Application of products of targeted knockout of bovine EDIL3 gene in regulating heat tolerance of bovine aortic endothelial cells
By targeting and knocking out the EDIL3 gene in bovine aortic endothelial cells using CRISPR/Cas9 technology, the heat tolerance of cattle was regulated, which solved the negative impact of heat stress on bovine health and production performance, improved the heat tolerance of cattle, and has significance for guiding the breeding of heat-resistant cattle breeds.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI
- Filing Date
- 2026-05-15
- Publication Date
- 2026-06-12
AI Technical Summary
Heat stress has a significant negative impact on the health and production performance of cattle. The function of the EDIL3 gene in heat stress has not been thoroughly studied in the current technology, which affects the heat tolerance of cattle.
By targeting and knocking out the EDIL3 gene in bovine aortic endothelial cells using CRISPR/Cas9 gene editing technology, and using a specific sgRNA sequence CGGGATCATGAAGCACTCGGTGG (SEQ ID NO:1) and Cas9 protein, a CRISPR/Cas9 system for targeting and knocking out the bovine EDIL3 gene was constructed. Cell lines targeting and knocking out the bovine EDIL3 gene were constructed and identified, and the heat resistance of bovine aortic endothelial cells was regulated.
The expression of heat-related genes PGC1α, FGF21, ELOVL6, and MAP2K6 was significantly downregulated, improving the heat resistance of bovine aortic endothelial cells and guiding the breeding and genetic improvement of heat-resistant cattle breeds.
Smart Images

Figure CN122189098A_ABST
Abstract
Description
Technical Field
[0001] The application of the product that targets and knocks out the bovine EDIL3 gene in regulating the heat resistance of bovine aortic endothelial cells. Background Technology
[0002] The statements in this section are merely background information related to the present invention and do not necessarily constitute prior art.
[0003] In recent years, the intensification of global warming and the frequent occurrence of extreme heat events have led to significant and multi-dimensional negative impacts on the health and production performance of cattle. Specifically, in terms of health, heat stress causes elevated body temperature and accelerated metabolic rate, leading to dehydration, respiratory alkalosis, and even heatstroke. It also suppresses immune activity, reduces resistance, and causes reproductive disorders, such as decreased sperm quality in bulls and estrus disorders and increased abortion risk in cows. In terms of production, heat stress directly inhibits the synthetic function of bovine mammary gland cells, resulting in decreased milk production, reduced feed conversion rates, and increased breeding costs. Therefore, how to select heat-resistant cattle breeds to ensure the health and stable production performance of the herd has become a crucial task urgently needing breakthroughs for the sustainable development of animal husbandry.
[0004] The EDIL3 gene, also known as the DEL1 gene, encodes a protein containing EGF-like repetitive sequences and a discoidal structure. According to the annotation of the bovine reference genome ARS-UCD 2.0 version, the EDIL3 gene is located in the region 83843439-84324060 bp on chromosome 7 (NC_037334.1) of the bovine reference genome. As a secreted protein, EDIL3 can directly act on vascular endothelial cells by binding to extracellular matrix components, mediating cell adhesion, migration, and proliferation, maintaining the stability of vascular structure, and participating in the dynamic remodeling of the vascular wall. Currently, there is no in-depth research on the role of the EDIL3 gene in heat stress; whether this gene plays a functional role in bovine heat stress requires further investigation and exploration. Summary of the Invention
[0005] To overcome the shortcomings of the prior art, the purpose of this invention is to provide the application of a product that targets and knocks out the bovine EDIL3 gene in regulating the heat resistance of bovine aortic endothelial cells.
