Application of blast resistance gene OsICMT in genetic improvement of rice

By overexpressing the OsICMT gene in rice to regulate rice false smut resistance, the problem of insufficient rice false smut resistance genes was solved, and a new variety with high resistance to rice false smut was bred, thus enhancing the disease resistance of rice.

CN122189084BActive Publication Date: 2026-07-28CHINA NAT RICE RES INST
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610678224.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-18
Publication Date
2026-07-28
Estimated Expiration
2046-05-18

AI Technical Summary

Technical Problem

The limited number of rice false smut resistance genes in existing technologies restricts the breeding process of disease-resistant varieties, and chemical control is the main method with a lack of effective gene resources.

Method used

By overexpressing the OsICMT gene in rice to regulate its resistance to rice false smut, a recombinant vector was constructed and introduced into rice cells to cultivate new varieties highly resistant to rice false smut.

Benefits of technology

It significantly enhances the resistance of rice to rice false smut, provides a new approach to disease-resistant breeding, and improves the resistance of rice to rice false smut.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122189084B_ABST
    Figure CN122189084B_ABST
Patent Text Reader

Abstract

The application discloses application of a rice take-all resistance gene OsICMT in genetic improvement of rice and belongs to the technical field of genetic engineering. The CDS region nucleotide sequence of the rice OsICMT gene is shown as SEQ ID NO. 2. The application research finds that the expression amount of the OsICMT gene is significantly increased after inoculation of a take-all fungus, and the OsICMT gene exists in interaction with an effector Uv8b_4970 of the take-all fungus, indicating that the OsICMT gene is involved in regulation of a defense response of the rice to the take-all fungus; the OsICMT gene function loss can weaken the defense ability of the rice to the take-all disease, and overexpression of the OsICMT gene can significantly enhance the resistance of the rice to the take-all fungus. It can be seen that the OsICMT gene positively regulates the rice take-all disease resistance, and can be used as a candidate gene for cultivation of a new rice variety resistant to the take-all disease, so as to improve the resistance of the rice to the take-all fungus and a disease caused by the take-all fungus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application of the rice blast resistance gene OsICMT in rice genetic improvement. Background Technology

[0002] Rice, as one of the world's most important food crops, provides a staple food source for more than half of the world's population. However, its growth process has long been threatened by various pathogenic microorganisms. Rice false smut is caused by the fungus *Vibrio oryzae* (rice false smut). Ustilaginoidea virens Fungal diseases caused by infecting the panicle of rice.

[0003] Currently, chemical control remains the primary means of controlling rice false smut. Molecular design breeding using resistance genes is a core approach to achieving sustainable disease management. To date, the number of reported rice false smut resistance genes is very limited, severely restricting the breeding progress of resistant varieties. With the deepening research into the rice-false smut interaction mechanism, an important theoretical foundation has been laid for discovering novel resistance genes and innovative breeding strategies.

[0004] Some genes in rice may play a role in resisting rice false smut. For example, invention patent CN202211062632.1 discloses the application of the rice scaffold protein encoding gene OsRACK1A in improving rice resistance to rice false smut. This invention improves rice resistance to rice false smut by overexpressing the rice scaffold protein encoding gene OsRACK1A. Studies have found that the OsRACK1A gene positively regulates rice resistance to rice false smut; overexpression of the OsRACK1A gene can enhance rice resistance to rice false smut, and this gene improves rice resistance without affecting rice yield or agronomic traits, providing a new approach for disease-resistant rice breeding. Therefore, discovering new rice false smut-resistant genes is of great significance for the control of rice false smut and the breeding of new disease-resistant varieties. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the rice false smut resistance gene OsICMT in rice genetic improvement, so as to solve the problems existing in the prior art. The OsICMT gene positively regulates rice false smut resistance. By overexpressing the OsICMT gene, new rice varieties resistant to rice false smut can be bred, thereby improving the resistance of rice to rice false smut fungus and the diseases it causes.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides the application of the rice OsICMT gene in any of the following: (1) Application in improving rice resistance to rice false smut; (2) Application in the cultivation of rice resistant to rice false smut; (3) Application in the genetic improvement of rice false smut resistance; The nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.2.

