A method for breeding carps with reduced intramuscular spines

Abstract

The present application relates to the field of aquatic organism breeding, and specifically discloses a method for breeding crucian carp with reduced intramuscular spicules. The present application is based on a gene editing technique, and through three target points, two genes piezo1-A and piezo1-B encoding mechanical force sensing proteins of crucian carp are simultaneously knocked out to obtain mutant crucian carp with reduced intramuscular spicules. The method of the present application helps to breed new non-transgenic crucian carp germplasm with reduced intramuscular spicules on a large scale, and the strain can be applied to artificial breeding to reduce the risk of food process, reduce fish processing procedures, and at the same time, the concern of people about transgenic food can be avoided.

Description

Technical Field

[0001] This invention relates to the field of aquatic organism breeding technology, and in particular to a breeding method for reducing the intermuscular spines of crucian carp. Background Technology

[0002] Intermuscular bones are hard bones located in the diaphragm of fish, formed by the ossification of some mesenchymal cells in the diaphragm. Crucian carp is a widely farmed fish in China, loved for its delicious flavor, especially by the elderly and children. However, crucian carp has many long intermuscular bones, posing a risk of choking on these bones for the elderly and children.

[0003] Currently, there are two main approaches to manipulating intermuscular spines: one is to reduce the number and size of the spines, and the other is to thicken them to facilitate removal and reduce accidental ingestion. Patent CN202211723915 describes a method of knocking out the runx2b-A and runx2b-B genes in silver carp to obtain silver carp without intermuscular spines. Patent CN113151361A describes a method of knocking out the bmp6a and bmp6b genes in crucian carp to obtain crucian carp with reduced or completely absent intermuscular spines. Patent CN202411391037 describes a method of gene editing in zebrafish bmp8a to obtain zebrafish with blunted and thickened intermuscular spines.

[0004] Using CRISPR / Cas9 gene editing technology for multi-target knockout is a mature molecular breeding method. Compared with traditional single-target knockout, multi-target knockout has a higher mutation efficiency. Summary of the Invention

[0005] The present invention aims to address the problems of high cost and high mortality rate when using multi-target knockout in existing technologies, and provides a breeding method for reducing the intermuscular spines of crucian carp.

[0006] This invention adopts the following technical solution: a cultivation method for reducing the intermuscular spines of crucian carp, comprising the following steps: (1) The F0 generation of crucian carp strains with loss of function of the piezo1 gene was constructed using the gene knockout method. Three gene knockout target sites were designed corresponding to exons 3, 5, and 9 of the crucian carp piezo1-A and piezo1-B genes. The three gene knockout target sites are as follows: piezo1-T1: 5'-TGCATTATCAAGGCTGGGGA-3', the nucleotide sequence is shown in SEQ ID NO:1; piezo1-T2: 5'-GCTGTGCTGTGGCACGGAGG-3', the nucleotide sequence is shown in SEQ ID NO:2; piezo1-T3: 5'-GGGTGAGGCTGGAGAGGAAG-3', the nucleotide sequence is shown in SEQ ID NO:3; (2) The efficiency of piezo1 gene mutation was tested in the F0 generation, and the crucian carp with high knockout efficiency were mated with wild crucian carp to obtain the offspring F1; (3) Take crucian carp with the same mutation site in F1 generation as parents and raise them together. Intraspecific breeding is used to obtain a homozygous strain of crucian carp with reduced intermuscular spines.

[0007] Furthermore, the nucleotide sequence of the piezo1-T1 forward primer is shown in SEQ ID NO:4: 5'-tgtaaaacgacggccagtCTCCATTCCACAGGACACAC-3'; The nucleotide sequence of the piezo1-T1 reverse primer is shown in SEQ ID NO:5: 5'-gtgtcttGCCTGGACCAACTACTAACC-3'.

[0008] Furthermore, the nucleotide sequence of the piezo1-T2 forward primer is shown in SEQ ID NO:6: 5'-tgtaaaacgacggccagtTGTAGAAGGAGAAGATGAGGGAA-3'; The nucleotide sequence of the piezo1-T2 reverse primer is shown in SEQ ID NO:7: 5'-gtgtcttGTCCAACTATTATGCTAAGCCTG-3'.

