Method for preparing a bovine with a mutation in the insulin-like growth factor 2 gene

By using Prime Editing technology to achieve G→A mutation in the bovine IGF2 gene without DSB, the risks of byproducts and off-target effects of the CRISPR-Cas9 system are eliminated, and the embryo survival rate and lean meat rate are improved, making it suitable for livestock breeding.

CN122189091APending Publication Date: 2026-06-12吉林省奥金斯农牧科技发展有限公司

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
吉林省奥金斯农牧科技发展有限公司
Filing Date
2026-02-05
Publication Date
2026-06-12

AI Technical Summary

Technical Problem

The existing CRISPR-Cas9 system suffers from uncontrollable byproducts, off-target editing risks, and genomic instability due to DNA double-strand breaks (DSB) in bovine IGF2 gene editing, making it difficult to achieve high-precision gene mutations with low off-target effects.

Method used

Using Prime Editing (PE) technology, a fusion protein of nCas9 (H840A) and reverse transcriptase, along with pegRNA, was used to precisely introduce a G→A mutation at the bovine IGF2-3072G site in a DSB-free manner. The pegRNA was then bound to PBS and the reverse transcription template was used to achieve efficient and precise gene editing.

Benefits of technology

It achieves efficient and precise G→A mutation in the bovine IGF2 gene, with an embryo survival rate of >60% and a significantly reduced off-target rate of <0.1%, making it suitable for precision breeding of livestock and improving lean meat percentage and daily weight gain performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a preparation method of an insulin-like growth factor 2 gene mutant cow, and belongs to the technical field of animal genetic engineering and precision breeding. In the method, the nucleotide at the 214th position of the sequence of SEQ ID NO: 1 is mutated from G to A in the nucleotide sequence of the genome of a to-be-edited cow, and a gene-edited cow is obtained; the to-be-edited cow is a cow containing the gene of the insulin-like growth factor 2. High-efficiency (more than 24.5%) mutation is realized without generating DSB, and the embryo survival rate is more than 35%. The birth weight of the obtained IGF2-3104A gene-edited cow is increased by 52%, and the 3-month-old weight is increased by 29.5%. The application further provides a supporting vector, a cell, an animal and application of the animal in a biological reactor, xenotransplantation and beef cattle breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal genetic engineering and precision breeding technology, specifically relating to a method for preparing mutant cattle with the insulin-like growth factor 2 gene. Background Technology

[0002] IGF2 is a key gene regulating muscle growth in mammals. The ZBED6 binding site, located in the third intron of bovine IGF2, is G in the wild type; when this base is mutated to A, ZBED6 cannot bind, IGF2 expression is upregulated 3-4 times, and lean meat percentage is significantly increased. Similar reports have been found in pigs and mice, but there are no successful cases of precisely introducing this mutation in cattle using a DSB-free method.

[0003] Traditional CRISPR-Cas9 systems rely on generating DNA double-strand breaks (DSBs) at target sites and achieving gene knockout or mutation through error-prone cellular repair mechanisms (such as non-homologous end joining, NHEJ). However, DSBs pose significant risks: 1) introducing uncontrollable byproducts such as insertions / deletions, inversions, large deletions, or translocations; 2) a high risk of off-target editing; and 3) DSBs and their repair errors may increase genomic instability and potential oncogenic risks. These drawbacks limit their application in scenarios requiring high-precision, simultaneous multi-gene editing (especially precise point mutations).

[0004] Therefore, there is a need to develop gene editing systems that are DSB-free, highly efficient, have low off-target effects, and do not introduce exogenous genes. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a DSB-free, highly efficient, and low off-target PE3 system for precisely introducing a G→A mutation at the bovine IGF2-3072G site to obtain gene-edited cattle with high meat production performance and an embryo survival rate >60%; it also provides supporting vectors, cells, animals, and downstream applications. The technical problem to be solved is not limited to the described technical subject matter; other technical subjects not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0006] The emergence of Prime Editing (PE) technology offers a new approach to solving the aforementioned problems. The PE system is based on a fusion protein of nCas9 (H840A, which only cleaves the PAM-containing strand) and reverse transcriptase (RT), along with a special guide RNA (pegRNA). The pegRNA contains: 1) a spacer targeting the target sequence; 2) a primer binding site (PBS); and 3) a reverse transcription template (RTT) carrying the desired edit (point mutation, small insertion, or deletion). PE creates a nick at the target site using nCas9, the pegRNA's PBS binds to the non-target strand near the nick, and the RT uses the RTT as a template to synthesize a DNA flap containing the edited sequence. Finally, the edit is integrated into the genome through cellular repair mechanisms. Compared to CRISPR-Cas9, PE's core advantages are: 1) It does not generate DSB, significantly reducing off-target effects, byproducts, and the risk of genomic instability; 2) It can efficiently and accurately introduce various types of point mutations, small insertions, and deletions, making it an ideal tool for achieving specific point mutations in IGF2 (such as G3072A); It achieves single-base substitution without generating DSB, with low embryotoxicity and an off-target rate of <0.1%, making it suitable for precision breeding of livestock.