[0007] This invention also provides the use of the protein encoded by the rice OsICMT gene in any of the following: (1) Application in improving rice resistance to rice false smut; (2) Application in the cultivation of rice resistant to rice false smut; (3) Application in the genetic improvement of rice false smut resistance; The nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.2.

[0008] The present invention also provides the use of a recombinant vector containing the rice OsICMT gene in any of the following: (1) Application in improving rice resistance to rice false smut; (2) Application in the cultivation of rice resistant to rice false smut; (3) Application in the genetic improvement of rice false smut resistance; The nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.2.

[0009] This invention also provides the application of recombinant engineered bacteria containing the rice OsICMT gene in any of the following: (1) Application in improving rice resistance to rice false smut; (2) Application in the cultivation of rice resistant to rice false smut; (3) Application in the genetic improvement of rice false smut resistance; The nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.2.

[0010] Preferably, the resistance of rice to rice false smut is improved by overexpressing the rice OsICMT gene in rice.

[0011] Preferably, rice resistant to rice false smut is obtained by introducing the rice OsICMT gene into rice, screening for and retaining rice with high expression of the rice OsICMT gene.

[0012] The present invention also provides a method for improving the resistance of rice to rice false smut, comprising overexpressing the rice OsICMT gene in rice to improve the resistance of the rice to rice false smut; wherein the nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.2.

[0013] Preferably, the overexpression method includes: cloning the rice OsICMT gene into an expression vector to construct a recombinant vector; then introducing the recombinant vector into rice cells through callus transformation, and cultivating the rice cells into plants.

[0014] The present invention also provides a method for cultivating rice resistant to rice false smut, comprising overexpressing the rice OsICMT gene in rice to increase the expression level of the rice OsICMT gene, and obtaining rice with high expression of the rice OsICMT gene as rice resistant to rice false smut; wherein, the nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.2.

[0015] Preferably, the overexpression method includes: cloning the rice OsICMT gene into an expression vector to construct a recombinant vector; then introducing the recombinant vector into rice cells through callus transformation, and cultivating the rice cells into plants.

[0016] The present invention discloses the following technical effects: This invention successfully identified a key gene, OsICMT, that significantly regulates rice resistance to rice false smut. Experimental results showed that OsICMT gene expression significantly increased after infection with *Strombus oryzae*, and that it interacts with the *Strombus oryzae* effector Uv8b_4970. Loss of function of the OsICMT gene weakens rice's defense against rice false smut, while overexpression of the OsICMT gene significantly enhances rice's resistance to *Strombus oryzae*. This indicates that the OsICMT gene positively regulates rice resistance to rice false smut, providing valuable genetic resources and theoretical support for breeding new rice varieties with high resistance to the pathogen. The OsICMT gene can be used as a candidate gene for rice genetic improvement to breed new varieties and enhance rice resistance to *Strombus oryzae* and the diseases it causes. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The graph shows the changes in OsICMT gene expression after infection with rice false smut; WX98 represents uninfected wild-type rice; 1dpi-13dpi represent the number of days after infection. Figure 2Plotting the two-hybrid interaction between OsICMT and the yeast effector Uv8b_4970 of rice false smut; SD(-WL) is a two-deficient medium, SD(-WLHA) is a four-deficient medium, and 1× is a 1-fold diluted yeast suspension (1×10⁻⁶). 6 One yeast cell / mL), 10×dilu. is a 10-fold diluted yeast suspension (1×10). 5 (each yeast cell / mL) Figure 3 The figure shows the sequence information of OsICMT knockout positive plants and the results of OsICMT transcription level in OE-OsICMT overexpressing positive plants; where A: target site location and sequence information in the construction of OsICMT knockout vector; B: sequence alignment results between knockout positive plants and wild type; C: changes in OsICMT transcription level in OE-OsICMT overexpressing plants. Figure 4 Figure 1 shows the results of rice false smut resistance identification of osicmt mutant and OE-OsICMT plants. In figure 2, A: Phenotypic diagram of osicmt mutant and OE-OsICMT plants after inoculation with rice false smut fungus; B: Statistical results of susceptible spikelets in figure A. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Example 1: Detection of OsICMT gene expression level after infection with rice false smut. (1) Select suitable rice plants from the field 5-7 days before the seedlings break, dig them up with their roots, put them in a bucket and transplant them into the greenhouse. Generally, rice should be transplanted about 3 days before inoculation. (2) Take out the cultured *Aspergillus oryzae* inoculum and pour it into a small cell-wall breaker to break it up. The main purpose is to break the *Aspergillus oryzae* hyphae into small pieces to prevent large pieces of hyphae from clogging the syringe needle. Use fresh PS liquid potato medium (cut 200 g of potatoes into small pieces, boil them in distilled water until the potatoes soften, filter the supernatant with gauze, collect the supernatant and add 20 g of sucrose, and make up to 1 L) to adjust the number of conidia in the *Aspergillus oryzae* hyphae and spore mixture to 1×10⁻⁶. 6 Units / mL, and finally bottled for later use; (3) Use a syringe to draw up the prepared mycelium and spore solution and inject it into a suitable spike. When injecting, inject from the upper middle part of the spike and stop injecting when the spore solution overflows, so that the spike is filled with spore solution. After injection, nail a label with the name and date to the flag leaf of the spike for easy recording and observation; (4) Shading and moisturizing are required for the first 2 days after inoculation. After inoculation, cover the greenhouse roof with the shading curtain to maintain the room temperature at 22℃, and spray water for about 20 minutes every 3 hours; 2 days later, open the shading curtain to adjust the room temperature to 28℃, and spray water for about 15 minutes every 4 hours. During this period, there are 12 hours of light and 12 hours of darkness. (5) Three independent rice panicles were taken 0, 1, 3, 5, 7, 9, 11 and 13 days after inoculation, and the heads and tails were removed with scissors and then frozen in liquid nitrogen. (6) RNA was extracted from rice samples at different time points after inoculation, reverse transcribed, and then qRT-PCR was performed to detect the difference in OsICMT expression levels at different time points.

