Trans-splicing nucleic acid molecules and methods of use thereof
By designing trans-splicing nucleic acid molecules containing exons, introns, antisense, and 3' domains, the problems of low efficiency in repairing defective genetic sequences and RNA toxicity in human cells have been solved, achieving highly efficient gene therapy effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- TACIT THERAPEUTICS INC
- Filing Date
- 2024-10-17
- Publication Date
- 2026-06-12
AI Technical Summary
Existing technologies struggle to effectively repair defective genetic sequences in human cells, RNA trans-splicing is inefficient, and there is a risk of protein toxicity from trans-spliced RNA.
A trans-splicing nucleic acid molecule containing exons, introns, antisense, and a 3' domain was designed. By utilizing sequences or structures derived from ribozymes, the efficiency of trans-splicing is improved through nuclear retention, stabilization, and cleavage of the domain, while preventing protein expression.
It significantly improves trans-splicing efficiency, reduces the toxicity of proteins produced by trans-spliced RNA, and enables efficient repair of mutated sequences in target RNA for the treatment of human genetic diseases.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Cross-reference to related applications
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 567,850, filed March 20, 2024, entitled “NUCLEICACID MOLECULES TO PROMOTE TRANS-SPLICING,” and U.S. Provisional Patent Application No. 63 / 591,356, filed October 18, 2023, entitled “RNA STRUCTURAL MOTIFS TO PROMOTE TRANS-SPLICING,” each of which is incorporated herein by reference in its entirety for all purposes.
[0002] Submission of sequence list The contents of the electronic serial number (309222000840SEQLIST.xml; size: 182,576 bytes; and creation date: October 17, 2024) are incorporated herein by reference in their entirety. Technical Field
[0003] Effective treatment of human genetic diseases may require the efficient repair of defective genetic sequences in human cells. Examples of human gene therapy include RNA transsplicing. Background Technology
[0004] Effective treatment of human genetic diseases may require the efficient repair of defective genetic sequences in human cells. Examples of human gene therapy include RNA transsplicing. Summary of the Invention
[0005] In some aspects, this document provides a trans-splicing nucleic acid molecule comprising: (a) an exon domain (e.g., an exon domain encoding a therapeutic sequence); (b) an intron domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) an antisense domain configured to bind a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the ribozyme is selected from the group consisting of: VS ribozymes, twist sister ribozymes, lantern ribozymes, pistol ribozymes, hairpin ribozymes, leadzymes, axe ribozymes, GIR1 branched ribozymes, glmS ribozymes, class I introns, class II introns, RNase P, CoTC ribozymes, Hoylinc ribozymes, Varkud satellite ribozymes, CPEB3 ribozymes, and riboswitches. In some embodiments, the trans-splicing molecule further comprises a G-quadruplex and / or a pseudoknot, and optionally a poly(A). In some embodiments, the trans-splicing molecule comprises, from 5' to 3': a G-quadruplex and / or a pseudoknot, a sequence or structure derived from or isolated from a ribozyme, and optionally a poly(A) at the 3' end. In some embodiments, the trans-splicing molecule comprises, from 5' to 3': a sequence or structure derived from or isolated from a ribozyme, a G-quadruplex and / or a pseudoknot, and optionally a poly(A) at the 3' end. In any embodiment herein, the trans-splicing molecule may, but is not required to, comprise a hammerhead ribozyme, an HDV ribozyme, or a twister ribozyme.
[0006] In some respects, this article provides a trans-splicing nucleic acid molecule comprising: (a) an exon domain (e.g., an exon domain encoding a therapeutic sequence); (b) an intron domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) an antisense domain configured to bind a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme, wherein the trans-splicing nucleic acid molecule does not contain a 3' poly(A).
[0007] In some embodiments, the sequence or structure derived from or isolated from the ribozyme is located in the 3' domain of the trans-splicing nucleic acid molecule. In some embodiments, the sequence or structure derived from or isolated from the ribozyme is located in the 5' domain of the trans-splicing nucleic acid molecule.
[0008] In any embodiment of this document, the ribozyme may be selected from the group consisting of: hammerhead ribozyme, HDV ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, CPEB3 ribozyme, and riboswitch.