[0009] Furthermore, the nucleotide sequence of the piezo1-T3 forward primer is shown in SEQ ID NO:8: 5'-tgtaaaacgacggccagtACAGCTCTGTCTCCTTGAAC-3'; The nucleotide sequence of the piezo1-T3 reverse primer is shown in SEQ ID NO:9: 5'-gtgtcttCAAATTGGGGGCTTTGTCCA-3'.

[0010] Furthermore, the nucleotide sequence of the M13F-FAM primer is shown in SEQ ID NO:15: 5'FAM-TGTAAAACGACGGCCAGT-3'.

[0011] Furthermore, the nucleotide sequence of the piezo1-A gene is shown in SEQ ID NO:10, and the nucleotide sequence of the piezo1-B gene is shown in SEQ ID NO:11.

[0012] Furthermore, the gene knockout in step (1) is performed using the CRISPR / Cas9 method.

[0013] The method for constructing gene deletion mutant strains of crucian carp using the CRISPR / Cas9 gene knockout method is as follows: (1) Three knockout target sites were designed in the third, fifth and ninth exon regions of the crucian carp piezo1-A gene and its copy gene piezo1-B; the templates of the three target sites were mixed in equal amounts and transcribed in vitro to synthesize sgRNA, which was then mixed with Cas9 protein at a molar ratio of about 1.2:1 to prepare a mixture for gene editing microinjection. (2) Take sexually mature crucian carp for artificial insemination, and inject the mixture from step (1) into the embryo. When injecting, the drug should be accurately injected into the cell at the one-cell stage. (3) DNA was extracted from embryos 24 hours after injection for fluorescent PCR and capillary electrophoresis was performed to detect the knockout efficiency. (4) Take the DNA from the tail fin of four-month-old injected crucian carp for fluorescent PCR and capillary electrophoresis detection. Leave the effective mutant F0 generation with a number of inserted or deleted bases not of 3n. Use alizarin red staining to observe the knockout crucian carp F0 phenotype. Raise the effective mutant crucian carp to adulthood.

[0014] Furthermore, in step (2), crucian carp are injected with 2 mg / kg of maleate dioxin and 5 μg / kg of luteinizing hormone-releasing hormone analogue. After 10-12 hours, the crucian carp reach sexual maturity. Sperm and eggs are then artificially extracted and mixed for dry artificial insemination.

[0015] Furthermore, in step (1), the final concentration of Cas9 protein in the mixture is 2500 ng / μL, and the final concentration of sgRNA in the mixture is 600 ng / μL.

[0016] Beneficial effects of this invention: (1) This invention uses CRISPR / Cas9 to perform three-target editing on the crucian carp piezo1-A gene and its copy gene piezo1-B to obtain crucian carp with reduced intermuscular spines, thereby reducing the risk of accidental ingestion of intermuscular spines; (2) The cultivation method of the present invention significantly reduces the cost of knockout, laying a good foundation for application. Attached Figure Description

[0017] Figure 1 This is a capillary electrophoresis result of embryonic-stage injected crucian carp and wild crucian carp in an embodiment of the present invention.

[0018] Figure 2 This is a comparison of the body size of four-month-old F0 crucian carp in an embodiment of the present invention.

[0019] Figure 3 This is a comparison of capillary electrophoresis results at three target sites between three randomly selected four-month-old injected crucian carp and wild crucian carp in an embodiment of the present invention.

[0020] Figure 4 Alizarin red staining of the tail of crucian carp and wild crucian carp after injection in this embodiment of the invention: white arrows represent ossicles of the medullary arch, and black arrows represent ossicles of the vascular arch.

[0021] Figure 5 This is an illustration of the in vitro separation of intermuscular bone from crucian carp and wild crucian carp after injection and staining with alizarin red, as shown in an embodiment of the present invention. Detailed Implementation

[0022] To enable those skilled in the art to better understand the present invention, the present invention will be clearly and completely described below in conjunction with specific embodiments.

[0023] The Cas9 protein with nuclear localization signal in this embodiment of the invention was purchased from Genscript Biotech Inc., catalog number Z03389.

