⁶. 1 ~1.0×10 5 When 0.06 μL / person was added to the 10 μM labeled primer 3047T-F and 0.05 μL / person was added to the 100 μM unlabeled primer 3047T-R, a specific melting valley was generated at around 51℃ in the HEX fluorescence channel, with a detection limit of 1.0 × 10⁻⁶ copies / μL. 1 The number of copies / μL reached the detection requirement without any decrease in detection sensitivity (see [link]). Figure 13 C).

[0080] Fluorescent probe dosage optimization experiment Using the A2 subtype plasmid as the detection template, which contains the 499A, 436A, 616G sites and HBV-specific sites, the plasmid concentration was 1.0 × 10⁻⁶. 2 ~1.0×10 5 When 0.6 μL / person of 10 μM Alexa fluor 488 fluorescent probe was added, the Alexa fluor 488 fluorescence (blue curve) channel showed no melting valley (see [reference needed]). Figure 14 A). Under normal circumstances, the A2 subtype plasmid will produce specific valleys at the 499A and 436A sites in the Alexa fluor 488 fluorescence channel at approximately 36℃ and 66℃, respectively. Currently, only the 616G site and the HBV-specific melting valley are observed in the HEX fluorescence (green curve) channel. This result may be due to the extremely high brightness of the Alexa fluor 488 fluorescent dye. When 10 μM of the Alexa fluor 488 fluorescent probe is added to the reaction system at 0.6 μL / person, the resulting fluorescence intensity exceeds the detection limit of the PCR instrument, thus failing to effectively detect the target signal.

[0081] When the dosage of 10 μM Alexa fluor 488 fluorescent probe was adjusted to 0.2 μL / person, the Alexa fluor 488 fluorescence (blue curve) channel produced specific valleys at approximately 499A and 436A sites at around 36℃ and 66℃, respectively, with deep melting valleys. The HEX fluorescence (green curve) channel also showed a 616G site and an HBV-specific melting valley. (See...) Figure 14 B.

[0082] Single-tube 2D PCR reaction system for identifying 6 HBV genotypes and 13 subtypes Based on the optimization of the conditions of each component in the above reaction system, the total volume of the single-tube reaction system was determined to be 25 μL, and the amount of each component is shown in Table 5.

[0083] Table 5. Optimized 2D PCR reaction system for single-tube identification of 6 HBV genotypes and 13 subtypes Note: When the test sample is plasmid nucleic acid, add 5 μL template to 20 μL PCR reaction solution for PCR amplification; when the test sample is a clinical sample: add 5 μL 1×Immobuffer to 20 μL PCR reaction solution to wash the clinical sample for nucleic acid elution, and then transfer the entire mixture with magnetic beads after elution to a PCR reaction tube for PCR amplification.

[0084] Example 4: Two-dimensional PCR reaction program design Reaction program optimization Taking the C2 subtype plasmid as an example, the plasmid concentration is 1.0 × 10⁻⁶. 1 ~1.0×10 5 The fluorescence channels were Alexa fluor 488 and HEX. PCR amplification and melting curve analysis were performed according to the reaction system shown in Table 5 and the reaction procedure described in Table 6 of Example 3.

[0085] The results are as follows Figure 15 As shown in Figure A, the melting curve of site 1041C has a detection limit of 1.0 × 10⁻⁶. 3 copies / μL; Figure C shows the melting curve of HBV-specific sites, with a detection limit of 1.0 × 10⁻⁶. 2 The reaction rate was 100 copies / μL, and a nonspecific valley was observed at approximately 51°C. The reaction procedure shown in Table 6 was improved, and the optimized reaction procedure is shown in Table 7.

[0086] The optimized reaction procedure (excluding the magnetic adsorption step) was used, with C2 subtype plasmid as template and plasmid concentration of 1.0 × 10⁻⁶. 1 ~1.0×10 5copies / μL, fluorescence channels were Alexa fluor 488 and HEX fluorescence channels. Results are as follows. Figure 15 As shown in Figure B, the melting curve of site 1041C is displayed; the detection limit is 1.0 × 10⁻⁶. 1 The detection sensitivity was improved by 100 times, and the melting curve was relatively standard; Figure D shows the melting curve of HBV-specific sites, with a detection limit of 1.0 × 10⁻⁶. 1 The detection sensitivity is improved by 10 times with copies / μL, and the melting curve is relatively standard with no nonspecific valleys.