[0009] In any embodiment of this document, the trans-splicing nucleic acid molecule may comprise a sequence or structure derived from or isolated from a twisted sister ribozyme. In any embodiment of this document, the trans-splicing nucleic acid molecule comprises a sequence or structure derived from or isolated from a lantern ribozyme. In any embodiment of this document, the trans-splicing nucleic acid molecule may comprise a sequence or structure derived from or isolated from a CPEB3 ribozyme. In some embodiments, the CPEB3 ribozyme is a mammalian CPEB3 ribozyme. In some embodiments, the CPEB ribozyme is a human CPEB3 ribozyme or an African chimpanzee ribozyme. Pan troglodytes CPEB3 ribozyme. In any embodiment herein, the trans-splicing nucleic acid molecule may comprise a sequence or structure derived from or isolated from the VS ribozyme. In any embodiment herein, the trans-splicing nucleic acid molecule may comprise a sequence or structure derived from or isolated from the CPEB3 ribozyme.
[0010] In any embodiment of this document, the ribozyme may be a ribozyme derived from or isolated from a eukaryote. In some embodiments, the eukaryote is a mammal. In some embodiments, the mammal is a human or... African chimpanzees In any embodiment of this document, the ribozyme may be a ribozyme derived from or isolated from a virus. In any embodiment of this document, the ribozyme may be a ribozyme derived from or isolated from a prokaryote. In some embodiments, the prokaryote is a bacterium.
[0011] In any embodiment of this document, the ribozyme may be a mutant ribozyme. In any embodiment of this document, the ribozyme may be an engineered ribozyme. In any embodiment of this document, the ribozyme may be derived from or encoded by lncRNA. In any embodiment of this document, the ribozyme may be a self-cleaving ribozyme. In any embodiment of this document, the ribozyme may be a self-alkylated ribozyme.
[0012] In any embodiment of this document, the ribozyme may comprise one or more pseudoknots. In any embodiment of this document, the ribozyme may be regulated by or require one or more metal ion cofactors. In some embodiments, the one or more metal ion cofactors comprise divalent cations. In some embodiments, the one or more metal ion cofactors comprise Mg. 2+ .
[0013] In any embodiment of this document, the trans-splicing nucleic acid molecule may include a 3' domain comprising a cleavage domain, wherein the sequence or structure derived from or isolated from a ribozyme is a first ribozyme sequence or structure. In some embodiments, the cleavage domain comprises: a second ribozyme sequence or structure that is the same as or different from the first ribozyme sequence or structure; a microprocessor substrate; an RNase P / Z substrate; or any combination thereof. In some embodiments, the cleavage domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the cleavage domain does not comprise a sequence or structure derived from or isolated from a ribozyme.
[0014] In any embodiment of this document, the trans-splicing nucleic acid molecule may include a 3' domain comprising a stabilizing domain. In some embodiments, the stabilizing domain comprises a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the stabilizing domain does not comprise a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the stabilizing domain comprises a G-quadruplex and / or a pseudoknot. In some embodiments, the stabilizing domain comprises a G-quadruplex. In some embodiments, the stabilizing domain comprises a pseudoknot.
[0015] In any embodiment of this document, the trans-splicing nucleic acid molecule may include a 3' domain containing a nuclear-reserved domain. Optionally, in some embodiments, the nuclear-reserved domain comprises a triple helix, a pseudoknot, a riboswitch, a G-quadruplex, RNase pRNA, a stem-loop structure, snoRNA, or any combination thereof. In some embodiments, the triple helix is a viral helix. In some embodiments, the triple helix is a human triple helix. In some embodiments, the G-quadruplex is a telomerase G-quadruplex. In some embodiments, the nuclear-reserved domain contains a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the nuclear-reserved domain does not contain a sequence or structure derived from or isolated from a ribozyme.
[0016] In any embodiment of this document, the trans-spliced nucleic acid molecule may include a 3' domain, which from 5' to 3' comprises: a G-quadruplex and / or a pseudoknot, and a sequence or structure derived from or isolated from a ribozyme.
[0017] In any embodiment of this document, a sequence or structure derived from or isolated from a ribozyme can increase the trans-splicing efficiency of the trans-splicing nucleic acid molecule. In some embodiments, the trans-splicing efficiency is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or 1000% compared to a reference trans-splicing nucleic acid molecule that does not have a sequence or structure derived from or isolated from a ribozyme.
