Molecular marker, primer pair, kit for predicting pig daily gain and application thereof

Abstract

The application belongs to the technical field of biology and particularly relates to a molecular marker for predicting daily weight gain of pigs, a primer pair, a kit and application thereof. The nucleotide sequence of the molecular marker is shown as SEQ ID NO. 3, and the 474th site at the 5' end of the molecular marker is a polymorphic site, the base of which is C or G, and the daily weight gain of the pig with the genotype CC of the site is higher than that of the pig with the genotype GG. The molecular marker provided in the application is a molecular marker related to the growth performance of pigs, and is used for predicting the daily weight gain, feed conversion rate and other growth traits of pigs, and provides an accurate genetic basis for early selection of pigs.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker, primer pair, reagent kit, and their applications for predicting daily weight gain in pigs. Background Technology

[0002] Daily weight gain is a crucial breeding indicator for pig production performance, directly reflecting a pig's genetic potential and feed conversion efficiency during its growth stage. It has a decisive impact on improving the economic benefits and competitiveness of the pig farming industry. At the breeding level, this trait, with its high heritability, can effectively shorten the time it takes for pigs to reach market weight through continuous selective breeding. Furthermore, it is closely linked to feed conversion efficiency, laying the genetic foundation for rapid growth. From an economic perspective, improved daily weight gain significantly reduces feed and fixed costs per kilogram of pork. Increased production efficiency leads to lower costs, resulting in a more stable pork supply and more competitive prices. Therefore, improving pig production performance through modern breeding methods, combined with marker-assisted selection based on phenotypic characteristics, is of paramount importance.

[0003] Currently, molecular markers associated with daily weight gain traits in pigs mainly fall into two categories: one is targeting... IGF2 , MC4R , MEP1B One type of marker is the design of candidate genes; another type is the markers associated with SNP loci such as ASGA0056780 and rs80860411, selected through genome-wide association analysis. However, these molecular markers suffer from insufficient polymorphism information, specifically their limited ability to distinguish individual genetic differences within a population, leading to low selection efficiency. Summary of the Invention

[0004] To address the deficiency in existing technologies regarding insufficient polymorphism information in molecular markers related to daily weight gain in pigs, this invention provides a molecular marker, primer pair, reagent kit, and their applications for predicting daily weight gain in pigs. To achieve the above objective, this invention employs the following technical solution.

[0005] This invention provides a molecular marker for predicting daily weight gain in pigs. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.3. The 474th position at the 5' end of the molecular marker is a polymorphic site with a base of C or G. Pigs with the genotype CC at this site have a higher daily weight gain than pigs with the genotype GG.

[0006] This invention identifies a molecular marker in a functionally conserved region of the pig genome related to growth and development. Located in a region with a relatively balanced allele frequency distribution within the population, this marker exhibits rich genotypic variation within the tested population, thus providing high polymorphism information content. In other words, it demonstrates a strong ability to distinguish individual genetic differences within the population and exhibits high selection efficiency. Compared to some existing molecular markers, which suffer from low information content and weak ability to distinguish individual genetic differences due to extreme allele frequency bias, the molecular marker provided by this invention has a site with moderate selection pressure but retains sufficient genetic variation. This ensures that the marker can effectively identify genetic differences between individuals in commercial breeding populations, providing a highly informative molecular basis for accurately assessing the genetic potential of pig growth performance, and significantly improving the accuracy and applicability of marker-assisted selection.

[0007] The present invention also provides primer pairs for amplifying the molecular markers for predicting daily weight gain in pigs, the primer pairs consisting of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.

[0008] The present invention also provides a kit for predicting the daily weight gain trait of pigs, the kit comprising the primer pair.

[0009] Preferably, the kit further includes enzymes, fluorescent labels, buffer reagents, and dNTPs for nucleic acid amplification reactions.

[0010] Preferably, the high daily weight gain trait refers to the young age at which the body reaches 115 kg, the high average daily weight gain throughout the period before reaching 115 kg, the high average daily weight gain throughout the period, and the high average daily feed intake; the low daily weight gain trait refers to the old age at which the body reaches 115 kg, the low average daily weight gain throughout the period before reaching 115 kg, the low average daily weight gain throughout the period, and the low average daily feed intake.

[0011] The present invention also provides the application of primer pairs for amplifying the molecular markers for predicting daily weight gain in pigs or the kit for predicting the daily weight gain trait in pigs.

[0012] Preferably, the steps for predicting the daily weight gain trait of pigs are as follows: Genomic DNA was extracted from the pigs to be tested.

[0013] Using the genomic DNA as a template, PCR amplification was performed using the primer pair.