[0087] Table 6. Two-dimensional PCR reaction program before optimization Table 7. Procedure for 2D PCR amplification and melting curve analysis of single-tube clinical samples for identifying HBV genotypes and subtypes. Adjustment of reaction procedures under sample adaptation For the detection of clinical samples, this invention uses magnetic bead amplification. After PCR amplification, the PCR reaction tube is placed on a magnetic rack and magnetically attracted for 3 minutes to allow the magnetic beads to accumulate at the bottom of the tube before melting curve analysis. The total reaction time can be controlled within 3 hours.

[0088] Taking clinical sample No. 96 (a patient at Shanghai East Hospital, a remaining sample after HBV DNA quantification, with low concentration and C2 subtype genotype) as an example, two-dimensional PCR detection was performed using the reaction system shown in Table 5 of Example 3 and the reaction procedure shown in Table 7 of this example. In clinical sample No. 96, magnetic beads loaded with viral nucleic acid were obtained using nucleic acid extraction or purification reagents (S1003, Sansure Biotech Inc., China). The eluted DNA was used as a template for non-magnetic amplification. After 2D PCR detection, the results were found to be poor. Subsequently, 1×Immobuffer solution was used for nucleic acid elution. The eluted DNA was used as a template for non-magnetic amplification. After the PCR amplification procedure, the melting curve analysis procedure was directly performed. The results are as follows: Figure 16 As shown in Figure A, only melting valleys at sites 1041C and 293A can be detected, and these melting valleys are relatively shallow.

[0089] Magnetic amplification was used, where viral DNA was extracted from clinical samples using nucleic acid extraction or purification reagents (S1003, Sansure Biotech Inc., China). The obtained viral DNA-loaded magnetic beads were directly placed in the reaction solution for magnetic amplification. After PCR amplification, the PCR reaction tube was placed on a magnetic rack for 3 minutes to allow the magnetic beads to accumulate at the bottom of the tube. Melting curve analysis was then performed, detecting melting valleys at 1041C, 293A, and HBV-specific sites. These melting valleys were deep and well-defined, classifying the sample as C2 subtype (see [link to relevant documentation]). Figure 16 B). Therefore, magnetic amplification, by adding a magnetic adsorption process after the PCR procedure, can greatly improve detection sensitivity.

[0090] Example 5: Establishment of HBV Genotyping Method The Tm values ​​of the same specific single nucleotide polymorphism site detected in different concentrations and plasmids were statistically analyzed, and their average values ​​were calculated. The Tm values ​​of each specific single nucleotide polymorphism site differed by more than 3°C. Combined with the different fluorescence channels, the result interpretation rules for 6 HBV genotypes (A, B, C, D, E, I) and 13 genotypes (A1, A2, A3, A5, B1, B2, B3, B4, B7, C1, C2, C5, C6) were formulated, as shown in Table 8.

[0091] Using the plasmids loaded with type A1, A2, A3, A5, B1, B2, B3, B4, B7, C1, C2, C5, C6, D, E, and type I constructed in Example 2 as templates, two-dimensional PCR detection was performed using the reaction system (Table 5) and reaction procedure (Table 7) determined in Examples 3 and 4 to verify the result interpretation rules for 6 HBV genotypes and 13 subtypes.

[0092] Table 8. Rules for interpreting results of 6 HBV genotypes and 13 subtypes Note: 1. The specific site base sequence number refers to the whole genome sequence number of the A1 gene subtype (KP234050); 2. The 499A site is only used for the interpretation of the results of the A1, A2 and B2 subtypes. When used for the interpretation of the B2 gene subtype results, it has an AND / OR relationship with the 1632A site, that is: (HBV specific positive, 321A positive, 499A positive, 1632A positive), (HBV specific positive, 321A positive, 499A positive), (HBV specific positive, 321A positive, 1632A positive) are all judged as B2 subtype.