[0018] In any embodiment of this document, the trans-spliced nucleic acid molecule may further include a G-quadruplex and / or a pseudoknot that enhances the trans-splicing efficiency of the trans-spliced nucleic acid molecule. In some embodiments, the trans-splicing efficiency is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or 1000% compared to a reference trans-spliced nucleic acid molecule that does not have a sequence or structure derived from or isolated from a ribozyme and a G-quadruplex and / or a pseudoknot.
[0019] In any embodiment of this document, the target RNA molecule may be present in a cell. In any embodiment of this document, the target RNA molecule may be messenger RNA (mRNA) or precursor mRNA. In any embodiment of this document, the target RNA molecule may contain a mutation. In some embodiments, the mutation is selected from the group consisting of: missense mutations, nonsense mutations, frameshift mutations, insertions, duplications, inversions, deletions, splice site mutations, and truncation mutations. In some embodiments, the mutation is a disease-causing mutation.
[0020] In any of the embodiments described herein, the trans-spliced nucleic acid molecule may be packaged in a viral vector for delivery to a subject in need. In some embodiments, the viral vector is a herpes simplex virus (HSV) vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector.
[0021] In some aspects, this document presents a composition comprising any of the aforementioned viral vectors and a pharmaceutically acceptable carrier or excipient. In any embodiment described herein, the trans-spliced nucleic acid molecule may be packaged in lipid nanoparticles for delivery to a subject in need.
[0022] In some embodiments, this document presents a composition comprising the aforementioned lipid nanoparticles and a pharmaceutically acceptable carrier or excipient. In any embodiment herein, the engineered nucleic acid may be packaged in vesicles for delivery to a subject in need. In some embodiments, this document presents a composition comprising the aforementioned vesicles and a pharmaceutically acceptable carrier or excipient.
[0023] Incorporate by reference All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference, as each individual publication, patent, or patent application is specifically and individually indicated to the extent of its incorporation herein. To the extent that any publication, patent, or patent application incorporated herein by reference contradicts the disclosure contained herein, this specification is intended to supersede and / or give precedence to any such contradictory material. Attached Figure Description
[0024] The novel features of the invention are set forth in the appended claims. The features and advantages of the invention can be better understood by referring to the following detailed description in conjunction with the accompanying drawings (also referred to herein as “Figures (FIG.)” and “Figures (FIG.)”), which illustrate illustrative embodiments utilizing the principles of the invention, in which: Figure 1 A- Figure 1 C illustrates the problem of human genetic diseases and provides a schematic diagram of gene repair using trans-splicing nucleic acid molecules containing a 3' domain. Figure 1 A illustrates the concept of human genetic diseases, in which mutated (“defective”) DNA sequences are transcribed into RNA that directly causes the disease or translated into proteins that cause the disease. Figure 1 B illustrates an exemplary gene repair method utilizing trans-splicing as described herein. In this example, a mutated gene is repaired via trans-splicing RNA containing a 3' domain. Figure 1 C illustrates the subdomains present in the 3' domain. Specifically, the 3' domain contains a kernel-preserving domain, a stabilizing domain, and a cleavage domain.
[0025] Figure 2 A- Figure 2 C illustrates the challenges associated with the reverse splicing technique and solutions described in this article. Figure 2 A describes the mechanism by which truncated proteins are produced via trans-splicing therapeutic agents. Specifically, truncated mRNA generated from trans-splicing RNA can cause toxicity in human cells. Figure 2 B- Figure 2 C describes two exemplary mechanisms that can eliminate truncated proteins by using the 3' domain in trans-splicing RNA. Figure 2B describes the activity of the cleavage domain, which leads to the elimination of the polyadenylated tail present on trans-spliced RNA, thereby preventing the translation of trans-spliced RNA in the absence of trans-splicing. Figure 2 C describes the activity of the 3' domain, which promotes nuclear retention of trans-spliced RNA, thereby improving trans-splicing efficiency.
[0026] Figure 3 Empirical data describing the relative ability of different 3' domains to enhance the editing efficiency of the target RNA (CEP290) are presented.