[0014] Based on the genotype at position 474 from the 5' end of the PCR amplification product, the daily weight gain trait of the pigs to be tested can be predicted.

[0015] Preferably, if the genotype at position 474 from the 5' end of the PCR amplification product is CC, then the pigs being tested exhibit a high daily weight gain trait; if the genotype at position 474 from the 5' end of the PCR amplification product is GG, then the pigs being tested exhibit a low daily weight gain trait.

[0016] Among them, pigs with high daily weight gain traits were characterized by young age at reaching 115kg body weight, high average daily weight gain throughout the period before reaching 115kg body weight, high average daily weight gain throughout the period, and high average daily feed intake; pigs with low daily weight gain traits were characterized by old age at reaching 115kg body weight, low average daily weight gain throughout the period before reaching 115kg body weight, low average daily weight gain throughout the period, and low average daily feed intake.

[0017] Preferably, the pigs to be tested include the Duroc breed.

[0018] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides a molecular marker for predicting daily weight gain in pigs. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.3. The 474th position at the 5' end of the molecular marker is a polymorphic site with a base of C or G. Pigs with the genotype CC at this site have a higher daily weight gain than pigs with the genotype GG. This invention discovers this molecular marker through a functionally conserved region related to growth and development in the pig genome. Located in a genomic region with a relatively balanced allele frequency distribution in the population, it exhibits rich genotypic variation in the tested population, thus providing high polymorphic information content. This means it has a strong ability to distinguish individual genetic differences within the population and high selection efficiency. Compared to some existing molecular markers, which suffer from low information content and weak ability to distinguish individual genetic differences due to extreme allele frequency bias, the molecular marker provided by this invention has a site with moderate selection pressure but retains sufficient genetic variation. This ensures that the marker can effectively identify genetic differences between different individuals in commercial breeding populations, providing a high-information molecular basis for accurately assessing the genetic potential of pig growth performance, and significantly improving the accuracy and applicability of marker-assisted selection.

[0019] 2. This invention provides SNP molecular markers related to pig growth performance, specifically molecular markers for predicting daily weight gain in pigs. Pigs with specific genotypes at the SNP loci of these molecular markers are older at 115kg body weight, have lower average daily weight gain before reaching 115kg body weight, lower average daily weight gain throughout the entire growth period, and lower average daily feed intake. These can serve as SNP molecular markers related to pig growth performance, used to predict daily weight gain in pig growth performance, screen for pigs with high daily weight gain, cull individuals with low daily weight gain, and for breeding methods to obtain pigs with high growth performance, thereby improving the speed of pig breeding. Attached Figure Description

[0020] Figure 1The pig provided in Example 1 of this invention CRAT Electrophoresis image of PCR amplification products at the chr.1:269392339 site; lane 1: sample 1, lane 2: sample 2, lane 3: sample 3.

[0021] Figure 2 The pig provided in Example 1 of this invention CRAT Genotyping results of gene chr.1:269392339 locus; where: A is of type CC; B is of type CG; C is of type GG. Detailed Implementation

[0022] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0023] Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well known in the art and as described in various general and more specific references, which are cited and discussed throughout this specification.

[0024] pig CRAT Gene polymorphism analysis revealed that pigs CRAT A SNP site is present in intron 5 of the gene. The physical location of this SNP site is: CRAT The gene is located at position 269392339 on chromosome 1, with genotypes CC, CG, and GG at this locus. Analysis was performed on growth records of pigs, including age at 115 kg body weight, average daily weight gain before 115 kg body weight, backfat thickness at 115 kg body weight, eye muscle thickness at 115 kg body weight, average daily feed intake, and average daily weight gain throughout the growth period. The association between these three genotypes and growth in the pig population was analyzed. Results showed that pigs... CRAT Therefore, this SNP locus was significantly associated with the age at which pigs reached 115 kg body weight, the average daily weight gain before reaching 115 kg body weight, the average daily weight gain throughout the entire period, and the average daily feed intake. Therefore, this invention, through the study of pigs... CRAT Association analysis between gene polymorphisms and pig growth performance identified SNP molecular markers associated with pig growth performance, revealing that pigs... CRAT The gene SNP locus chr.1:269392339 is associated with daily weight gain in pig growth performance.

[0025] Among them, pigs CRAT Gene is abbreviated as CRAT Gene. CRAT The gene SNP locus chr.1:269392339 is the nucleotide at position 269392339 on chromosome 1 of pigs. When the genotype of this SNP locus is GG, that is, the genotype at position 269392339 on chromosome 1 of pigs is GG homozygous, the pigs have low daily weight gain.