[0025] The primer sequences are as follows: qOsICMT-F: 5'-CATTGGTGCTGTGGCGATTC-3' (SEQ ID NO.4); qOsICMT-R: 5'-CTGAGTGCACTTTCTGTGCG-3' (SEQ ID NO.5); qOsUBQ-F: 5'-AAGAAGCTGAAGCATCCAGC-3' (SEQ ID NO. 6); qOsUBQ-R: 5'-CCAGGACAAGATGATCTGCC-3' (SEQ ID NO. 7).

[0026] Experimental results are as follows Figure 1 As shown, the expression level of OsICMT increased significantly after inoculation with rice false smut, indicating that it may play an important role in the infection process of rice false smut.

[0027] Example 2: Yeast two-hybrid screening library reveals interaction between OsICMT and rice false smut effector Uv8b_4970. (1) Vector construction: Using Nipponbare genomic DNA as a template, the OsICMT fragment was amplified using AD-OsICMT-F / R primers. The pGADT7 vector was double-digested with BamHI and EcoRI restriction enzymes (Thermo, catalog numbers R3136L and R3101L, respectively; see product instructions for specific operation methods). The linearized vector was then purified and recovered. The recovered OsICMT fragment and the digested pGADT7 vector were then processed using pEASY. Seamless cloning and ligation were performed using the ligase (TransGene, CU201) from the Basic Seamless Cloning and Assembly Kit. After transformation, single colonies were picked and cultured, and plasmids were extracted for sequencing verification. Clones with correct sequences were used as the AD-OsICMT vector for later use, followed by yeast two-hybrid library screening experiments.

[0028] The primer sequences are as follows: AD-OsICMT-F: 5'-gccatggaggccagtgaattcATGCGGCATCTGCCTCTGC-3' (SEQ IDNO.8); AD-OsICMT-R: 5'-cagctcgagctcgatggatccTCATTCTATAAAAGGTAATCCTGAGTGC-3' (SEQ ID NO. 9).