[0027] Figure 4 A- Figure 4 C illustrates a schematic diagram of gene repair using trans-splicing nucleic acid molecules (e.g., trans-splicing RNA) containing a 3' domain. Figure 4 A illustrates the concept of human genetic diseases, in which mutated (“defective”) DNA sequences are transcribed into RNA that directly causes the disease or translated into proteins that cause the disease. Figure 4 B illustrates an exemplary gene repair method utilizing trans-splicing as described herein. In this example, a mutated gene is repaired via trans-splicing RNA containing a 3' domain. Figure 4 C illustrates the 3' domain of a trans-splicing nucleic acid molecule. The 3' domain may contain a sequence or structure derived from or isolated from a ribozyme, and optionally a G-quadruplex and / or a pseudoknot.
[0028] Figure 5 The relative repair efficiencies of various 3' domains are shown.
[0029] Figures 6A-6B The reverse splicing efficiency of the reverse splicing system targeting CEP290 is shown. Figure 6A The distribution of trans-splicing efficiency in trans-splicing systems containing certain ribozymes is shown. Figure 6B This demonstrates the trans-splicing efficiency of specific trans-splicing nucleic acid molecules.
[0030] Figure 7 The relative editing efficiency of the reverse splicing system targeting introns 8, 11, or 17 of SCN1A is shown. Detailed Implementation
[0031] Unless otherwise defined, all technical terms, symbols, and other technical and scientific terms used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some instances, terms with their commonly understood meanings are defined herein for clarity and / or ease of reference, and the inclusion of such definitions herein should not be construed as representing a material difference from the commonly understood meaning in the art.
[0032] As used herein, the term “about” refers to a common range of error for an individual value that is readily known to a person skilled in the art. References to “about” a value or parameter herein include (and describe) implementations for that value or parameter itself.
[0033] As used herein, unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” include plural indicators. For example, “a” or “an” means “at least one” or “one or more”.
[0034] Throughout this disclosure, all aspects of the claimed subject matter are presented in a scope format. It should be understood that the scope format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Where a scope describes a value, it should be understood that the description includes all possible sub-scopes within that scope, as well as specific values falling within that scope, regardless of whether specific values or sub-scopes are explicitly stated. For example, where a range of values is provided, it should be understood that all intermediate values between the upper and lower limits of that range, as well as any other specified values or intermediate values within that range, are covered by the claimed subject matter. The upper and lower limits of these smaller ranges may be independently included within that smaller range and are also covered by the claimed subject matter, subject to any specifically excluded limits within the specified range. Where the specified range includes one or both limits, the range excluding one or both of those included limits is also included in the claimed subject matter. This rule applies regardless of the breadth of the scope.
[0035] When the term “each” is used to refer to a collection of items, it is intended to identify a single item in the collection, but not necessarily every item in the collection, unless otherwise explicitly stated or unless the context in which it is used indicates otherwise.
[0036] The use of sequential terms (such as "first," "second," "third," etc.) to modify claim elements in claims does not imply any priority, precedence, or order of one claim element over another, or the sequence of actions of the method, but is merely a marker to distinguish one claim element with a certain name from (if no sequential terms were used, then) another element with the same name. Similarly, the use of a), b), etc., or i), ii), etc., does not imply any priority, precedence, or order of steps in the claims. Likewise, the use of these terms in the specification does not imply any desired priority, precedence, or order.
[0037] The section headings used in this article are for organizational purposes only and should not be construed as limiting the topics described.
[0038] Overview This disclosure provides a nucleic acid molecule (e.g., an RNA molecule) that selectively binds to and promotes trans-splicing with a target RNA molecule and carries a 3' domain that promotes trans-splicing. This disclosure provides vectors, compositions, and cells that comprise or encode trans-spliced RNA molecules. This disclosure provides methods for treating diseases or conditions using the trans-spliced nucleic acid molecules, vectors, compositions, and cells of this disclosure.
[0039] In one aspect, the present invention relates to a trans-splicing nucleic acid molecule (e.g., a trans-splicing RNA molecule), wherein the trans-splicing nucleic acid molecule comprises a sequence or structure derived from or isolated from a ribozyme and different types of domains. One type of domain is an exon domain inserted into a target RNA molecule via a trans-splicing reaction. A second type of domain is an antisense domain complementary to the target RNA. A third type of domain is an intron domain that facilitates the trans-splicing reaction between the trans-splicing RNA molecule and the target RNA. A fourth domain is a 3' domain carrying a sequence that increases the efficiency of trans-splicing.