[0093] Test results as follows Figure 17 As shown. Based on the interpretation rules in Table 8, where the B2 subtype plasmid is used as the reaction template, the results are as follows. Figure 17As shown in Figure F, melting valleys were observed at 67.2℃ and 62.8℃ in the HEX fluorescence channel, 35.7℃ in the Alexa fluor 488 fluorescence channel, and 61.9℃ in the Alexa fluor 568 fluorescence channel, corresponding to HBV-specific sites, 321A, 499A, and 1632A, respectively. The result identified HBV subtype B2. Using the C2 subtype plasmid as a template, the detection results are as follows... Figure 17 As shown in K, melting valleys were observed at 67.2℃ in the HEX fluorescence channel, 66℃ in the Alexa fluor 568 fluorescence channel, and 60.8℃ in the Alexa fluor 488 fluorescence channel, corresponding to HBV specific sites, 293A site, and 1041C site, respectively. The result indicates that it is HBV C2 subtype.

[0094] The detection limits for HBV genotype-specific single nucleotide polymorphism sites for 6 genotypes and 13 genotype subtypes are shown in [link to relevant documentation]. Figure 19 As shown.

[0095] The above experimental results show that the HBV genotyping method established in this invention can effectively detect 6 HBV genotypes and 13 subtypes.

[0096] Example 6: Application of HBV genotyping methods in clinical sample testing Clinical sample preparation and nucleic acid extraction This study collected serum samples from 1072 patients who underwent HBV DNA quantification at Shanghai East Hospital between January 2024 and August 2025, including those with HBV DNA quantification results greater than 5.0 × 10⁻⁶. 3 Of the 716 samples with a concentration of IU / mL, these were HBV DNA positive samples, with HBV DNA quantification results less than 2.0 × 10⁻⁶. 1 Of the 356 samples with a concentration of IU / mL, all were HBV DNA negative. Duplicate samples from the same patient were excluded. Samples were stored at -20°C. For HBV DNA quantification results of ~10... 7 IU / mL and ~10 8 For samples with IU / mL, dilution with standard newborn calf serum 10-fold and 100-fold respectively is performed before HBV genotype and subtype detection to prevent nonspecific amplification.

[0097] HBV DNA was extracted using the Natch CS3 fully automated nucleic acid extractor from Sansure Biotech Inc. and the matching nucleic acid extraction or purification reagent S1003. The operation was strictly carried out in accordance with the reagent instructions. The PCR-mix reaction solution was prepared using the reaction system determined in Example 3 (Table 5) for nucleic acid elution. Then, all the eluted magnetic bead-containing mixture was transferred to the PCR reaction tube. Negative and positive controls were set up at the same time.

[0098] Analysis of 2D PCR results from 716 HBV DNA-positive samples The PCR reaction tubes containing all the magnetic beads were placed in the Shanghai Hongshi fully automated medical PCR system and amplified according to the procedure listed in Table 6. Melting curve signals were collected. The HBV genotyping success rate was 94.83% (679 / 716), mainly type B and type C. The detection results of 716 HBV DNA positive samples are shown in Table 9.

[0099] HBV type A is mainly prevalent in Northern Europe, North America, and parts of Africa, while types B and C are dominant in East Asia and Southeast Asia. Type D has the widest distribution, covering multiple continents globally. Collecting HBV patient samples from within China for consistency verification of type A testing has certain limitations. The 716 HBV DNA-positive samples tested in this experiment came from Shanghai East Hospital. One case showed a mixed B / A genotype, consistent with the sequencing results, indicating that this method can detect HBV type A samples.

[0100] Table 9. Detection results and distribution of HBV genotypes and subtypes in 716 samples. Methodological consistency analysis A total of 205 samples were selected for Sanger sequencing, covering all HBV genotypes, subtypes, mixed genotypes, and untyped samples detected in this experiment. The results of 2D PCR and Sanger sequencing for single genotype and subtype samples showed strong methodological consistency (Kappa = 1.000, P < 0.001); the results of both methods for all samples also showed strong consistency (Kappa = 0.841, P < 0.001), with discrepancies occurring in mixed and untyped samples. Melting curves of 2D PCR and their comparison with Sanger sequencing results for some samples are shown in the figure below. Figures 20-28 .

