Use of a clec4d and apoe double knockout mouse in atherosclerosis

By constructing a mouse model with the Clec4d and Apoe double gene deletions, and combining high-fat induction and histopathological staining, the unknown problem of the role of Clec4d in the existing technology was solved, realizing an effective tool for atherosclerosis research, reducing plaque area and improving plaque stability, and providing a new experimental platform for drug development.

CN122207650APending Publication Date: 2026-06-16XINXIANG MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610150379.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-03
Publication Date
2026-06-16

Smart Images

  • Figure CN122207650A_ABST
    Figure CN122207650A_ABST
Patent Text Reader

Abstract

This application discloses the application of a Clec4d and Apoe double gene deletion mouse model in atherosclerosis, relating to the field of animal model technology. This Clec4d and Apoe double gene deletion mouse model is constructed using CRISPR / Cas9 technology, and Clec4d is further obtained through hybridization and self-crossing. ‑ / ‑ Apoe ‑ / ‑ Mouse. The purpose of this invention is to provide an animal model that clearly defines the role of Clec4d in atherosclerosis and to establish a standardized application method for its use in research on this disease. By subjecting this model mouse to a high-fat diet, monitoring of systemic physiological indicators, histopathological staining, and blood lipid analysis, the effects of Clec4d deficiency on atherosclerotic plaque formation, lipid metabolism, and inflammatory processes can be revealed. This model provides an effective experimental tool for the study of the mechanisms of atherosclerosis and drug screening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of animal model technology, and more particularly to the application of a Clec4d and Apoe double gene deletion mouse in atherosclerosis. Background Technology

[0002] Atherosclerosis is a chronic inflammatory disease characterized by lipid accumulation in the arterial wall, accompanied by persistent immune cell infiltration and inflammatory response, ultimately leading to plaque formation, instability, and rupture, triggering serious cardiovascular and cerebrovascular events such as myocardial infarction and stroke. The occurrence and development of this disease occur within the chronic inflammatory microenvironment of the arterial wall (scenario constraint layer: specific pathophysiological environment).

[0003] In research on the mechanisms of this disease, the role of pattern recognition receptors, particularly the C-type lectin receptor family, in the recognition of endogenous danger signals by immune cells and the regulation of the inflammatory microenvironment of atherosclerosis has received increasing attention. C-type lectin domain family 4 member D (Clec4d) is an important member of this family, primarily expressed on the surface of myeloid cells (such as monocytes, macrophages, and neutrophils). Existing research indicates that Clec4d can recognize various pathogen-associated molecular patterns, including β-glucan, and plays a crucial role in the host's innate immune defenses, such as antifungal activity.

[0004] However, while the role of Clec4d in infection immunity is understood, its role in regulating the progression of atherosclerosis has not been reported. Therefore, the lack of a clear understanding in this field regarding whether and how Clec4d affects the development of atherosclerosis, as well as how to construct animal models for experimental purposes, hinders the progress in understanding disease mechanisms or developing potential intervention strategies based on this target. Summary of the Invention

[0005] This application provides an application of Clec4d and Apoe double gene deletion mice in atherosclerosis, which solves the problem that the role of Clec4d in regulating the process of atherosclerosis has not been reported in the prior art.

[0006] This application provides a Clec4d and Apoe double gene deletion mouse model, in which both Clec4d and Apoe genes are knocked out.

[0007] Furthermore, methods for constructing mouse models include: Clec4d gene deletion mice were constructed using CRISPR / Cas9 technology; The Clec4d gene-deleted mice were crossed with Apoe gene-deleted mice. Mice with deletions of both the Clec4d and Apoe genes were obtained through self-crossing.

[0008] Furthermore, mice obtained through self-crossing with deletions of both the Clec4d and Apoe genes were mated with their siblings to establish a genetically stable offspring mouse strain with homozygous deletions at both gene loci.