[0040] In one aspect, this article provides a trans-splicing nucleic acid molecule comprising: (a) an exon domain (e.g., an exon domain encoding a therapeutic sequence); (b) an intron domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) an antisense domain configured to bind a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme, wherein the ribozyme is selected from the group consisting of: VS ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, mammalian CPEB3 ribozyme, and riboswitches.
[0041] In one aspect, this paper provides a trans-splicing nucleic acid molecule comprising: (a) an exon domain (e.g., an exon domain encoding a therapeutic sequence); (b) an intron domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) an antisense domain configured to bind a target RNA molecule; (d) a sequence or structure derived from or isolated from a ribozyme; and (e) a 3' domain, wherein the 3' domain does not contain poly(A). In some embodiments, the 3' domain contains a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain does not contain a sequence or structure derived from or isolated from a ribozyme. This novel domain enhances trans-splicing efficiency by promoting RNA processing phenomena that favor efficient trans-splicing. The 3' domain comprises up to three subdomains: a nuclear-retention domain, a stabilization domain, and a cleavage domain. Without being bound by any theory, the nuclear-retention domain facilitates the localization of trans-splicing RNA to the nucleus, which serves as the active site for trans-splicing. The stabilizing domain reduces the turnover of trans-spliced RNA. Furthermore, the cleavage domain removes the tail of the RNA, reducing interference with nuclear output and associated RNA processing activity during trans-splicing. This novel combination of typical trans-splicing domains (exons, introns, and antisense domains) with a 3' domain facilitates RNA trans-splicing in a manner sufficient to replace disease-causing RNA sequences in human cells for disease treatment. Indeed, inefficiency has been a major obstacle for many nucleic acid editing methods, including RNA trans-splicing. This disclosure provides compositions and methods for specifically targeting disease-causing RNA molecules and efficiently replacing disease-causing RNA sequences within these RNA molecules. Trans-spliced RNA molecule implementations have shown utility in a variety of contexts, including replacing disease-causing sequences or inserting engineered sequences into target RNA. Engineered sequences can alter the translation or stability of target RNA to increase or decrease protein production or target RNA levels. This disclosure provides vectors, compositions, and cells containing or encoding trans-spliced nucleic acid molecules (e.g., trans-spliced RNA molecules), as well as methods for using compositions of trans-spliced nucleic acid molecules (e.g., trans-spliced RNA molecules).
[0042] In one aspect, the present invention is an RNA technology capable of replacing arbitrary sequences within specific RNA molecules in living cells. This technology is based on RNA trans-splicing, utilizing spliceosomes naturally present in human cells to provide catalytic activity for this trans-splicing process. Typically, RNA splicing occurs within RNA molecules, where exons are tandemly linked and introns are removed from immature messenger RNA molecules (precursor mRNA) to form mature messenger RNA molecules (mRNA). This process is called cis-splicing and requires a group of enzymes and non-coding RNAs collectively referred to as spliceosomes. RNA trans-splicing is the process by which spliceosomes connect exons derived from different and separate RNA molecules. This process rarely occurs in human cells, and existing technological systems promoting RNA trans-splicing are active at low levels. The present invention includes compositions that improve the efficiency of RNA trans-splicing. These improved RNA trans-splicing compositions can be used to replace mutated sequences within target RNA molecules to address human diseases. The substitution of arbitrary RNA sequences is a general capability with numerous specific applications, some of which have been explored as relevant evidence. RNA transsplicing allows the insertion of engineered sequences into target RNA to confer new activities, such as altered RNA stability or changes in RNA translation. This feature can be used to increase protein production from the target RNA. In the broadest sense, this RNA transsplicing technique can confer arbitrary changes to both coding and non-coding regions of the target RNA.