[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0008] This invention provides a method for preparing a gene-edited cow, comprising the following steps: mutating the 214th nucleotide of the sequence SEQ ID NO:1 in the genome of the cow to be edited from G to A, thereby obtaining a gene-edited cow; wherein the cow to be edited is a cow containing the gene for insulin-like growth factor 2.

[0009] In the above method, the gene for insulin-like growth factor 2 contains a nucleic acid molecule with the nucleotide sequence SEQ ID NO:1.

[0010] In the above method, the step of changing the nucleotide position 214 of the sequence SEQ ID NO:1 in the genome of the cow to be edited from G to A is achieved by a guided editing system. The guided editing system includes pegRNA, which includes single-guide RNA, primer binding site, and reverse transcription template containing the editing sequence of the target site. The nucleotide sequence of the target site editing sequence (RTT) in the reverse transcription template of the pegRNA is nucleotides 97 to 115 of SEQ ID NO:4, and the nucleotide sequence of the primer binding site (PBS) is the same as nucleotides 116 to 128 of SEQ ID NO:4.

[0011] The tag proteins mentioned above include, but are not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0012] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein insulin-like growth factor 2 of this invention using known methods, such as directed evolution or point mutation. Artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein insulin-like growth factor 2 isolated in this invention, as long as they encode and function as protein insulin-like growth factor 2, are derived from and equivalent to the nucleotide sequence of this invention.

[0013] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0014] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0015] In this document, the 85% or more of identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of identity.

[0016] In some embodiments of the present invention, the insulin-like growth factor 2 gene is a DNA molecule encoding insulin-like growth factor 2.

[0017] In the above method, the guided editing system includes Nick sgRNA, and the nucleotide sequence of Nick sgRNA is SEQ ID NO:5.

[0018] In the above method, the step of mutating the nucleotide at position 214 of the sequence SEQ ID NO:1 in the genome of the cow to be edited from G to A includes introducing a recombinant vector expressing the pegRNA, a recombinant vector expressing the Nick sgRNA, and a recombinant vector expressing a fusion protein formed by nCas9 (H840A) and reverse transcriptase into bovine cells.

[0019] In one embodiment of the present invention, the nucleotide sequence of the recombinant vector expressing the pegRNA composition is SEQ ID NO:6.

[0020] In one embodiment of the present invention, the nucleotide sequence of the recombinant vector expressing the Nick sgRNA composition is SEQ ID NO:7.

[0021] In one embodiment of the present invention, the nucleotide sequence of the recombinant vector expressing the fusion protein formed by nCas9 (H840A) and reverse transcriptase is SEQ ID NO:3.

[0022] In some embodiments of the present invention, the cells of the cow to be edited are bovine fetal fibroblasts.

[0023] In one embodiment of the present invention, the bovine fetal fibroblasts are fibroblast cell lines cultured from bovine fetal tissue.

[0024] In one embodiment of the present invention, the bovine fetal tissue is bovine fetal tissue from a 45-day-old fetus.

[0025] The bovine fetuses were obtained by the following method: using Holstein dairy cows as the maternal line, artificial insemination was performed on them with frozen semen from Simmental bulls when they came into estrus, and the bovine fetuses were collected when the Holstein dairy cows were 45 days old.

[0026] The present invention also provides recombinant bovine cells, wherein the genome of the recombinant bovine cells contains SEQ ID NO:2 but does not contain SEQ ID NO:1.

[0027] In some embodiments, the recombinant cells are prepared by introducing a guided editing system into the genome of bovine cells to be edited, wherein the guided editing system includes the aforementioned pegRNA and NicksgRNA.

[0028] In some embodiments, the bovine cells may not include bovine germ cells, fertilized eggs, and embryonic stem cells, but may be somatic cells or cell lines.