[0009] The above-mentioned application of Clec4d and Apoe double gene deletion mice in atherosclerosis, and its application in the study of atherosclerotic diseases involving the Clec4d gene.

[0010] Furthermore, it can be used as a disease model for atherosclerosis research and for drug target validation and treatment strategy development.

[0011] One or more technical solutions provided in the embodiments of this application have at least the following technical effects or advantages: A double-gene deletion animal model with a clear genetic background and stable phenotype was successfully constructed: homozygous mice with both Clec4d and Apoe genes deleted were successfully obtained through CRISPR / Cas9 technology and hybridization breeding strategies. This model has a clear genotype and is stably inherited, providing a reliable in vivo experimental tool for studying Clec4d function in the context of atherosclerosis.

[0012] An efficient and reproducible phenotypic evaluation system for atherosclerosis was established. Based on this model, combined with hyperlipidemia induction, histopathological staining, and blood lipid testing, a systematic and quantitative method for atherosclerosis phenotypic analysis was developed. This method is standardized in operation, yields highly comparable results, and is suitable for standardized research on the mechanisms of this disease.

[0013] The model exhibits a significant and stable anti-atherosclerotic phenotype: compared with Apoe single-gene deletion mice, Clec4d / Apoe double-gene deletion mice showed the following after high-fat feeding: significantly reduced aortic plaque area, significantly reduced proportion of plaque necrosis core, improved lipid profile, and more stable weight gain; this model has clear experimental value in simulating the effect of Clec4d deletion on the atherosclerotic process.

[0014] This model provides a novel experimental platform for the study of atherosclerosis mechanisms and drug screening: it fills the gap in the lack of a dedicated animal model for Clec4d in atherosclerosis research, and can be used to: elucidate the specific mechanism of action of Clec4d in atherosclerosis; evaluate drugs or interventions targeting the Clec4d pathway; and explore the regulatory network between immune metabolism and atherosclerosis.

[0015] Therefore, this model not only has significant value in basic research but also provides a practical preclinical experimental system for the development of related treatment strategies. Its scientific significance is outstanding: it is the first time that Clec4d deficiency has been demonstrated in an animal model to alleviate the progression of atherosclerosis in the context of Apoe deficiency, clarifying the role of Clec4d as a potential regulatory target for atherosclerosis, and providing new theoretical basis and experimental platform for the study of the mechanism of this disease and the development of treatment strategies. Attached Figure Description

[0016] Figure 1 This invention describes the strategy for constructing Clec4d gene knockout mice, electrophoretic identification, and sequencing genotype detection. Figure 2 The absence of Clec4d in this invention affects Apoe - / - Effects of atherosclerosis phenotype and metabolic indicators in mice; Figure 1 In the diagram: A is a schematic diagram of two guide RNA (sgRNA) sequences targeting the Clec4d gene; B is an electrophoresis diagram of the knockout genotype (KO) of Clec4d gene knockout mice; C is an electrophoresis diagram of the wild-type (WT) of Clec4d gene knockout mice; D shows the expected Clec4d knockout mutation in F0 animals as revealed by sequencing analysis, with the red dashed line indicating deletion. Figure 2 A: Macroscopic images of the entire aorta of two groups of mice stained with Oil Red O, visually showing the plaque distribution; B: Statistical analysis of patch area in Figure (A); C: Microscopic images of H&E stained sections of the aortic root of two groups of mice; D: Statistical analysis of patch area and necrotic core ratio in Figure (C).

[0017] E: A more detailed statistical analysis of the proportion of necrotic cores in Figure (C).

[0018] F: Body weight changes in the two groups of mice during the high-fat feeding period from 0 to 14 weeks.