[0029] (2) Y2HGold strain culture: A single clone of Y2HGold strain was picked and cultured overnight at 30℃ and 250 rpm with shaking in 5 mL of YPDA liquid medium. 5 μL of the shaken yeast culture was added to 50 mL of YPDA liquid medium and cultured at 30℃ and 250 rpm for 16 h until OD was reached. 600 Reach 0.15; centrifuge at 3000 rpm for 5 min at room temperature, discard the supernatant, resuspend the cells in 100 mL of YPDA liquid medium, and incubate at 250 rpm for 3 h at 30℃ until OD reaches 0.15; 600 Reaching 0.5; (3) Y2HGold cell collection: Centrifuge at 3000 rpm for 5 min at room temperature, discard the supernatant, add 50 mL ddH2O to resuspend the cells, centrifuge, and discard the supernatant; (4) Preparation of competent yeast cells: Add 1.1×TE / LiAc (including 330 μL 10×TE, 330 μL 10×LiAc and 2340 μL ddH2O) to the cells in (3); dispense the mixture into two 1.5 mL centrifuge tubes, centrifuge at the highest speed for 15 s, discard the supernatant; then add 600 μL 1.1×TE / LiAc solution to resuspend the cells to obtain competent cells; (5) Yeast transformation: Add the following components to the resuspended cells in (4): 10 μL of rice cDNA library, 6 μg of BD plasmid and 20 μL of ssDNA; add 2.5 mL of PEG / LiAc (including 250 μL of 10×LiAc, 2 mL of 50%PEG3350 and 250 μL of ddH2O) to each tube and mix gently; incubate at 30℃ for 45 min (invert and mix every 15 min); add 160 μL of LDMSO, mix well, and incubate at 42℃ for 20 min (invert and mix every 10 min); centrifuge at 1000 rpm for 5 min, discard the supernatant, add 3 mL of YPD plus medium to resuspend the cells, and culture at 30℃ and 250 rpm for 2 h; (6) Spreading: After centrifugation at 1000 rpm for 5 min, discard the supernatant and add 6 mL of 0.9% sterile NaCl to resuspend the bacterial cells; spread them on triple-deficient SD / -His / -Leu / -Trp and quadruple-deficient SD / -Ade / -His / -Leu / -Trp medium and incubate at 30℃ for 3-5 days; (7) Detection: Select single clones with toothpicks, place them in 100 μL of 0.2% sodium hydroxide solution, boil at 100℃ for 10 min, centrifuge at 12000 rpm for 1 min, and the supernatant is yeast DNA. Perform PCR with the corresponding primers and send it to the company for sequencing.

[0030] The primer sequences are as follows: AD-screen-F: 5'-TGATGAAGATACCCCACC-3' (SEQ ID NO. 10); AD-screen-R: 5'-AGATGGTGCACGATGCACAG-3' (SEQ ID NO. 11).

[0031] Preliminary results from yeast two-hybrid screening suggest a potential interaction between OsICMT and the rice false smut effector Uv8b_4970. To validate this result, point-to-point verification was performed on two-deficient (SD / -Leu / -Trp) and four-deficient (SD / -Ade / -His / -Leu / -Trp) media, confirming the interaction. Figure 2 As shown.

[0032] Example 3: Construction of OsICMT gene knockout mutants and overexpression plants The amino acid sequence of rice OsICMT protein is shown in SEQ ID NO.1; the nucleotide sequence of the CDS region of the OsICMT gene is shown in SEQ ID NO.2; and the genomic DNA sequence of rice OsICMT is shown in SEQ ID NO.3, which includes non-coding regions such as introns.

[0033] (1) To elucidate the biological function of the OsICMT gene in rice growth, development, and resistance to rice false smut, this invention constructed a rice OsICMT gene knockout mutant. The knockout mutant was constructed according to the following method: First, based on the OsICMT gene number (LOC_Os04g51380), the reference sequence of the OsICMT gene in Nipponbare rice was downloaded from the MSU website. Then, suitable knockout target sites for the OsICMT gene were screened using the CRISPR-P website, and the target site detection primer OsICMT-check-F / R was designed. PCR amplification was performed using genomic DNA from japonica rice TP309 as a template. Finally, the amplified target band was recovered, purified, and sequenced to confirm that the target site sequence remained unchanged in TP309. Subsequently, the target gene was knocked out using CRISPR / Cas9 gene editing technology. A specific sgRNA target site (5'-CGCCTTTGCCCAGATCCCGT-3', SEQ ID NO.12) was designed targeting the OsICMT gene coding region, and an OsICMT gene knockout vector was constructed by transforming it into the pYLCRISPR / Cas9-MH vector. Finally, the OsICMT knockout mutant was obtained by transforming the vector into TP309 plants.