[0024] The T7 High Yield RNA Transcription Kit used in this embodiment of the invention was purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number TR101-01.

[0025] Example 1:

[0026] 1. Partial nucleotide sequence of the piezo1 gene in cloned crucian carp (1) Download the crucian carp piezo1-A (ENSYGUG00000015181) and piezo1-B (ENSYGUG00000047551) sequences from the NCBI database; (2) Using wild crucian carp cDNA as a template, the piezo1-A and piezo1-B sequences were amplified to obtain partial sequences of the coding regions of crucian carp piezo1-A and piezo1-B as shown in SEQ ID NO:10 and SEQ ID NO:11; 2. Target selection of the target gene and in vitro RNA transcription Three target sites were designed corresponding to the exons of the crucian carp piezo1-A and piezo1-B genes: piezo1-T1: 5'-TGCATTATCAAGGCTGGGGA-3' (shown in SEQ ID NO:1) piezo1-T2: 5'-GCTGTGCTGTGGCACGGAGG-3' (shown in SEQ ID NO:2) piezo1-T3: 5'-GGGTGAGGCTGGAGAGGAAG-3' (shown in SEQ ID NO:3) 3. The three target templates were mixed in equal amounts and synthesized simultaneously using the T7 High Yield RNA Transcription Kit. The synthesized sequences are as follows: sgRNA (piezo1-T1): shown in SEQ ID NO:12 GGCAUUAUCAAGGCUGGGGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGGCUUUU sgRNA (piezo1-T2): shown in SEQ ID NO:13 GGUGUGCUGUGGCACGGAGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAGUGGCACCGAGUCGGGCUUUU sgRNA (piezo1-T3): shown in SEQ ID NO:14 GGGUGAGGCUGGAGAGGAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGGCUUUU The Cas9 protein was mixed with the three sgRNAs mentioned above in a certain proportion, as shown in Table 1. Each crucian carp egg was injected with 2500 pg of Cas9 protein and 600 pg of sgRNA.

[0027] Table 1. Crucian carp embryo injection system Cas9 protein concentration (ng / μL) Total concentration of piezo1 sgRNA (ng / μL) Cas9 protein volume (μL) piezo1 sgRNA volume (μL) Water (μL) Total volume (μL) Injection volume (nL) 4000 3000 3.2 1 0.8 5 1

[0028] Example 2:

[0029] 1. Artificial insemination of crucian carp Inducing spawning is done by injecting hormones into the pectoral fins of crucian carp broodstock 10-12 hours in advance, including 2 mg / kg of diometabolum maleate (Dom) and 5 μg / kg of luteinizing hormone-releasing hormone analog (A2). After the eggs of the broodstock crucian carp injected with oxytocin mature, wipe the genital opening of the fish with a dry, clean towel. Gently press the abdomen of the fish to squeeze out the eggs, and examine the quality of the eggs under a microscope. If the eggs are round, uniform in size, and the egg membrane absorbs water normally, they can be used for injection. Collect the high-quality eggs in disposable sterile culture dishes and store them at 4°C. Gently press the abdomen of the male fish to squeeze out the sperm, and examine the quality of the male fish's semen under a microscope. Collect the semen into centrifuge tubes and store it at 4°C. Place a graduated plastic culture dish at the bottom of a water tank containing aerated water. Take an appropriate amount of sperm and eggs, mix them evenly in a dry culture dish, and then sprinkle them evenly into the water tank. After the fertilized eggs sink and adhere to the culture dish, gently shake off the unattached eggs, remove the culture dish, rinse it with clean water, and leave a small amount of water in the culture dish to submerge the fertilized eggs.