[0101] Specificity test 356 HBV DNA-negative samples were tested, and all results showed no HBV genotyping, with a negative concordance rate of 100%. For HCV RNA-positive samples (4.4 × 10⁻⁶), the results showed no HBV genotyping. 4 IU / mL), HIV-1 RNA positive sample (2.3×10 4 IU / mL), CMV DNA positive sample (8.0×10 3 EBV DNA positive samples (copies / mL), EBV DNA positive samples (5.0×10) 3The results (copies / mL) were repeated three times, and all results showed no HBV genotyping. There was no cross-reactivity with HCV, HIV-1, CMV, or EBV. Melting curves are shown below. Figure 29 .

[0102] Repeatability test Repeat testing was performed on 70 previously tested samples, including 55 HBV DNA positive samples (9 B2 subtype, 6 B type, 10 D type, 2 B2 / B4 mixed type, 1 B2 / A mixed type, 1 C1 / C2 mixed type, 8 C2 subtype, 8 C1 subtype, 5 C type, and 5 untyped samples) and 15 HBV DNA negative samples. The results showed that HBV genotype was not detected in any of the 15 negative samples, and the genotype results of the 55 positive samples were consistent. The overall concordance rate of the repeatability test results was 100% (70 / 70).

Claims

1. A specific primer-probe set for identifying 6 genotypes and 13 subtypes of hepatitis B virus, the primer-probe set comprising 17 upstream primers, 11 downstream primers, and 3 probes; the nucleotide sequences of the 17 upstream primers are SEQ ID NO. 1-17, the nucleotide sequences of the 11 downstream primers are SEQ ID NO. 18-28, and the nucleotide sequences of the 3 probes are SEQ ID NO. 29-31.