[0034] The primer sequences are as follows: OsICMT-check-F: 5'-CCCGGTCCCTAGCAGAGAAG-3' (SEQ ID NO. 13); OsICMT-check-R: 5'-CCAAAGCAGCGAGGAAAACA-3' (SEQ ID NO. 14); MH-OsICMT-F: 5'-ggcaCGCCTTTGCCCAGATCCCGT-3' (SEQ ID NO. 15); MH-OsICMT-R: 5'-aaacACGGGATCTGGGCAAAGGCG-3' (SEQ ID NO. 16).

[0035] Detailed steps for constructing the OsICMT gene knockout mutant: ① Target adapter preparation: 1 μM MH-OsICMT-F / R primers were annealed at 90℃ for 30 s.

[0036] ② Perform gRNA expression cassette ligation reaction, the reaction system is shown in Table 1.

[0037] Table 1 Connection Reaction System

[0038] ③ First round of amplification: gRNA expression cassette amplification was performed using UF / gRNA-R primers.

[0039] The primer sequences are as follows: UF: 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID NO. 17); gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID NO. 18).

[0040] The amplification system is shown in Table 2.

[0041] Table 2 First-round amplification system

[0042] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 1 min; 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 68℃ extension for 20 s, for 10 cycles; 95℃ denaturation for 10 s, 60℃ annealing for 15 s, 68℃ extension for 30 s, for 20 cycles.

[0043] ④ Second round of amplification: Amplify gRNA expression cassettes at specific locations using B1' and BL primers.

[0044] The primer sequences are as follows: B1': 5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3' (SEQ ID NO. 19); BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3' (SEQ ID NO. 20).

[0045] The amplification system is shown in Table 3.

[0046] Table 3 Second-round amplification system

[0047] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 1 min; 98℃ denaturation for 10 s, 60℃ annealing for 15 s, 68℃ extension for 30 s, for a total of 25 cycles; and 68℃ extension for 5 min.

[0048] ⑤ Simultaneous digestion and ligation: Mix the second-round amplification product from step ④ with an equal volume of the pYLCRISPR / Cas9-MH vector, and then perform simultaneous digestion and ligation using T4 ligase. The reaction system is shown in Table 4, taking one target site as an example: Table 4 Enzyme digestion system

[0049] After reacting at 37℃ for 10 min, add 1.6 μL of 10× DNA ligase buffer and 1.6 μL of T4 DNA ligase.

[0050] The final reaction program was: 37℃ for 5 min, 10℃ for 5 min, 20℃ for 5 min, for a total of 15 cycles.

[0051] ⑥ Escherichia coli DH5α transformation and sequencing verification.

[0052] After the recombinant vector was sequenced and verified to be correct, Wuhan Boyuan Biotechnology Co., Ltd. was commissioned to carry out genetic transformation of rice. The CRISPR / Cas9 editing vector was introduced into the callus tissue of TP309 variety using Agrobacterium-mediated transformation. After infection, co-culture and antibiotic resistance screening, the osicmt knockout mutant was finally obtained.

[0053] (2) Construction of OE-OsICMT overexpression plants: In order to verify the biological significance of OsICMT in rice development and pathogenicity, the OsICMT gene was overexpressed in TP309 background material.

[0054] The primer sequences are as follows: OE-OsICMT-F: 5'-gttacttctgcactaggtaccATGCGGCATCTGCCTCTGC-3' (SEQ IDNO.21); OE-OsICMT-R: 5'-cggggatccgtcgacctgcagTCATTCTATAAAAGGTAATCCTGAGTGC-3' (SEQ ID NO. 22).

[0055] The CDS sequence of OsICMT was amplified using primers OE-OsICMT-F / R and cloned into the pCAMBIA1390 vector (KpnI / PstI double restriction sites) using homologous recombination ligase. After successful sequencing, the samples were sent to Wuhan Boyuan Biotechnology Co., Ltd. for rice genetic transformation. The overexpression vector was introduced into the callus tissue of TP309 cultivar using Agrobacterium-mediated transformation. After infection, co-culture, and antibiotic resistance screening, transgenic plants with high expression of the OsICMT gene were obtained.