[0006] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions: This invention provides the application of a product that targets and knocks out the bovine EDIL3 gene in regulating the heat resistance of bovine aortic endothelial cells. The bovine EDIL3 gene is located in the 83843439-84324060bp region of chromosome 7, NC_037334.1 of the bovine reference genome (ARS-UCD2.0), and the genome version is ARS-UCD2.0. The product includes any one of the following (1)-(5): (1) Targeted knockout of sgRNA of bovine EDIL3 gene; (2) Construct primer pairs for targeting and knocking out bovine EDIL3 gene sgRNA; (3) sgRNA expression vector for targeted knockout of bovine EDIL3 gene; (4) CRISPR / Cas9 system for targeted knockout of bovine EDIL3 gene; (5) Cell lines with targeted knockout of the bovine EDIL3 gene; The nucleotide sequence of the sgRNA is: CGGGATCATGAAGCACTCGGTGG (SEQ ID NO:1).
[0007] Preferably, the primer pair nucleotide sequence is as follows: Upstream primer: caccGCGGGATCATGAAGCACTCGG (SEQ ID NO:2); Downstream primer: aaacCCGAGTGCTTCATGATCCCGC (SEQ ID NO:3).
[0008] Preferably, the sgRNA expression vector comprises the DNA sequence of sgRNA.
[0009] Preferably, the CRISPR / Cas9 system includes a Cas9 protein or a Cas9 expression vector; and sgRNA or a DNA sequence of sgRNA.
[0010] Preferably, the CRISPR / Cas9 system is constructed by inserting the DNA sequence of the sgRNA into the multiple cloning site of a vector containing the Cas9 expression element, wherein the vector containing the Cas9 expression element is PX330, PX458, or PX459.
[0011] Preferably, the cell line is constructed by the following method: the sgRNA or the sgRNA expression vector or the CRISPR / Cas9 system is transferred into bovine aortic endothelial cells via liposomes, followed by PCR identification and single-clone culture; positive clones identified by PCR and sequencing are cell lines that target and knock out the bovine EDIL3 gene.
[0012] Preferably, the nucleotide sequence of the primers used to identify positive clone cells is as follows: F:TCACCCCTCTTTCTCGTCCT (SEQ ID NO:4), R: CTCACCAACACTCCGCTCTG (SEQ ID NO: 5).
[0013] The technical solution provided by this invention has the following beneficial effects: This invention reveals that under hot conditions, the expression level of the EDIL3 gene in bovine aortic endothelial cells is significantly increased. Knocking out the EDIL3 gene in bovine aortic endothelial cells using CRISPR / Cas9 gene editing technology significantly downregulated the gene levels of heat-related genes PGC1α, FGF21, ELOVL6, and MAP2K6, indicating that the EDIL3 gene can effectively regulate the heat resistance of bovine aortic endothelial cells. Based on this, the EDIL3 gene can be used as a target for producing transgenic heat-resistant cattle, which has important guiding significance for the selection, breeding, and genetic improvement of heat-resistant cattle breeds. Attached Figure Description
[0014] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0015] Figure 1 The EDIL3 gene expression level in bovine aortic endothelial cells subjected to gradient heat treatment in Example 1 is shown.
[0016] Figure 2 This is a sequencing peak diagram of mixed cells after knocking out the EDIL3 gene in bovine aortic endothelial cells in Example 2.
[0017] Figure 3 This is a sequencing peak diagram of a single-clone cell with the EDIL3 gene knocked out in bovine aortic endothelial cells in Example 2.
[0018] Figure 4 The results of monoclonal cell sequence analysis of bovine aortic endothelial cells with the EDIL3 gene knocked out in Example 2 are shown.
[0019] Figure 5 The results of protein truncation analysis of monoclonal cells with knocked-out EDIL3 gene in bovine aortic endothelial cells in Example 2 are shown.
[0020] Figure 6 The changes in the expression levels of heat-related genes after heat treatment of wild-type (WT) and EDIL3 knockout (KO) bovine aortic endothelial cells in Example 2 are shown. Detailed Implementation
[0021] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Experimental methods not specified herein are generally performed under standard conditions as described in *Molecular Cloning: A Laboratory Manual*, or as recommended by the reagent manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art.