[0019] GJ: Statistical analysis of the comparison of total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) levels in the plasma of two groups of mice. Detailed Implementation

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to limit the invention; the term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0021] Example 1: To directly verify and reveal the role of Clec4d in regulating the progression of atherosclerosis, and to address the technological gap in existing technologies regarding the lack of tools specifically for studying Clec4d function in the pathological context of atherosclerosis, this example provides the optimal technical solution of the present invention. The core innovation of this solution lies in: creatively constructing and applying a "Clec4d and Apoe double gene deletion (Clec4d... - / - Apoe - / - The "Apoe mouse" is a novel animal model system. Targeting the specific chronic inflammatory disease environment of atherosclerosis, it combines the disease susceptibility basis (Apoe deletion) with the loss of function of the target gene (Clec4d deletion), thus providing an effective in vivo research tool for solving the aforementioned technical problems.

[0022] First, Clec4d single-gene deletion mice were constructed. Determination of the target sequence: Using CRISPR / Cas9 gene editing technology and CRISPOR online design software, the specific target site of the Clec4d gene to be knocked out in mice was determined to achieve its loss-of-function knockout.

[0023] Specifically, the mouse Clec4d gene sequence (ENSMUSG00000030144) was located in the mouse genome database ensembl (http: / / asia.ensembl.org). Then, the online design software CRISPOR was used to screen and design specific guide RNAs (sgRNAs) within the Intron 1-2 and Intron 5-6 regions of this gene. (See details below.) Figure 1 As shown in Figure A. The designed sgRNAs are intended to induce loss of gene function through frameshift mutations or large deletions; their sequences are detailed below (all sgRNAs were synthesized and provided by Nanjing Genscript Biotech Co., Ltd.): sgRNA498: 5'-GCTACAACATATTCCTTCGC-3' sgRNA500: 5'-CGCTGAGTAAGCACTTACAT-3' Embryo microinjection: Purified Cas9 mRNA and the above-mentioned sgRNA were co-injected into the pronucleus of fertilized eggs from C57BL / 6J background mice.

[0024] Embryo transfer and offspring generation: The injected embryos were transferred into the oviducts of pseudopregnant mice, and F0 generation mice were obtained by full-term delivery.

[0025] Genotyping and strain establishment: Genomic DNA was extracted from mouse tails, and specific primers were designed targeting the Clec4d gene editing site for PCR amplification. The PCR products were then analyzed by gel electrophoresis or sequencing. The primer sequences are as follows: Clec4d-F1: GGGCATACTTTTCATTTTGTTTGGTG Clec4d-R1: AGCCCTTGTTATATTACTCCTCACCA Clec4d-F2:GCTTACCATTGAGTCACACTGCT Clec4d-R2:GGTTTCTGTCTCAAGTTCCCTGCA The PCR reaction system was as follows: 20 ng of mouse tail DNA was added as template; 2 μL of upstream primer was added; 2 μL of downstream primer was added; 25 μL of 2 × Taq Master Mix (purchased from Vazyme, P111-01) was added; and H2O was added to a total volume of 50 μL.

[0026] The PCR reaction program was as follows: pre-denaturation at 94℃ for 5 min; followed by 35 cycles of denaturation at 94℃ for 30 s, annealing at 60℃ for 30 s, and extension at 72℃ for 30 s; and a final extension at 72℃ for 10 min. When using the Clec4d-F1 and Clec4d-R1 primer combination, a band of approximately 350 bp was amplified only when a large knockout allele was present. Figure 1 B-gel image); while when using the Clec4d-F2 and Clec4d-R2 primer combination for amplification, a 496 bp band was amplified only when the wild-type allele was present ( Figure 1 (C gel image). After obtaining the PCR product, 2 μL of the product was used for electrophoresis detection. By analyzing the amplification results of the two primer pairs, it can be determined whether the Founder mouse carries a large knockout allele. Figure 1 The identification results shown in B and C indicate that samples R46, 48, 49, 52-58, and R61-62 are homozygous mice with Clec4d gene deletion, while R47, 50, 51, 59, and 60 are heterozygous mice with Clec4d gene deletion.