[0056] Example 4: Identification of OsICMT gene knockout mutants and overexpression plants The detection primers OsICMT-check-F / R were used to target sites in wild-type TP309 and transgenic knockout plants, respectively. Figure 3 PCR amplification was performed on the mutants (as shown in Figure A). After agarose gel electrophoresis confirmed that the band size met expectations, sequencing and sequence alignment analysis were conducted to obtain different types of knockout mutants. The results are as follows: Figure 3 As shown in Figure B, compared to wild-type plants, knockout plants exhibit gene base deletions or insertions. The osicmt-2 and osicmt-5 mutant plants were selected for further research.

[0057] Subsequently, quantitative primers qOsICMT-F / R were selected using NCBI BLAST and analyzed by real-time quantitative PCR. Primer qOsUBQ-F / R was used to amplify the rice internal reference gene Ubiquitin, and the results are as follows: Figure 3 As shown in Figure C, compared with wild-type plants, the gene expression level of overexpression plants was significantly increased. OE-OsICMT-17 and OE-OsICMT-22 overexpression plants were selected for further research.

[0058] The primer sequences are as follows: qOsICMT-F: 5'-CATTGGTGCTGTGGCGATTC-3' (SEQ ID NO.4); qOsICMT-R: 5'-CTGAGTGCACTTTCTGTGCG-3' (SEQ ID NO. 5); qOsUBQ-F: 5'-AAGAAGCTGAAGCATCCAGC-3' (SEQ ID NO. 6); qOsUBQ-R: 5'-CCAGGACAAGATGATCTGCC-3' (SEQ ID NO. 7).

[0059] Example 5: Effect of OsICMT on the pathogenicity of rice false smut. The artificial inoculation method for *Aspergillus oryzae* is as follows: After activating strain JS60-2, incubate it for 7 days at 28℃ and 180 rpm using PS liquid potato medium. Remove the cultured *Aspergillus oryzae* inoculum and crush it in a small cell-wall blender. Adjust the number of conidia in the mixture of *Aspergillus oryzae* mycelia and spores to 1×10⁻⁶ using fresh PS liquid potato medium. 6 Prepare a solution of mycelium / mL for later use. Select rice plants 5-7 days before panicle breakage from the field, attach tags, and carefully dig them up by the roots and transplant them into the greenhouse. Inject the mycelium and spore solution into the rice panicles using a syringe until the spore solution overflows. After injection, attach a label with the name and date to the flag leaf of the panicle for easy recording and observation. Shade and moisture are required for the first 2 days after inoculation. After inoculation, cover the greenhouse roof with the shade curtain to maintain a room temperature of 22℃, and spray water for about 20 minutes every 3 hours. After 2 days, open the shade curtain and adjust the room temperature to 28℃, spraying water for about 15 minutes every 4 hours, with 12 hours of light and 12 hours of darkness during this period. After 25-30 days of inoculation, investigate the disease status of the rice panicles by counting the number of rice spikelets.

[0060] The results are as follows Figure 4 As shown, the number of rice false smut balls was counted 30 days after inoculation. The results showed that, compared with the wild type, the number of rice false smut balls formed by the osicmt knockout transgenic plants increased, and the defense ability against rice false smut was significantly reduced; while the OE-OsICMT overexpressing plants formed fewer rice false smut balls than the wild type, indicating that OsICMT is regulating the resistance of rice to rice false smut.

[0061] The amino acids and gene sequences involved in this invention are: SEQ ID NO.1: MRHLPLPPAAAAAAAAPREASPPPPPPPAARALSPTAVAFAQIPSVAMAARAQAWLFAAALVIFHGSEYVLAAAFHGRRNVTATSLLISKQYVLAMSFAMLEHLTEALLFPELKEYWFVSYVGLVMVIIGEVIRKLAVVTAGRSFTHVIRIHYEDQHKLITHGVYRLMRHPGYSGFLIWAVGTQVMLCNPLSTVAFTLVLWRFFSKRIPYEEFFLRQFFGREYEEYAQKVHSGLPFIE*。