[0022] Main instruments: PCR instrument (Applied Biosystems, USA); DYY-6C electrophoresis apparatus power supply (Beijing Liuyi Biotechnology Co., Ltd.); agarose horizontal electrophoresis tank (Beijing Liuyi Biotechnology Co., Ltd.); small vertical electrophoresis system (BIO-RAD, USA); Trans-Blot SD semi-dry transfer apparatus (BIO-RAD, USA); ChemiScope 6200 chemiluminescence imaging system (Shanghai Qinxiang Scientific Instruments Co., Ltd.); inverted fluorescence microscope (OLYMPUS); DNP-9162 electric thermostatic incubator (Shanghai Senxin Experimental Instruments Co., Ltd.); sterile laboratory bench (Wujiang Xinglong Purification Equipment Factory); ultra-low temperature freezer (Midea); pipette (Eppendorf).
[0023] The present invention will be further described in detail below with reference to specific embodiments. It should be noted that the specific embodiments are explanations of the present invention and not limitations thereof.
[0024] Example 1: Heat stress promotes EDIL3 gene expression in bovine aortic endothelial cells Bovine aortic endothelial cells (Guangzhou Genio Biotechnology Co., Ltd.) were subjected to time-gradient heat treatment at a temperature of 42℃ for 0h, 3h, 6h, and 9h. Cells were collected after each time gradient treatment, and total RNA was extracted from the cells using an RNA extraction kit. cDNA was obtained by reverse transcription of the total RNA using a reverse transcription kit.
[0025] Using β-actin as an internal reference gene, the gene expression differences of EDIL3 after heat treatment were detected by qRT-PCR.
[0026] like Figure 1 As shown, the expression level of the EDIL3 gene increased significantly after heat treatment, reaching its highest value after 3 hours of heat treatment. This indicates that heat treatment promotes the expression of the EDIL3 gene, which is a candidate gene for responding to heat stress.
[0027] Example 2: Construction of a cell line targeting and knocking out the bovine EDIL3 gene (1) sgRNA design and screening and oligo annealing to form double-stranded DNA Using the online tool E-Crisp (www.e-crisp.org / E-CRISP / designcrispr.html), the Bos taurus reference genome was selected, and sgRNA sequences were designed. Sequences with higher scores were selected as candidate sequences. In this embodiment, the specific sgRNA sequence used is: CGGGATCATGAAGCACTCGGTGG (SEQ ID NO:1), corresponding to the EDIL3 gene target location in the 84323569-84323591 region of chromosome 7, NC_037334.1 of the bovine reference genome (ARS-UCD2.0).
[0028] The upstream and downstream primers for the above sgRNA were designed. The primer nucleotide sequences are as follows: upstream primer: caccGCGGGATCATGAAGCACTCGG (SEQ ID NO:2), downstream primer: aaacCCGAGTGCTTCATGATCCCGC (SEQ ID NO:3), both containing BBSI restriction enzyme cleavage sites. The primer sequences were submitted to a biotechnology company to synthesize oligo sequence powder, which was diluted with water to a concentration of 10 μM. 5 μL of each primer sequence was pipetted into a PCR tube, mixed thoroughly, and placed in a PCR instrument. The PCR program was 95°C for 5 min, followed by a gradient cooling of 5°C per minute to 25°C, and stored at 4°C to obtain the annealed double-stranded DNA fragment.
[0029] (2) Construction of sgRNA expression vector Vector plasmids containing the Cas9 restriction enzyme expression element, such as PX330, PX458, and PX459, can be used for vector construction. This example uses the PX459 vector (Addgene), which contains the puromycin resistance gene (Puro). r This facilitates subsequent cell drug screening. The vector is digested with BbsI enzyme to form a linear vector with sticky ends. The linear vector is then ligated with the annealed double-stranded DNA fragment using T4 ligase at 16°C for 2 to 16 hours.