[0043] References describe the use of sequences derived from mRNA, long non-coding RNA, and synthetic sequences to alter the localization of different transcription types within the nucleus (Espinoza et al., 2007; Guo et al., 2020; Long et al., 2017; Lubelsky and Ulitsky, 2018; Miyagawa et al., 2012; Shukla et al., 2018; Wilusz et al., 2012). Indeed, it is known that various RNA sequences placed in a heterologous background can promote RNA accumulation in the nucleus. Typically, these sequences are derived from long non-coding RNAs (such as MALAT1) and have had their polyadenylated tails removed, and contain tertiary structures that stabilize the RNA and / or localization sequences that promote nuclear preservation (Wilusz et al., 2012). However, little is known about whether heterologous sequences derived from other sources can be combined to generate superior nuclear localization phenomena. Since the activity of many known RNA sequences is background-dependent, the inventors envision a different set of 3' domain sequences that will function in the context of trans-splicing. Experiments have confirmed this, showing that the activity of the 3' domain in other contexts does not necessarily predict the activity in trans-splicing.
[0044] An important safety aspect associated with the trans-splicing system is the ability to prevent the production of proteins from trans-spliced RNA before a trans-splicing reaction occurs. In some embodiments, the 3' domain is configured to prevent the production of proteins from the trans-splicing molecule in the absence of a trans-splicing reaction. In some embodiments, the presence of the 3' domain comprises three subdomains: a stabilizing domain, a nuclear retention domain, and a cleavage domain. In some embodiments, the activity of the 3' domain is configured to eliminate the expression of a protein product encoded by the trans-spliced RNA molecule or a portion thereof. In some embodiments, the activity of the 3' domain is configured to eliminate the expression of a protein product encoded by the trans-spliced RNA molecule or a portion thereof in the absence of association of two or more exon domains. In some embodiments, the activity of the 3' domain is configured to eliminate the expression of a protein product encoded by the trans-spliced RNA molecule or a portion thereof in the absence of a trans-splicing reaction between the trans-spliced RNA molecule and the target RNA. In some implementations, the 3' domain is configured to eliminate the exon domain of the trans-spliced RNA molecule in the absence of a trans-splicing reaction between the trans-spliced RNA molecule and the target RNA.
[0045] In some embodiments, the stabilizing domain forms a tertiary RNA structure. In some embodiments, the stabilizing domain is isolated from or derived from sequences selected from the group consisting of: RNA pseudoknots, RNA triplets, riboswitch, aptamers. In some embodiments, the cleavage domain facilitates the cleavage of the RNA molecule. In some embodiments, the stabilizing domain contains sequences or structures derived from or isolated from ribozymes. In some embodiments, the ribozyme is selected from the group consisting of: hammerhead ribozyme, HDV ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, mammalian CPEB3 ribozyme, and riboswitch.
[0046] In some embodiments, the cleavage domain comprises a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the ribozyme is selected from the group consisting of: hammerhead ribozyme, HDV ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, mammalian CPEB3 ribozyme, and riboswitches.
[0047] In some embodiments, the nuclear-reserving domain facilitates the localization of trans-spliced RNA to the cell nucleus. In some embodiments, the nuclear-reserving domain is isolated from or derived from viral ENE (expression and nuclear-reserving element) sequences, human ENE sequences, NEAT1 ENE sequences, XIST, BORG, TUG1, MEG3, GAS5, human lncRNA, and mouse lncRNA. In some embodiments, the nuclear-reserving domain contains sequences or structures derived from or isolated from ribozymes. In some embodiments, the ribozyme is selected from the group consisting of: hammerhead ribozymes, HDV ribozymes, torsion ribozymes, torsion sister ribozymes, lantern ribozymes, pistol ribozymes, hairpin ribozymes, VS ribozymes, lead ribozymes, axe ribozymes, GIR1 branched ribozymes, glmS ribozymes, class I introns, class II introns, RNase P, CoTC ribozymes, Holick ribozymes, Walkud satellite ribozymes, mammalian CPEB3 ribozymes, and riboswitches.
[0048] Trans-splicing nucleic acid molecules may comprise RNA, DNA, DNA / RNA hybrids, nucleic acid analogs, chemically modified nucleic acids, chimeras composed of two or more nucleic acids or nucleic acid analogs, or any combination thereof. Trans-splicing nucleic acid molecules containing DNA can be transcribed from DNA to RNA. Trans-splicing nucleic acid molecules containing DNA can be transcribed from DNA to RNA upon administration to a subject. Trans-splicing nucleic acid molecules (e.g., trans-splicing RNA molecules) can associate with target RNA via trans-splicing. The target RNA sequence or a portion thereof may have mutated or deleted sequences. Binding to and / or replacing the target RNA sequence or a portion thereof with one or more exon domains can treat or restore the function of the target RNA sequence or a portion thereof.