[0062] SEQ ID NO.2: ATGCGGCATCTGCCTCTGCCCCCAGCAGCAGCAGCAGCAGCCGCCGCGCCGCGCGAAGCATCTCCTCCTCCTCCTCCTCCTCCCGCCGCGCGAGCGCTGAGCCCTACTGCTGTCGCCTTTGCCCAGATCCCGTCGGTGGCCATGGCGGCGAGGGCGCAGGCGTGGCTGTTCGCGGCCGCGCTGGTCATCTTCCACGGCTCCGAGTACGTCCTCGCCGCGGCCTTCCACGGCCGCCGCAACGTCACCGCCACATCACTTCTTATCAGCAAGCAGTATGTTTTGGCAATGAGTTTTGCAATGTTGGAACACCTGACAGAAGCTCTTCTCTTCCCTGAATTGAAGGAGTATTGGTTTGTCAGTTATGTTGGTTTAGTAATGGTGATTATTGGTGAAGTTATTCGTAAACTTGCTGTGGTGACAGCTGGGCGTTCCTTTACGCATGTTATAAGAATTCACTATGAAGACCAACATAAGCTGATTACTCATGGGGTGTATAGGCTTATGCGTCATCCTGGGTATTCTGGCTTTCTTATATGGGCAGTAGGAACCCAGGTTATGTTGTGTAATCCATTATCCACAGTTGCATTCACATTGGTGCTGTGGCGATTCTTTTCAAAACGGATACCGTATGAAGAATTTTTCTTAAGGCAGTTCTTTGGTCGTGAATACGAAGAATACGCACAGAAAGTGCACTCAGGATTACCTTTTATAGAATGA。

[0063] SEQ ID NO.3:

[0064] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of the rice OsICMT gene in any of the following: (1) Application in improving rice resistance to rice false smut; (2) Application in the cultivation of rice resistant to rice false smut; (3) Application in the genetic improvement of rice false smut resistance; wherein The nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.

2.

2. The application of the protein encoded by the rice OsICMT gene in any of the following: (1) Application in improving rice resistance to rice false smut; (2) Application in the cultivation of rice resistant to rice false smut; (3) Application in the genetic improvement of rice false smut resistance; wherein The nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.

2.

3. Application of recombinant vectors containing the rice OsICMT gene in any of the following: (1) Application in improving rice resistance to rice false smut; (2) Application in the cultivation of rice resistant to rice false smut; (3) Application in the genetic improvement of rice false smut resistance; wherein The nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.

2.

4. Application of recombinant engineered bacteria containing the rice OsICMT gene in any of the following: (1) Application in improving rice resistance to rice false smut; (2) Application in the cultivation of rice resistant to rice false smut; (3) Application in the genetic improvement of rice false smut resistance; wherein The nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.

2.

5. Use according to any one of claims 1 to 4, wherein By overexpressing the rice OsICMT gene in rice, the resistance of rice to rice false smut is improved.

6. Use according to any one of claims 1 to 4, wherein By introducing the rice OsICMT gene into rice, rice varieties that exhibit high expression of the rice OsICMT gene are screened and retained, thus obtaining rice resistant to rice false smut.

7. A method for increasing resistance of rice to Magnaporthe grisea, the method comprising introducing into a rice plant a nucleic acid molecule encoding a protein having an amino acid sequence of SEQ ID NO:

2. The invention includes overexpressing the rice OsICMT gene in rice to improve the rice's resistance to rice false smut; wherein the nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.

2.

8. The method of claim 7, wherein, The overexpression method includes: cloning the rice OsICMT gene into an expression vector to construct a recombinant vector; then introducing the recombinant vector into rice cells through callus transformation, and cultivating the rice cells into plants.

9. A method for breeding rice plants resistant to Magnaporthe grisea, characterized in that, The method includes overexpressing the rice OsICMT gene in rice to increase the expression level of the rice OsICMT gene, and obtaining rice with high expression of the rice OsICMT gene, which is rice resistant to rice false smut; wherein, the nucleotide sequence of the CDS region of the rice OsICMT gene is shown in SEQ ID NO.

2.

10. The method of claim 9, wherein, The overexpression method includes: cloning the rice OsICMT gene into an expression vector to construct a recombinant vector; then introducing the recombinant vector into rice cells through callus transformation, and cultivating the rice cells into plants.