[0027] Based on the electrophoresis results, the remaining PCR products from one Clec4d gene deletion homozygous mouse (R62) and one wild-type C57BL / 6J mouse were sent for sequencing. Figure 1As shown in D, the Clec4d gene in the obtained Founder mice has a deletion of 5764 bp, which covers the genome sequence from Exon 2 to Exon 5.

[0028] The Clec4d gene homozygous knockout (Clec4d) will be screened out. - / - The founders mice were backcrossed with wild-type C57BL / 6J mice, and the offspring underwent continuous genotyping and sibling mating to ultimately breed homozygous Clec4d mice with consistent genetic background and stable genetics. - / - Mouse strains.

[0029] Construct mice with double gene deletion of Clec4d and Apoe; To place the study of Clec4d gene function within the classic pathological context of atherosclerosis, the Clec4d obtained above... - / - Mice and atherosclerosis-susceptible mouse models—Apoe gene knockout (Apoe - / - ) mice (commercially purchased Apoe - / - Mice (C57BL / 6J background) were hybridized.

[0030] Hybrid breeding: The homozygous Clec4d - / - Mice and homozygous Apoe - / - Mice mate to produce F1 generation heterozygotes (Clec4d) + / - Apoe + / - ).

[0031] Self-crossing and genotype screening: F1 generation mice were self-crossed. In F2 generation offspring, genotype identification was performed using combined PCR targeting the Clec4d and Apoe gene loci to screen for mice that were homozygous for both Clec4d and Apoe gene knockout (Clec4d...). - / - Apoe - / - ) mouse individuals.

[0032] Strain propagation and stabilization: The selected Clec4d strains - / - Apoe - / - By mating sibling mice with double gene deletions to expand the breeding population, the resulting offspring mouse strains exhibited homozygous deletions at both gene loci and were genetically stable.

[0033] Example 2: To verify the Clec4d constructed above - / - Apoe - / - The model can effectively reveal the role of Clec4d in atherosclerosis and demonstrate its breakthrough as an optimal solution tool. This embodiment presents a systematic phenotypic and mechanistic analysis.

[0034] Experimental design: Grouping of experimental animals: Control group: Apoe - / - Mice (n=16). This group is a classic positive control for atherosclerosis research, possessing disease susceptibility but with intact Clec4d gene function.

[0035] Experimental group: Clec4d - / - Apoe - / - Double gene deletion mice (n=17). This group is the disease model constructed in this invention, specifically targeting mice with Clec4d function deficiency.

[0036] Disease model induction: Both groups of mice were fed a high-fat diet (containing 21% fat and 0.15% cholesterol) starting at 8 weeks of age for 14 weeks to stably induce atherosclerotic plaque formation. Mouse weight was recorded weekly to monitor basic health status.

[0037] Effect evaluation and data analysis: 1. Overall assessment of atherosclerotic lesions; Methods: After 14 weeks of high-fat feeding, mice were sacrificed, the entire aorta (from the heart to the bifurcation of the iliac artery) was separated, longitudinally dissected, and Oil Red O staining was performed to mark lipid deposits (plaques) in the arterial wall.

[0038] Results and conclusions: Figure 2 As shown in A, through intuitive comparison and statistical analysis in 2B, Clec4d - / - Apoe - / - The total aortic plaque coverage area of ​​the experimental group mice was significantly smaller than that of the Apoe mice. - / - Control group (p<0.05). This result is the first direct and conclusive demonstration at the in vivo animal level that the deletion of the Clec4d gene can significantly reduce the overall pathological burden of the disease during the development of atherosclerosis.

[0039] 2. Stability assessment of aortic root plaques; Methods: Frozen or paraffin sections were prepared from the root of the mouse aorta and stained with hematoxylin and eosin (H&E) and Oil Red O, respectively, to quantitatively analyze the plaque area and the proportion of necrotic cores within the plaque.