[0029] The present invention also provides a complete set of carriers, which includes the aforementioned carriers.

[0030] The present invention also provides the application of the foregoing method in any of the following: B1) Prepare products that increase the lean meat percentage and / or daily weight gain of animals; B2) Breed animals with increased lean meat percentage and / or increased daily weight gain.

[0031] The present invention also provides a method for editing bovine fetal fibroblasts, comprising the following steps: introducing the aforementioned vector into bovine fetal fibroblasts for gene editing.

[0032] The present invention also provides for the application of any of the following in the aforementioned method for editing bovine fetal fibroblasts: B1) Prepare products that increase the lean meat percentage and / or daily weight gain of animals; B2) Breed animals with increased lean meat percentage and / or daily weight gain.

[0033] The present invention also provides products for increasing the lean meat percentage and / or daily weight gain of animals, said products comprising animal somatic cells and the aforementioned complete carrier.

[0034] In some embodiments, the animal somatic cells may not include bovine germ cells, fertilized eggs, and embryonic stem cells, but may be somatic cells or cell lines.

[0035] The present invention also provides a method for mutating the 214th nucleotide of the sequence SEQ ID NO:1 in the genome of a cow to be edited from G to A.

[0036] The method provided by the present invention for mutating the 214th nucleotide of the sequence SEQ ID NO:1 in the genome of a cow to be edited from G to A includes using the above-described guided editing system to mutate the 214th nucleotide of the sequence SEQ ID NO:1 in the genome of a cow to be edited from G to A.

[0037] The present invention also provides a gene-edited cow, which is obtained by a method comprising the following steps: mutating the 214th nucleotide of the sequence SEQ ID NO:1 in the genome of the cow to be edited from G to A, thereby obtaining a gene-edited cow; wherein the cow to be edited is a cow containing the gene of insulin-like growth factor 2.

[0038] This invention achieves highly efficient (>24.5%) mutations without generating DSBs, with an embryo survival rate >35%. The resulting IGF2-3104A gene-edited cattle showed a 52% increase in birth weight and a 29.5% increase in weight at 3 months of age. This invention also provides supporting vectors, cells, animals, and their applications in bioreactors, xenotransplantation, and beef cattle breeding. Attached Figure Description

[0039] Figure 1 The spectrum of the pCMV-PE2max-BFP-Puro vector.

[0040] Figure 2 Sequencing diagram of IGF2-3104A clone.

[0041] Figure 3 This is a cloned calf with the serial number 5C013.

[0042] Figure 4 This refers to the genetic modification type of the cloned calf numbered 5C013.

[0043] Figure 5 This is a cloned calf with the serial number 5C015.

[0044] Figure 6 The genetic modification type of the cloned calf numbered 5C015.

[0045] Figure 7 This is a cloned calf with the serial number 5C021.

[0046] Figure 8 This refers to the genetic modification type of the cloned calf numbered 5C021.

[0047] Figure 9 For the parameters of six calves.

[0048] Figure 10 This represents the relative expression level of IGF2 in serum.

[0049] Figure 11 This represents the relative expression level of IGF2 in muscle. Detailed Implementation

[0050] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0051] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0052] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0053] The experimental results of the following examples are expressed as mean ± standard deviation. A one-way ANOVA test was used, and P < 0.05 was considered satisfactory. () indicates a significant difference.

[0054] The bovine fetal fibroblast cell line used in this embodiment was prepared according to the following method: Following steps 3)-20) of Section 4, Chapter 1, of *Cellular Experimentation Guide (Volume 1)* (by D.L. Spector et al.; translated by Huang Peitang et al., Beijing: Science Press, 2001.2), the bovine fetal fibroblast cell line was obtained. Except that the shredded embryo in step 3) was replaced with 45-day-old bovine fetal tissue, and the fetal bovine serum used in the culture process was 20% fetal bovine serum, and the trypsin used was 0.05% trypsin, all other operations were exactly the same. The bovine fetus was obtained as follows: Holstein cows were used as the maternal line, and artificial insemination was performed with Simmental bull frozen semen when the cows were in estrus. The fetuses were collected when the Holstein cows reached 45 days of gestation.

[0055] It should be noted that in the following examples, the RNA portions are represented by T instead of U in the sequence listing to meet the requirements of sequence listing.