2. The primer and probe set as described in claim 1, wherein among the 17 upstream primers and 11 downstream primers, SEQ ID NO.1, SEQ ID NO.8, SEQ ID NO.6, and SEQ ID NO.12, and SEQ ID NO.21, SEQ ID NO.18, SEQ ID NO.20, and SEQ ID NO.19 are used for specific detection of HBV A1 gene subtypes; SEQ ID NO. 1, SEQ ID NO. 7, SEQ ID NO. 6 and SEQ ID NO. 12, and SEQ ID NO. 21, SEQ ID NO. 20 and SEQ ID NO. 19 are used for the specific detection of HBV A2 genotype; SEQ ID NO. 15, SEQ ID NO. 6, and SEQ ID NO. 12, along with SEQ ID NO. 27, SEQ ID NO. 20, and SEQ ID NO. 19, are used for the specific detection of HBV A3 genotypes. SEQ ID NO. 10, SEQ ID NO. 6, and SEQ ID NO. 12, along with SEQ ID NO. 23, SEQ ID NO. 20, and SEQ ID NO. 19, are used for the specific detection of HBV A5 genotypes. SEQ ID NO. 6 and SEQ ID NO. 12, along with SEQ ID NO. 20 and SEQ ID NO. 19, are used for the specific detection of HBV A genotypes. SEQ ID NO. 15, SEQ ID NO. 11, and SEQ ID NO. 12, along with SEQ ID NO. 26 and SEQ ID NO. 19, are used for the specific detection of HBV B1 genotypes; SEQ ID NO. 1, SEQ ID NO. 16, SEQ ID NO. 11 and SEQ ID NO. 12, and SEQ ID NO. 21, SEQ ID NO. 24 and SEQ ID NO. 19 are used for the specific detection of HBV B2 genotype; SEQ ID NO. 4, SEQ ID NO. 11, and SEQ ID NO. 12, along with SEQ ID NO. 23 and SEQ ID NO. 19, are used for the specific detection of the HBV B3 genotype. SEQ ID NO. 3, SEQ ID NO. 11, and SEQ ID NO. 12, along with SEQ ID NO. 23 and SEQ ID NO. 19, are used for the specific detection of HBV B4 genotypes. SEQ ID NO. 14, SEQ ID NO. 11, and SEQ ID NO. 12, along with SEQ ID NO. 23 and SEQ ID NO. 19, are used for the specific detection of the HBV B7 genotype. SEQ ID NO. 11 and SEQ ID NO. 12, along with SEQ ID NO. 19, are used for the specific detection of HBV B genotype; SEQ ID NO. 13, SEQ ID NO. 17 and SEQ ID NO. 12, and SEQ ID NO. 25 and SEQ ID NO. 19) are used for the specific detection of HBV C1 genotypes; SEQ ID NO. 5, SEQ ID NO. 17 and SEQ ID NO. 12, and SEQ ID NO. 22 and SEQ ID NO. 19) are used for the specific detection of HBV C2 gene subtypes; SEQ ID NO. 3, SEQ ID NO. 17 and SEQ ID NO. 12, and SEQ ID NO. 23 and SEQ ID NO. 19) are used for the specific detection of HBV C5 genotypes; SEQ ID NO. 16, SEQ ID NO. 17 and SEQ ID NO. 12, and SEQ ID NO. 24 and SEQ ID NO. 19) are used for the specific detection of HBV C6 gene subtypes; SEQ ID NO. 17 and SEQ ID NO. 12, along with SEQ ID NO. 19, are used for the specific detection of HBV C genotype; SEQ ID NO. 9 and SEQ ID NO. 12, along with SEQ ID NO. 28 and SEQ ID NO. 19, are used for the specific detection of HBV D genotype. SEQ ID NO. 2 and SEQ ID NO. 12, along with SEQ ID NO. 18 and SEQ ID NO. 19, are used for the specific detection of HBV E genotypes; SEQ ID NO. 13, SEQ ID NO. 3 and SEQ ID NO. 12, and SEQ ID NO. 25, SEQ ID NO. 23 and SEQ ID NO. 19 are used for specific detection of HBV I genotype; Of the 17 upstream primers, mutant bases were introduced near the 3' end of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 13, SEQ ID NO. 15, SEQ ID NO. 16 and SEQ ID NO. 17 at the single nucleotide polymorphism sites corresponding to the HBV genotype and subtype. In the primer-probe set, each of the 17 upstream primers is equipped with a different tag. The nucleotide sequence of the tag is homologous to the probe sequence. Different types and numbers of mutant bases are formed on the tags, so that the HBV genotypes and subtypes to be tested have different melting temperatures.

3. A reaction system for detecting 6 genotypes and 13 subtypes of hepatitis B virus, the reaction system containing a primer and probe set for detecting the 6 genotypes and 13 subtypes of hepatitis B virus, the primer and probe set comprising 17 upstream primers, 11 downstream primers and 3 probes; the nucleotide sequences of the 17 upstream primers are SEQ ID NO. 1-17, the nucleotide sequences of the 11 downstream primers are SEQ ID NO. 18-28, and the nucleotide sequences of the 3 probes are SEQ ID NO. 29-31.

4. The reaction system as described in claim 3, wherein the reaction system contains an immobuffer solution, a magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexa fluor 568, probe-Alexa fluor 488, 17 upstream primers, 11 downstream primers, and deionized water; the ratio of the immobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexa fluor 568, and probe-Alexa fluor 488 is 15~30∶3~9∶5~15∶5~15∶3~9∶1~10∶0.5~5.

5. A method for identifying 6 genotypes and 13 subtypes of hepatitis B virus, the method being used to detect plasmid nucleic acid samples, the method comprising the following steps: S1. Prepare a reaction system containing Immobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexafluor 568, probe-Alexafluor 488, and tagged and untagged primers for detecting 6 genotypes and 13 subtypes of hepatitis B virus to obtain 2D PCR reaction solution. S2, add the sample to be tested to the 2D PCR reaction solution prepared in S1; S3, set the PCR amplification program as follows: 95℃ for 10 min, one cycle; 95℃ for 15 s, 61℃ for 30 s, 5 cycles; 95℃ for 15 s, 72℃ for 1 s, 61℃ for 30 s, 35 cycles; 28℃ for 10 s, one cycle; perform the PCR reaction according to the above program. S4. Set the melting curve analysis program as follows: 95℃ for 10 s, one cycle; 28℃ for 4 min, one cycle; continuously increase the temperature to 70℃ at a rate of 0.1℃ / s, continuously collecting fluorescence signals; 40℃ for 30 s, one cycle; perform melting curve analysis according to the above program to obtain melting curve data. S5. Result Interpretation: Based on the interpretation rules for the 6 HBV genotypes and 13 subtypes, interpret the melting curve data obtained in step S4 to determine the HBV genotype and subtype in the sample to be tested. The interpretation rules for the 6 HBV genotypes and 13 subtypes are shown in the table below: 。 6. The identification method as described in claim 5, wherein the ratio of the Imobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexa fluor 568 and probe-Alexa fluor 488 is 15~30∶3~9∶5~15∶5~15∶3~9∶1~10∶0.5~5.