[0030] 2. Screening of target gene mutants and obtaining homozygous mutants: Approximately 1 nL of a mixture of Cas9 protein and sgRNA was injected into crucian carp embryos during the single-cell stage. Twenty-four hours post-injection, DNA was extracted from 10 randomly selected eggs for fluorescent PCR, and capillary electrophoresis was used to assess the injection knockout efficiency. Primers used were: The nucleotide sequence of the piezo1-T1 forward primer is shown in SEQ ID NO:4: 5'-tgtaaaacgacggccagtCTCCATTCCACAGGACACAC-3'; piezo1-T1 reverse primer: 5'-gtgtcttGCCTGGACCAACTACTAACC-3', nucleotide sequence is shown in SEQ ID NO:5; The nucleotide sequence of the piezo1-T2 forward primer is shown in SEQ ID NO:6: 5'-tgtaaaacgacggccagtTGTAGAAGGAGAAGATGAGGGAA-3'; The nucleotide sequence of the piezo1-T2 reverse primer is shown in SEQ ID NO:7: 5'-gtgtcttGTCCAACTATTATGCTAAGCCTG-3'; The nucleotide sequence of the piezo1-T3 forward primer is shown in SEQ ID NO:8: 5'-tgtaaaacgacggccagtACAGCTCTGTCTCCTTGAAC-3'; The nucleotide sequence of the piezo1-T3 reverse primer is shown in SEQ ID NO:9: 5'-gtgtcttCAAATTGGGGGCTTTGTCCA-3'; The nucleotide sequence of the M13F-FAM primer is shown in SEQ ID NO:15: 5'FAM-TGTAAAACGACGGCCAGT-3'.

[0031] like Figure 1 As shown, the capillary electrophoresis results of three target sites were obtained from six fertilized crucian carp injected five days after fertilization and wild crucian carp. The red asterisks represent the wild peak positions in the capillary electrophoresis. The capillary electrophoresis results of the injected crucian carp during the embryonic period show that the injected crucian carp embryos exhibited more band peaks compared to wild crucian carp, indicating that high mutation efficiency was generated at all three target sites after injection.

[0032] DNA was extracted from the tail fins of each crucian carp in batches from the four-month-old F0 group that had been injected. The body size of the four-month-old F0 crucian carp changed from... Figure 2 It was found that capillary electrophoresis successfully screened for the knockout of crucian carp. Alizarin red staining was used to detect the effect on the intramuscular spines of the crucian carp. Crucian carp with high knockout efficiency were bred in groups to obtain F1 offspring. DNA was extracted from the tails of the F1 generation crucian carp and screened for the same mutation site using capillary electrophoresis. First-generation sequencing confirmed that crucian carp with the same mutation could be used as homozygous parents for mixed culture. Further intraspecific breeding was then conducted to establish a large-scale homozygous strain. Figure 3 As shown, capillary electrophoresis results of three randomly selected four-month-old injected crucian carp and wild crucian carp at three target sites indicate that the injected population generally exhibited sequence insertions or deletions, affecting normal gene function. The red stars represent the positions of the wild peaks. Skeletal staining of homozygous mutant crucian carp was performed using... Figures 4-5 It can be seen that the intermuscular spines are significantly reduced after mutation. This indicates that the present invention can successfully cultivate crucian carp with reduced intermuscular spines.

[0033] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A method for cultivating crucian carp with reduced intermuscular spines, characterized in that: Includes the following steps: (1) The F0 generation of crucian carp gene deletion mutant strains was constructed using the gene knockout method. Three knockout target sites were designed targeting exons 3, 5, and 9 of the crucian carp piezo1-A and piezo1-B genes. These three knockout target sites matched both piezo1-A and piezo1-B. The sequences of the three target sites are as follows: The piezo1-T1 nucleotide sequence is shown in SEQ ID NO:1: 5'-TGCATTATCAAGGCTGGGGA-3'; The piezo1-T2 nucleotide sequence is shown in SEQ ID NO:2: 5'-GCTGTGCTGTGGCACGGAGG-3'; The piezo1-T3 nucleotide sequence is shown in SEQ ID NO:3: 5'-GGGTGAGGCTGGAGAGGAAG-3'; (2) Screening of the piezo1 gene mutation efficiency of F0 generation crucian carp obtained by microinjection, and mating crucian carp with high knockout efficiency with wild crucian carp to obtain offspring F1; (3) Take crucian carp with the same mutation site in F1 generation as homozygous parents and mix them together to obtain homozygous crucian carp with reduced intermuscular spines through intraspecific breeding.