[0056] Example 1 1. Target site information Sequencing of the wild bovine genome: 5'-ttcgccttctcttcaccagtgcttcaactctcccgcgttatcaaaacaaaattgggttcgccttcgtcgaggggcccgagaaggcccggacggcgct cccggagcgccgggggcgagcggggacggccgccgggggtgatccggggccccccaaaccgagccggggacgagcctgcccgcggcggtcgccgggccgcggcttcgcctag gctcGcagagcggagcgcgtggggcgcgcggcggcggcggcggggagcccgcgggccttctcggaggcagccgagcagggagcccagagccccccccggcacgccagggagcagcgccccgtcgctccctcgccgccccccggggtgcctcgcttccacccgacgcgctgcagcacggaagcgctgtcaggggccaggaggcaaaatcgggagaagcgacgtgcca-3' (SEQ ID NO:1, corresponding to nucleotides 49408195 to 49408620 of the IGF2 genome sequence with Gene ID: 281240 (updated on 29-Jun-2025, URL: https: / / www.ncbi.nlm.nih.gov / gene / 281240)).

[0057] Post-mutation sequence: 5'-ttcgccttctcttcaccagtgcttcaactctcccgcgttatcaaaacaaaattgggttcgccttcgtcgaggggcccgagaaggcccggacggcgctcccggagcg ccgggggcgagcggggacggccgccgggggtgatccggggccccccaaaccgagccggggacgagcctgcccgcggcggtcgccgggccgcggcttcgcctaggctcAc agagcggagcgcgtggggcgcggcggcggcggggagcccgcgggccttctcggaggcagccgagcagggagcccagagccccccggcacgccagggagcagcgccccgt cgctccctcgccgccccggggtgcctcgcttccacccgacgcgctgcagcacggaagcgctgtcaggggccaggaggcaaaatcgggagaagcgacgtgcca-3' (SEQ ID NO:2, that is, the 214th nucleotide of SEQ ID NO:1 is mutated from G to A).

[0058] 2. PE3 System Composition (1) Effector protein expression cassette The plasmid used to generate the effector protein is pCMV-PE2max-BFP-Puro (SEQ ID NO:3), in which nucleotides 1687–5788 encode nCas9 (H840A); nucleotides 5891–7921 encode M-MLV reverse transcriptase; BFP labeling and puromycin resistance are used for flow cytometry sorting.

[0059] (2) pegRNA The full sequence of the pegRNA is shown in SEQ ID NO:4 (180 nt in total): 5'-GCCGGGCCGCGGCUUCGCCUgUUUCagagcUaGAAAUagcaagUUGaaaUaaggcUagUccgUUaUcaacUUgaaaaagUggcaccgagUcggUgcUCCGCUCUGUGAGCCUAGGCGAAGCCGCGGCCAAAUCCUAcgcggUUcUaUcUagUUacgcgUUaaaccaacUagaaUUUUUUU-3', which includes a spacer (20 nt), RTT (19 nt), and PBS (13 nt), as detailed below: spacer (20 nt): 5'-GCCGGGCCGCGGCUUCGCCU -3' is complementary to nucleotides 3079 to 3087 of the non-template strand of IGF2; The reverse transcription template RTT (19 nt) is 5'-UCCCGCUCUGUGAGCCUAGG-3', containing a G→A mutant base; Primer binding site PBS (13nt): 5'-CGAAGCCGCGGCC-3' is complementary to the 3' end after cleavage.

[0060] The plasmid used to generate pegRNA is pU6-pegRNA-IGF2-3104A, and its nucleotide sequence is SEQ ID NO:6:

[0061] (3) Nick sgRNA Nick's sgRNA sequence is SEQ ID NO:5 (CUGCUCCCUGGCGUGCCGG, 19 nt), which targets the non-edited strand to improve efficiency.

[0062] The plasmid used to generate Nick sgRNA is pU6-Nick-sgRNA-IGF2-NT, and its nucleotide sequence is SEQ ID NO:7:

[0063] 3. Preparation of IGF2 gene mutant cell lines 1) Two days before transfection, thaw the aforementioned bovine fetal fibroblasts (P2–P4 passages), and then use 1×10⁻⁶ cells. 6 One bovine fetal fibroblast was seeded into a culture flask (T25 specification), and 5 mL of DMEM culture medium containing 10% (v / v) fetal bovine serum was added. The flask was then cultured at 37°C and 5% CO2 until the logarithmic growth phase.

[0064] 2) Take bovine fetal fibroblasts in the logarithmic growth phase from step 1, digest them with trypsin, then centrifuge at 1000g for 5 minutes and collect the precipitated cells.