7. A method for identifying 6 genotypes and 13 subtypes of hepatitis B virus, said method for detecting clinical samples, said method comprising the following steps: S1, Preparation of test samples: HBV virus nucleic acid is extracted using a viral nucleic acid extraction kit, and the magnetic beads loaded with HBV virus nucleic acid are used as test samples. S2, prepare a reaction system containing Immobuffer solution, magnesium ion solution, dNTPs, DNA polymerase, probe-HEX, probe-Alexafluor 568, probe-Alexafluor 488, and upstream and downstream primers for detecting 6 genotypes and 13 subtypes of hepatitis B virus, and obtain 2D PCR reaction solution; S3, Add the test sample: Add the 2D PCR reaction solution obtained in step S2 to the test sample obtained in step S1. S4. Set the PCR amplification program as follows: 95℃ for 10 min, one cycle; 95℃ for 15 s, 61℃ for 30 s, 5 cycles; 95℃ for 15 s, 72℃ for 1 s, 61℃ for 30 s, 35 cycles; 28℃ for 10 s, one cycle; perform the PCR reaction according to the above program. S5. After the PCR reaction is complete, place the container containing the PCR reaction solution on the magnetic rack and magnetically attract it for 3 minutes to allow the magnetic beads to gather at the bottom of the container. S6. Set the melting curve analysis program as follows: 95℃ for 10 s, one cycle; 28℃ for 4 min, one cycle; continuously increase the temperature to 70℃ at a rate of 0.1℃ / s, continuously collecting fluorescence signals; 40℃ for 30 s, one cycle; perform melting curve analysis according to the above program to obtain melting curve data. S7. Result Interpretation: Based on the interpretation rules for the 6 HBV genotypes and 13 subtypes, interpret the melting curve data obtained in step S6 to determine the HBV genotype and subtype in the sample to be tested. The interpretation rules for the 6 HBV genotypes and 13 subtypes are shown in the table below: 。 8. The application of the specific primer-probe set as described in claim 1 in the preparation of reagents for detecting 6 genotypes and 13 subtypes of hepatitis B virus, wherein the primer-probe set comprises 17 upstream primers, 11 downstream primers, and 3 probes; the nucleotide sequences of the 17 upstream primers are SEQ ID NO. 1-17, the nucleotide sequences of the 11 downstream primers are SEQ ID NO. 18-28, and the nucleotide sequences of the 3 probes are SEQ ID NO. 29-31.

9. A kit for detecting 6 genotypes and 13 subtypes of hepatitis B virus based on two-dimensional PCR, the kit comprising the following components: dNTPs, DNA polymerase, MgCl2, PCR reaction buffer, and the specific primer and probe set for detecting 6 genotypes and 13 subtypes of hepatitis B virus as described in the first aspect of the present invention; The specific primer and probe set includes 17 upstream primers, 11 downstream primers, and 3 probes; the nucleotide sequences of the 17 upstream primers are SEQ ID NO. 1-17, the nucleotide sequences of the 11 downstream primers are SEQ ID NO. 18-28, and the nucleotide sequences of the 3 probes are SEQ ID NO. 29-31.

10. A kit for detecting 6 genotypes and 13 subtypes of hepatitis B virus based on two-dimensional PCR, the kit containing the reaction system for detecting 6 genotypes and 13 subtypes of hepatitis B virus as described in claim 3.