[0026] Based on the above findings, this invention provides, in one aspect, the application of a method for detecting SNP sites in products for predicting daily weight gain in pigs, wherein the SNP sites are located at... CRAT The gene is located at position 269392339 on chromosome 1, and the polymorphic base at this site is either C or G.

[0027] In some specific implementations, the evaluation indicators of growth performance include age at 115 kg body weight, average daily weight gain before 115 kg body weight, average daily weight gain throughout the entire period, and average daily feed intake.

[0028] In some specific embodiments, the product includes testing. CRAT The substance at gene SNP site chr.1:269392339.

[0029] In some specific implementations, the detection CRAT The substance for the gene SNP site chr.1:269392339 includes, but is not limited to, one or more of the following: reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for constructing sequencing libraries, or reagents for sequencing. More specifically, the detection... CRAT The substances for the gene SNP site chr.1:269392339 include, but are not limited to, primers, probes, enzymes for nucleic acid amplification reactions, fluorescent labels, buffer reagents, dNTPs, and salts. Depending on the specific detection method, those skilled in the art can select the above-mentioned reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for constructing sequencing libraries, and reagents for sequencing according to the methods described in general and more specific textbooks, references, process manuals, product instructions, and standard documents. This invention does not limit these selections.

[0030] In some specific implementations, the detection CRAT The substance at gene SNP site chr.1:269392339 includes materials used for amplification. CRAT The primer pair for the gene SNP site chr.1:269392339 consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.

[0031] According to another aspect of the present invention, a kit for predicting daily weight gain in pig growth performance is also provided, comprising methods for amplification. CRAT The primer pair for the gene SNP site chr.1:269392339 consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.

[0032] According to another aspect of the present invention, a method for predicting pig growth performance is also provided, comprising: CRAT Pigs with the genotype GG at gene SNP locus chr.1:269392339 are predicted to have low daily weight gain.

[0033] In some specific implementations, the growth performance includes age at 115 kg body weight, average daily weight gain before 115 kg body weight, average daily weight gain throughout the entire period, and average daily feed intake.

[0034] Another aspect of the present invention provides a method for predicting pig growth performance, comprising: CRAT The gene SNP locus chr.1:269392339 can be used as the sole identification target; it can also be combined with other targets, such as other polymorphic molecular markers, such as SSR molecular markers, STR molecular markers or InDel molecular markers, or other screening methods known in the art to assist in the prediction of pig growth performance.

[0035] According to another aspect of the present invention, a method for screening pigs with low daily weight gain is also provided, comprising screening pigs with low growth performance predicted by the above-described method.

[0036] In some specific implementations, the breed of pig in any of the above implementations is Duroc.

[0037] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0038] Example 1 1. Sample collection The experimental group in this embodiment consisted of 217 Duroc pigs raised under the same conditions. Blood was collected from the jugular vein and placed in anticoagulant tubes, which were then stored at 4°C.

[0039] The 217 Duroc pigs were raised in a standardized, enclosed pigsty with an all-in, all-out management system, equipped with a suitable temperature and humidity, ventilation, and clean drinking water feeding system. The stocking density and environmental conditions met the standards for fattening pigs in large-scale pig farms.

[0040] The Duroc breed pigs come from the pig farm of the Jilin Academy of Agricultural Sciences.

[0041] 2. Genomic DNA extraction Genomic DNA was extracted from 217 Duroc pigs using a commercially available rapid blood genomic DNA extraction kit. The concentration and purity of the DNA were determined using an ultra-micro spectrophotometer. The qualified DNA samples were aliquoted and stored at -20°C.

[0042] In the extraction of genomic DNA from 217 Duroc pigs, 21 Duroc pigs were randomly selected from the total number of pigs and divided into three groups. Blood samples from seven pigs in each group were mixed and then used for genomic DNA extraction. These samples were designated as Sample 1, Sample 2, and Sample 3, respectively.

[0043] Rapid extraction kit for blood genomic DNA: Axygen, APMNBLGDNA50.

[0044] 3. Primer design According to pigs published in the Ensembl database CRAT Gene sequence information was used to design primers using Primer Premier 5.0 software. The target fragment was 734 bp in length. Primers were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.

[0045] Among them, pigs CRAT Gene is abbreviated as CRAT The gene has a transcript ID of ENSSSCT00000039132.2.

[0046] The designed primers are as follows: CRAT The upstream primer at the chr.1:269392339 site, referred to as the upstream primer, has the nucleotide sequence shown in SEQ ID NO.1: 5'tctgtccctgcctgtgcct3'.