[0065] 3) Take the cell pellet obtained in step 2), wash it once with PBS buffer at pH 7.4, and then resuspend it with 100 μL of Nucleofector electroporation reagent from the Nucleofector transfection kit to obtain a cell suspension.

[0066] 4) Take the cell suspension obtained in step 3) (containing 1×10 6 (1 cell), using Lonza 2b (program U-023), the plasmids (pCMV-PE2max-BFP-Puro 3 µg, pU6-pegRNA-IGF2-3072A 2 µg, pU6-Nick-sgRNA-IGF2-NT 2 µg) were co-transfected into the aforementioned P2–P4 generation bovine fetal fibroblasts.

[0067] 5) Flow cytometry sorts BFP+ cells after 24 h.

[0068] 6) The cells obtained by convective sorting are cultured as single cells for 7 days to form cell clones. After the cell clones are formed, they are picked for further culture. After they are cultured to the point of confluence in a 6-well plate, each cell clone is numbered and two-thirds of them are frozen for preservation. The remaining one-third is used for DNA genome extraction.

[0069] 7) PCR identification of the extracted clone cell DNA (product 412 bp), using the following primers: F: 5'-AGAGGCAGGGAATGGGTGTA-3' (SEQ ID NO: 8); R: 5'-TGGGAGAACAGAGGCATGA-3' (SEQ ID NO:9).

[0070] High-resolution melting curves were used for initial screening, and Sanger sequencing confirmed the 3104A mutant clone (named IGF2-3072A-PE).

[0071] 4. Somatic cell nuclear transfer (SCNT) 1) Collect ovaries from adult cows at the slaughterhouse, take follicles with a diameter of 2-8 mm, and recover uniform and dense cumulus-oocyte complexes. Place the cumulus-oocyte complexes into a four-well cell culture plate (50-60 cells / well) containing maturation medium (liquid M199 medium + 10% fetal bovine serum + 0.01 U / ml bovine follicle-stimulating hormone + 0.01 / ml bovine luteinizing hormone + 1 µg / ml estradiol). Incubate at 38.5℃ for 18-20 h in a 5% CO2 incubator. Then, place the mature oocytes into a centrifuge tube containing 0.1% hyaluronidase and shake for 2-3 min. Gently blow with a glass tube to completely separate the cumulus cells from the oocytes. Select oocytes with intact morphology, uniform cytoplasm, and extrusion of the first polar body as recipient oocytes.

[0072] 2) Transfer the oocytes with the first polar body obtained in step 2 into the operating solution (liquid M199 medium + 10% FBS + 7.5µg / ml cytochalasin B). Under a 200x microscope, use a glass needle to make a small incision in the zona pellucida above the polar body. Then, use a glass tube with an inner diameter of 20µm to aspirate the first polar body and the chromosomes in the oocyte below it. Then, wash the oocytes with the first polar body and chromosomes removed three times in liquid M199 medium containing 20% ​​FBS.

[0073] 3) Take the 3104A mutant clone confirmed by the Sanger sequencing, starve the serum for 2-4 days, and then digest it with 0.25% trypsin for 2-4 minutes.

[0074] 4) Select donor cells with a diameter of 10-12 μm and transfer them into the zona pellucida of the oocytes obtained in step 1). Then, place them in Zimmerman's solution (an aqueous solution containing 0.3 M mannitol, 0.1 M MgSO4, 0.05 M CaCl2, 0.5 mM HEPES, and 0.05 g / 100 mL BSA, pH 7.2, filtered through a 0.22 µm filter membrane) for equilibration for 3-5 min. Then, place them in a fusion tank and rotate the oocytes so that the contact surface between the donor cells and the oocytes is perpendicular to the electric field. Simultaneously, fuse the oocytes under the conditions of a DC pulse field strength of 2.5 kV / cm, a pulse duration of 10 μs, 2 pulses, and a pulse interval of 1 s (using a BTX ECM-2001 fusion apparatus). Then, quickly transfer the reconstructed embryos into liquid M199 medium containing 10% FBS for 30 min. Next, place the reconstructed embryos in a 5 μmol / L ionomycin aqueous solution for 4 min, and then transfer them to a 1.9 mmol / L... The embryos were placed in 6-DMAP aqueous solution for 4 hours, then transferred to CR1aa culture medium containing 5% FBS and cultured at 38.5℃ for 7 days in an incubator containing 5% CO2 to form cloned blastocysts.