2. The cultivation method for reducing intermuscular bones in crucian carp according to claim 1, characterized in that: The nucleotide sequence of the piezo1-T1 forward primer is shown in SEQ ID NO:4: 5'-tgtaaaacgacggccagtCTCCATTCCACAGGACACAC-3'; The nucleotide sequence of the piezo1-T1 reverse primer is shown in SEQ ID NO:5: 5'-gtgtcttGCCTGGACCAACTACTAACC-3'.

3. The method for cultivating crucian carp with reduced intermuscular spines according to claim 2, characterized in that: The nucleotide sequence of the piezo1-T2 forward primer is shown in SEQ ID NO:6: 5'-tgtaaaacgacggccagtTGTAGAAGGAGAAGATGAGGGAA-3'; The piezo1-T2 reverse primer is 5'-gtgtcttGTCCAACTATTATGCTAAGCCTG-3', with the nucleotide sequence shown in SEQ ID NO:

7.

4. The method for cultivating crucian carp with reduced intermuscular spines according to claim 3, characterized in that: The nucleotide sequence of the piezo1-T3 forward primer is shown in SEQ ID NO:8: 5'-tgtaaaacgacggccagtACAGCTCTGTCTCCTTGAAC-3'; The nucleotide sequence of the piezo1-T3 reverse primer is shown in SEQ ID NO:9: 5'-gtgtcttCAAATTGGGGGCTTTGTCCA-3'.

5. The method for cultivating crucian carp with reduced intermuscular spines according to claim 1, characterized in that: The nucleotide sequence of the M13F-FAM primer, as shown in SEQ ID NO:15, is: 5'FAM-TGTAAAACGACGGCCAGT-3'.

6. The method for cultivating crucian carp with reduced intermuscular spines according to claim 1, characterized in that: The cDNA nucleotide sequence of the piezo1-A gene is shown in SEQ ID NO:10, and the cDNA nucleotide sequence of the piezo1-B gene is shown in SEQ ID NO:

11.

7. The cultivation method for reducing intermuscular bones in crucian carp according to claim 1, characterized in that: The gene knockout in step (1) is performed using the CRISPR / Cas9 method.

8. The method for cultivating crucian carp with reduced intermuscular spines according to claim 1, characterized in that: The method for constructing gene deletion mutant strains of crucian carp using the CRISPR / Cas9 gene knockout method is as follows: (1) Three knockout target sites were designed in the exon regions of the crucian carp piezo1-A gene and piezo1-B gene; the templates of the three target sites were mixed in equal amounts and transcribed in vitro to synthesize sgRNA, which was then mixed with Cas9 protein at a molar ratio of about 1.2:1 to prepare a mixture for gene editing injection; (2) Take sexually mature crucian carp for artificial insemination, and inject the mixture from step (1) into the embryo. When injecting, the drug should be accurately injected into the cell at the one-cell stage. (3) DNA was extracted from embryos 24 hours after injection for fluorescent PCR and capillary electrophoresis was performed to detect the knockout efficiency. (4) When the injected crucian carp grow to four months old, DNA is extracted from the tail fin for fluorescent PCR and capillary electrophoresis. F0 generation with the target sequence inserted or missing bases of non-3n is retained. Alizarin red is used to stain the bone, and the number and size of intermuscular spines of the F0 generation of piezo1 knockout crucian carp are observed. The F0 generation of crucian carp with the target sequence inserted or missing bases of non-3n is raised to adulthood.

9. The method for cultivating crucian carp with reduced intermuscular spines according to claim 8, characterized in that: In step (2), crucian carp are injected with 2 mg / kg of maleate dioxin and 5 μg / kg of luteinizing hormone-releasing hormone analogue. After 10-12 hours, the crucian carp reach sexual maturity. Sperm and eggs are then artificially extracted and mixed for dry artificial insemination.

10. The method for cultivating crucian carp with reduced intermuscular spines according to claim 8, characterized in that: In step (1), the Cas9 protein in the mixture carries a nuclear localization signal and has a final concentration of 2500 ng / μL, while the sgRNA in the mixture has a final concentration of 600 ng / μL.

Images