[0047] CRAT The downstream primer at the chr.1:269392339 site, referred to as the downstream primer, has the nucleotide sequence shown in SEQ ID NO.2: 5'TTGCCGCTGTTGAGCTTG3'.

[0048] 4. PCR amplification The PCR amplification reaction system was 20 μL: 10 μL of 2×PCR premix, 0.5 μL each of upstream and downstream primers, 0.5 μL of DNA, and 8.5 μL of double-distilled water. The DNA was the genomic DNA extracted above.

[0049] The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 4 min; 95℃ denaturation for 40 s, 65℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 34 cycles starting from the second step; 72℃ extension for 5 min; and storage at 4℃. The PCR amplification products were detected by 1.5% agarose gel electrophoresis, and the bright bands of the PCR amplification products were sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing.

[0050] CRAT The electrophoresis image of PCR amplification at the chr.1:269392339 locus is shown below. Figure 1 As shown in the diagram. Lane 1: Sample 1, Lane 2: Sample 2, Lane 3: Sample 3. All three samples amplified a single, clear target band, and the PCR amplification products in lanes 1, 2, and 3 were of consistent size and position, indicating that all three samples could represent the target band. CRAT The target fragment was amplified by PCR at the chr.1:269392339 site of the gene.

[0051] The target fragment, the PCR amplification product described above, is 734 bp, consistent with the expected size. The sequence obtained from sequencing is shown in SEQ ID NO.3: TCTGTCCCTGCCTGTGCCTGGCCAGTTTTTAGCTGGACGTGTACCACAGTGATGGGACACCCCTGACCTCGGATCAGATCTTCACGCAGCTGGAAGATCTGGAACTCGTCCCTGCAAACCAACAAAGAGCCTGTGGGCATTCTCACCTCCAACCATCGCAACTCCTGGGCCAAGGCCTACA GCACCCTCATCAAAGGTACCCCGGGAGGGGGTGGGCAGCCGTctgtctccctgaatccgctcatcccagcccgtgtcagccccattccccagaagaggaacctgtggctcagttgggttaagttagtttccccttattaagcagcaagtcgcagtgagtcgtcctctggctgaggagcccgtcc ccgcatcacgccccctgaatcctgtgccggtccggggcgtcggccccgtgtgggatccccgaccacctcacggactcccggtgtgaccctgggcttctgtccc[c / g]aagtggggccctgcctctcgggggctgtggggctgcggggccctggagagcgaggctctggaggcctccccaggccc ggccctCACCGTGCCACCACGTCGCCGCAGACAAGGTGAACCGGGAGTCGGTGCGCTCCATCCAGAAGAGCATCTTCACCGTGTGCCTGGACGCGCCCATGCCTCGGGTCTCGGAGGACAGGTACCGCCACCAAGTGGCCTGCCAGATGCTGCACGGGGGCGGCGGCAAGCTCAACAGCGGCAA. Among them, the SNP position is marked with square brackets "[ ]", with the non-variation first, and the two are separated by " / ".

[0052] 5. Sequencing and sequence analysis The target fragment obtained in step 4 above was recovered from the gel and subjected to Sanger sequencing. DNASTAR 7.1 software was used for sequencing. CRAT Comparative analysis of gene sequences revealed... CRAT A polymorphic site C>G exists at intron 5 of the gene. Specifically... CRAT The gene has an SNP site at position 269392339 on chromosome 1, and the base at this site is either G or C.

[0053] 6. Pigs CRAT Gene polymorphism analysis The analysis results are shown in Table 1.

[0054] Table 1 CRAT Gene polymorphism analysis and genetic indicators

[0055] From Table 1 and Figure 2 It is known that the genotypes at intron 5 (chr.1:269392339) of the Duroc breed pig population are CC, CG, and GG, respectively; the alleles are C and G, respectively. The Duroc breed pig population, namely the 217 Duroc pigs mentioned above, is also referred to as the Duroc pig population.

[0056] 7. CRAT Association analysis of genetic variation and growth traits The following data were recorded for 217 Duroc pigs: age at 115 kg body weight, average daily weight gain before 115 kg body weight, backfat thickness at 115 kg body weight, eye muscle thickness at 115 kg body weight, average daily feed intake, and average daily weight gain throughout the entire period. Association analysis was performed on the CC, CG, and GG genotypes and growth traits in the Duroc pig population. The results showed that... CRAT Therefore, the SNP locus was associated with the age at which body weight reaches 115 kg, the average daily weight gain before body weight reaches 115 kg, the average daily weight gain throughout the entire period, and the average daily feed intake, but not with any of the other recorded growth traits. As shown in Table 2, in this Duroc breed pig population, individuals with the GG genotype had significantly lower average daily weight gain before body weight reaches 115 kg, lower average daily feed intake, and lower average daily weight gain throughout the entire period compared to individuals with the CC and CG genotypes. Their age at body weight reaches 115 kg was also higher than that of individuals with the CC and CG genotypes, indicating that individuals carrying the GG allele had significantly lower daily weight gain than homozygous CC individuals.