[0075] 5. Embryo transfer and pregnancy monitoring Selective mature adult cows are used for surrogacy with cloned embryos. The recipient cows are synchronized with estrus. On the 7th day after estrus, the corpus luteum status of the ovary is detected by rectal examination. The cloned embryos are transferred to the recipient cows with good corpus luteum status. The cloned blastocysts formed after 7 days of culture are transferred into the uterine horn of the surrogate cow using a non-surgical method of rectal manipulation. 1-2 blastocysts are transferred. The surrogate cows are examined for pregnancy 60 days after the transfer to confirm the pregnancy status.

[0076] Table 1. Embryo Development and Transfer (Blastocyst Rate Statistics)

[0077] The embryos were stored as blastocysts: the development of the PE-edited embryos was similar to that of the WT group, indicating that the embryos were developing normally.

[0078] Table 2. Transplantation Statistics

[0079] The results showed that only heterozygous mutant calves were born, further demonstrating the feasibility of the PE scheme.

[0080] 6. Phenotypic determination Record birth weight, 6-month weight, muscle IGF2 mRNA (RT-qPCR), and serum IGF2 concentration.

[0081] IGF2 mRNA (RT-qPCR) detection primer F: 5'-atggtttccccagaccctca-3'; IGF2 mRNA (RT-qPCR) detection primer R: 5'-ggccaagaaggcaagaagc-3'; Internal reference GAPDH primer F: 5'-ACACCCTCAAGATTGTCAGCAA-3'; Internal reference GAPDH primer R: 5'-TCATAAGTCCCTCCACGATGC-3'.

[0082] The relative expression level of IGF2 was calculated using the following method: .

[0083] The results are as follows Figure 4-11 As shown.

[0084] The complete sequence of pCMV-PE2max-BFP-Puro (SEQ ID NO:3, its spectrum is as follows) Figure 1 (also known as pCL597)

[0085] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for preparing gene-edited cattle, characterized in that, The procedure includes the following steps: mutating the nucleotide sequence of the sequence SEQ ID NO:1 in the genome of the cow to be edited from G to A to obtain a gene-edited cow; the cow to be edited is a cow containing the gene for insulin-like growth factor 2.

2. The preparation method according to claim 1, characterized in that, The step of changing the nucleotide position 214 of the sequence SEQ ID NO:1 in the genome of the cow to be edited from G to A is achieved through a guided editing system, which includes pegRNA, a single-guide RNA, a primer binding site, and a reverse transcription template containing the editing sequence of the target site. The nucleotide sequence of the target site editing sequence in the reverse transcription template of the pegRNA is nucleotides 97 to 115 of SEQ ID NO:4, and the nucleotide sequence of the primer binding site is the same as nucleotides 116 to 128 of SEQ ID NO:

4.

3. The preparation method according to claim 2, characterized in that, The guided editing system includes Nick sgRNA, the nucleotide sequence of which is SEQ ID NO:

5.

4. The preparation method according to claim 3, characterized in that, The process of mutating the nucleotide sequence of the bovine genome to be edited, which is SEQ ID NO:1, from G to A at position 214 includes introducing a recombinant vector expressing the pegRNA, a recombinant vector expressing the Nick sgRNA, and a recombinant vector expressing a fusion protein formed by nCas9 (H840A) and reverse transcriptase into bovine cells.

5. Recombinant bovine cells, characterized in that, The genome of the recombinant bovine cells contains SEQ ID NO:2 but does not contain SEQ ID NO:

1.

6. A complete carrier system, characterized in that, The complete carrier includes the carrier described in claim 4.

7. A method for editing bovine fetal fibroblasts, characterized in that, The procedure includes the following steps: introducing the vector described in claim 4 into bovine fetal fibroblasts for gene editing.

8. The use of the preparation method according to any one of claims 1-4, the recombinant bovine cells according to claim 5, the complete vector according to claim 6, or the method according to claim 7 in any of the following: B1) Prepare products that increase the lean meat percentage and / or daily weight gain of animals; B2) Breed animals with increased lean meat percentage and / or increased daily weight gain.

9. A product that increases the lean meat percentage and / or daily weight gain of animals, said product comprising animal somatic cells and the complete carrier as described in claim 6.

10. Gene-edited cattle, characterized by, The gene-edited cow was obtained by a method comprising the following steps: mutating the 214th nucleotide of the sequence SEQ ID NO:1 in the genome of the cow to be edited from G to A, thereby obtaining the gene-edited cow; the cow to be edited is a cow containing the gene for insulin-like growth factor 2.