[0040] Results and conclusions: Figure 2 As shown in CE, H&E staining revealed plaque formation in the aortic root of both groups of mice, but quantitative analysis revealed more profound differences. Clec4d - / - Apoe - / - The proportion of necrotic cores within plaques was significantly lower in the experimental group mice than in the Apoe group mice. - / - control group ( Figure 2E, p<0.0001). Necrotic core is a key feature of plaque instability and rupture. This result indicates that Clec4d deficiency not only reduces plaque size but, more importantly, improves plaque stability, pointing to potentially greater clinical benefits than simply reducing plaque size (such as reducing the risk of myocardial infarction), highlighting the high value of the findings of this invention.

[0041] Furthermore, body weight was monitored during the experiment, and the results were as follows: Figure 2 F, within a certain time period, there was no statistically significant difference in body weight between the two groups of mice, Clec4d - / - Apoe - / - The experimental group mice had a slightly higher body weight than Apoe - / - The body weight of the mice in the experimental group had no significant impact on the experimental results.

[0042] 3. Systemic metabolic index analysis; Methods: Mouse plasma was collected, and the levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) were detected using a biochemical analyzer.

[0043] Results and conclusions: Figure 2 As shown in GI, Clec4d - / - Apoe - / - Experimental group and Apoe - / - In the control group mice, there were no statistically significant differences in plasma TC, TG, and LDL-C levels, but HDL-C levels were decreased. Since HDL-C can clear excess cholesterol from the vascular wall and reduce lipid deposition through a reverse cholesterol transport mechanism, the decrease in HDL-C in this experiment is inconsistent with the observed reduction in atherosclerosis and plaque stabilization phenotype, suggesting that Clec4d deficiency does not exert its effect through systemic regulation of blood lipid levels. Therefore, this indicates that the atherosclerosis-reducing and plaque-stabilizing effects of Clec4d deficiency are not achieved through the traditional pathway of altering systemic lipid metabolism levels, suggesting that Clec4d exerts its effect through other unique mechanisms.

[0044] This embodiment elaborates on Clec4d - / - Apoe - / - The process of constructing the double gene deletion mouse model and the application of this model in disease phenotypic analysis clearly demonstrates that the constructed Clec4d model... - / - Apoe - / - Mouse models are an effective tool for studying the function of Clec4d in atherosclerosis; using this model, it was revealed for the first time that Clec4d deficiency can significantly alleviate Apoe - / -This study elucidates the severity of atherosclerotic lesions in mice and enhances plaque stability, with this protective effect independent of systemic lipid changes. This not only clarifies the crucial role of Clec4d in this disease for the first time, filling a technological gap, but more importantly, it provides novel insights into the immune-inflammatory regulatory mechanisms of atherosclerosis and lays a solid experimental foundation for developing novel therapeutic strategies targeting Clec4d.

[0045] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A mouse with double gene deletion of clec4d and apoe, characterized in that, Both the Clec4d and Apoe genes were knocked out in the mouse model.

2. The clec4d and Apoe double gene deletion mouse as described in claim 1, characterized in that, Methods for constructing mouse models include: Clec4d gene deletion mice were constructed using CRISPR / Cas9 technology; The Clec4d gene-deleted mice were crossed with Apoe gene-deleted mice. Mice with deletions of both the Clec4d and Apoe genes were obtained through self-crossing.

3. The Clec4d and Apoe double gene deletion mouse as described in claim 1, characterized in that, Mice obtained through self-crossing with deletions of both the Clec4d and Apoe genes were used to establish a genetically stable offspring mouse strain with homozygous deletions at both gene loci.

4. The application of a Clec4d and Apoe double-gene deletion mouse as described in any one of claims 1-3 in atherosclerosis, characterized in that, Application in research on atherosclerotic diseases involving the Clec4d gene.

5. The application of a Clec4d and Apoe double-gene deletion mouse as described in claim 4 in atherosclerosis, characterized in that, Its applications include serving as a disease model for atherosclerosis research and for drug target validation and treatment strategy development.