[0057] Table 2 CRAT Results of significance test for differences in growth traits among gene genotypes

[0058] Note: "a / b" indicates pig CRAT There are significant differences in growth traits among the different genotypes of the gene.

[0059] Example 2: Application Verification Another 217 Duroc pigs were selected for further testing. CRATThe application validation experiment of the gene SNP locus recorded the age at which the child reached 115 kg body weight, the average daily weight gain before reaching 115 kg body weight, the backfat thickness at 115 kg body weight, the eye muscle thickness at 115 kg body weight, the average daily feed intake, and the average daily weight gain throughout the entire period. CRAT SNP genotyping results divided the experimental pigs into three genotype groups: CC, CG, and GG. Statistical analysis was performed using SPSS software. Data are expressed as mean ± standard deviation. Differences between genotypes were analyzed using one-way ANOVA and Duncan's multiple comparisons. Different letters indicate statistical significance. P <0.05).

[0060] Table 3 CRAT Comparison of growth traits of Duroc pigs with different SNP loci

[0061] Note: "a / b" indicates pig CRAT There are significant differences in growth traits among the different genotypes of the gene.

[0062] Application verification results show that CRAT Therefore, the SNP locus was significantly associated with the age at which body weight reaches 115 kg, the average daily weight gain before body weight reaches 115 kg, the average daily weight gain throughout the period, and the average daily feed intake, but not significantly associated with backfat thickness at body weight or eye muscle thickness at body weight reaches 115 kg.

[0063] As shown in Table 3, in this Duroc breed pig population, the average daily weight gain, average daily feed intake, and average daily weight gain before reaching 115 kg body weight were significantly lower in individuals with the GG genotype than in individuals with the CC and CG genotypes. P <0.05, the age at which they reached 115kg was significantly greater than that of individuals with the CC genotype and the CG genotype ( P <0.05 indicates that the daily growth rate of individuals carrying the GG allele was significantly lower than that of homozygous CC individuals. There were no significant differences in any growth trait index between CC and CG genotype individuals. P >0.05).

[0064] As can be seen from the above, this invention, by designing primer pairs targeting functionally conserved regions in the pig genome related to growth and development, can effectively amplify DNA fragments containing high genetic polymorphism. This molecular marker is located in a genomic region with a relatively balanced allele frequency distribution in the population, enabling the amplified product to exhibit rich genotypic variation in the detection population, thereby providing a high polymorphism information content. In other words, it has a strong ability to distinguish individual genetic differences within the population and exhibits high selection efficiency.

[0065] It should be noted that when numerical ranges are involved in this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, this invention describes preferred embodiments.

[0066] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments, all of which fall within the scope of the invention.

Claims

1. A molecular marker for predicting daily weight gain in pigs, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

3. The 474th position at the 5' end of the molecular marker is a polymorphic site with a base of C or G. Pigs with the genotype CC at this site have a higher daily weight gain than pigs with the genotype GG.

2. The primer pair for amplifying the molecular marker for predicting daily weight gain in pigs as described in claim 1, characterized in that, The primer pair consists of an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

2.

3. A reagent kit for predicting daily weight gain traits in pigs, characterized in that, The kit includes the primer pair as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes enzymes, fluorescent labels, buffer reagents, and dNTPs for nucleic acid amplification reactions.

5. The application of the primer pair for amplifying the molecular marker for predicting daily weight gain in pigs as described in claim 2, or the kit for predicting daily weight gain traits in pigs as described in any one of claims 3 to 4, in predicting daily weight gain traits in pigs.

6. The application according to claim 5, characterized in that, The steps for predicting daily weight gain traits in pigs are as follows: Genomic DNA was extracted from the pigs to be tested; Using the genomic DNA as a template, PCR amplification was performed using the primer pair; Based on the genotype at position 474 from the 5' end of the PCR amplification product, the daily weight gain trait of the pigs to be tested can be predicted.

7. The application according to claim 6, characterized in that, If the genotype at position 474 from the 5' end of the PCR amplification product is CC, then the pigs being tested exhibit a high daily weight gain trait; if the genotype at position 474 from the 5' end of the PCR amplification product is GG, then the pigs being tested exhibit a low daily weight gain trait.

8. The application according to claim 6, characterized in that, The pigs to be tested included Duroc breeds.

Images