[0030] Table 1. BBSI digestion system Table 2. T4 ligase system The ligation product was transformed into E. coli DH5α competent cells and cultured overnight in LB solid medium containing ampicillin resistance. Single clones were picked and cultured by shaking. After the plasmid in the bacterial culture was identified by sequencing, the plasmid was extracted from the positive bacterial culture, and after endotoxin removal, a CRISPR / Cas9 gene editing vector targeting the EDIL3 gene was obtained and named PX459-EDIL3 vector.
[0031] (3) Cell transfection This embodiment uses bovine aortic endothelial cells to construct an EDIL3 gene knockout cell line. Cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin, at a CO2 concentration of 5% and a temperature of 38°C. The cells were seeded into 6-well plates one day before transfection. When the cell confluence reached approximately 80%, Invitrogen Lipofectamine was used. TM The PX459-EDIL3 vector was transfected into bovine aortic endothelial cells using the 3000 transfection reagent according to the instructions.
[0032] (4) Drug screening and knockout effectiveness testing After 48 hours of transfection with bovine aortic endothelial cells, the culture medium was replaced with a screening medium containing 2.5 μg / mL puromycin (the screening medium is prepared by adding serum, antibiotics and 2.5 μg / mL puromycin to a cell-specific basic medium such as DMEM or RPMI-1640; it can be prepared by yourself). Three days after screening, the culture medium was replaced with normal medium to obtain mixed cells with targeted editing of the EDIL3 gene.
[0033] Mixed cells were collected, and after trypsin digestion, approximately one-third of the cells were removed for genomic DNA extraction to assess the effectiveness of EDIL3 gene knockout. Simultaneously, genomic DNA was extracted from wild-type bovine aortic endothelial cells as a control. The remaining two-thirds of the cells were cryopreserved for use in 96-well plates to screen for monoclonal cells.
[0034] The extracted DNA was amplified by PCR using the following primers: F (SEQ ID NO:4):TCACCCCTCTTTCTCGTCCT, R (SEQ ID NO:5): CTCACCAACACTCCGCTCTG.
[0035] The PCR amplification system consisted of 25 μL, including 1.0 μL (10 μmol / L) upstream primer, 1.0 μL (10 μmol / L) downstream primer, 1 μL (-50 μg / L) DNA template, 12.0 μL 2×Taq PCR Master Mix, and 10 μL ddH2O. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, and 72℃ extension for 30 s, repeated 35 times; followed by a final extension at 72℃ for 10 min. The amplified target fragment was 437 bp in length. PCR products were detected by 1% agarose gel electrophoresis, and the remaining PCR products were sequenced.
[0036] The effectiveness of PX459-EDIL3 vector knockout was analyzed based on the sequencing results. The results are as follows: Figure 2 As shown, the sequencing peaks of the PX459-EDIL3 vector genome showed overlapping peaks at the corresponding sgRNA target sequence, while the sequencing results of wild-type cells did not show overlapping peaks. This indicates that the Cas9 endonuclease cleaved the target sequence under the guidance of sgRNA, resulting in a frameshift mutation in the target sequence, proving that the PX459-EDIL3 vector is effective in knocking out the EDIL3 gene.
[0037] (5) Selection of EDIL3 gene knockout cell monoclonal cells It has been confirmed that the mixed cells targeting the EDIL3 gene have knockout efficiency. Therefore, the remaining two-thirds of the frozen cells were thawed and cultured normally for 24-48 hours. After trypsin digestion, the cells were prepared into a cell suspension at a concentration of 40 cells / 10 ml and seeded into 96-well plates for 1 week. When the cell count in the 96-well plate reached more than 1 / 4 of the well area, the monoclonal cells were transferred to 24-well plates for propagation. After the cells in the 24-well plate were confluent, the cells were digested with trypsin, and a small amount of cells were taken from each well to extract DNA. PCR amplification was performed using the PCR primers F / R from step (4) above, and sequencing was used to identify whether the monoclonal cells were EDIL3 gene knockout cell lines.
[0038] like Figure 3 and Figure 4 As shown, screening and identification of cells transfected with the PX459-EDIL3 vector revealed three biallelic knockout monoclonal cells: monoclonal cell 1 with a deleted C base sequence, monoclonal cell 2 with an inserted T base sequence, and monoclonal cell 3 with a deleted 58 base sequences.
[0039] like Figure 5 As shown, it was found that after deleting a C base in monoclonal 1, the amino acid sequence terminated prematurely at position 91; after deleting a T base in monoclonal 2, the amino acid sequence terminated prematurely at position 24; and after deleting 58 bases in monoclonal 3, the amino acid sequence was completely changed and was completely different from the wild type.
[0040] (6) EDIL3 gene deletion reduces the level of heat production-related genes. Cells from the obtained EDIL3 gene knockout strain were collected after heat treatment at 42℃ for 3 hours. mRNA was extracted and reverse transcribed into cDNA. Subsequently, qRT-PCR was used to detect the levels of genes related to heat production, such as... Figure 6 As shown, compared with wild-type (WT) cells, the levels of heat-related genes PGC1α, FGF21, ELOVL6, and MAP2K6 (mean values of the three monoclonal cell lines) were downregulated in the three EDIL3 gene knockout (KO) cell lines, indicating that the EDIL3 gene has a promoting effect on cellular heat stress. Inhibiting the expression of the EDIL3 gene can effectively reduce the expression of heat-related genes, thereby improving the cell's adaptability to thermal environments.
[0041] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.
Claims
1. The application of products that target and knock out the bovine EDIL3 gene in regulating the heat resistance of bovine aortic endothelial cells, characterized in that, The bovine EDIL3 gene is located in the 83843439-84324060bp region on chromosome 7 of the bovine reference genome, NC_037334.1, with the genome version being ARS-UCD2.0; The product includes any one of the following (1)-(5): (1) Targeted knockout of sgRNA of bovine EDIL3 gene; (2) Construct primer pairs for targeting and knocking out bovine EDIL3 gene sgRNA; (3) sgRNA expression vector for targeted knockout of bovine EDIL3 gene; (4) CRISPR / Cas9 system for targeted knockout of bovine EDIL3 gene; (5) Cell lines with targeted knockout of the bovine EDIL3 gene; The nucleotide sequence of the sgRNA is: CGGGATCATGAAGCACTCGGTGG.
2. The application according to claim 1, characterized in that, The primer pair nucleotide sequences are as follows: Upstream primer: caccGCGGGATCATGAAGCACTCGG; Downstream primer: aaacCCGAGTGCTTCATGATCCCGC.
3. The application according to claim 1, characterized in that, The sgRNA expression vector includes the DNA sequence of sgRNA.
4. The application according to claim 1, characterized in that, The CRISPR / Cas9 system includes a Cas9 protein or a Cas9 expression vector; and a sgRNA or a sgRNA DNA sequence.
5. The application according to claim 1, characterized in that, The CRISPR / Cas9 system is constructed by inserting the DNA sequence of the sgRNA into the multiple cloning site of a vector containing the Cas9 expression element, wherein the vector containing the Cas9 expression element is PX330, PX458, or PX459.
6. The application according to claim 1, characterized in that, The cell line was constructed by the following method: the sgRNA, the sgRNA expression vector, or the CRISPR / Cas9 system was transferred into bovine aortic endothelial cells via liposomes, followed by PCR identification and single-clone culture; positive clones identified by PCR and sequencing were identified as cell lines that targeted the knockout of the bovine EDIL3 gene.
7. The application according to claim 6, characterized in that, The nucleotide sequences of the primers used to identify positive clone cells are as follows: F: TCACCCCTCTTTCTCGTCCT, R: CTCACCAACACTCCGCTCTG.