[0049] The nucleic acid molecules disclosed herein can be provided in cells. The nucleic acid molecules provided herein can be administered to cells. The nucleic acid molecules provided herein can be delivered to cells. Cells may contain human cells. For example, DNA or RNA molecules can be provided in or delivered to human cells. Target RNA can be in cells. For example, target RNA can be in human cells. Target RNA can be messenger RNA (mRNA) or precursor mRNA. The nucleic acid molecules provided herein can be used for trans-splicing and may be referred to as trans-splicing nucleic acid molecules.
[0050] Including localization sequences in trans-splicing nucleic acid molecules to form the RNA trans-splicing technique of this invention further allows for the general ability to alter non-coding sequences within target RNA. By efficiently replacing the 5' or 3' untranslated regions of the target RNA, this invention allows for alterations in RNA behavior, such as translation or turnover. The net result of these effects is increased protein production from the target RNA or other downstream effects associated with altered RNA levels.
[0051] Nucleic acid molecules may contain or encode nucleic acid sequences that promote trans-splicing. For example, trans-splicing nucleic acid molecules may contain one or more intron domains. These one or more intron domains may carry binding sites preferentially targeted by RNA-binding proteins with disease-causing mutations. In some embodiments, disease-causing mutations may be insertions, duplications, inversions, deletions, splice site mutations, missense mutations, nonsense mutations, frameshift mutations, or truncated mutations. In some embodiments, the intron domain contains one or more trans-splicing enhancing sequences. In some embodiments, the trans-splicing enhancing sequences are configured to bind engineered U1 snRNA (ESM). In some embodiments, the ESM comprises engineered small nuclear RNA (esnRNA). The antisense domain is configured to bind to target mRNA or precursor mRNA. Trans-splicing nucleic acid molecules may contain one or more domains that bind RNA-binding proteins. The nucleic acid sequences provided herein may contain or encode one or more engineered U1 snRNAs (ESMs). ESMs may contain one or more engineered non-coding RNA molecules that can enhance trans-splicing. Engineered noncoding RNA molecules may contain engineered snRNA (e.g., esnRNA) that can recruit RNPs of the spliceosome. Trans-splicing nucleic acid molecules may contain one or more trans-splicing enhancers.
[0052] In some embodiments, the nucleic acid sequence of this disclosure is provided by one nucleic acid molecule. In some embodiments, the nucleic acid sequence is provided by two or more nucleic acid molecules. In some embodiments, two or more nucleic acid molecules are provided to cells in one vector. In some embodiments, two or more nucleic acid molecules are provided to cells in two or more vectors. In some embodiments, the vector is a recombinant virus.
[0053] Composition In one aspect, this article provides compositions comprising engineered nucleic acid molecules (e.g., trans-splicing nucleic acid molecules) for RNA trans-splicing.
[0054] In one aspect, this article provides a trans-splicing nucleic acid molecule comprising: (a) an exon domain (e.g., an exon domain encoding a therapeutic sequence); (b) an intron domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) an antisense domain configured to bind a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme, wherein the ribozyme is selected from the group consisting of: VS ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, mammalian CPEB3 ribozyme, and riboswitch.
[0055] In one aspect, this document provides a trans-splicing nucleic acid molecule comprising: (a) an exon domain (e.g., an exon domain encoding a therapeutic sequence); (b) an intron domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) an antisense domain configured to bind a target RNA molecule; (d) a sequence or structure derived from or isolated from a ribozyme; and (e) a 3' domain, wherein the 3' domain does not contain poly(A). In some embodiments, the 3' domain contains a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain does not contain a sequence or structure derived from or isolated from a ribozyme.
[0056] In some embodiments, the trans-splicing nucleic acid molecule comprises a trans-splicing RNA molecule. In some embodiments, the engineered nucleic acid molecule comprises two or more nucleic acid sequences, each encoding a portion of a trans-splicing nucleic acid molecule (e.g., a trans-splicing RNA molecule). The nucleic acid sequences may encode or comprise antisense domains, 3' domains, exon domains, intron domains, antisense domains, splicing enhancers, domains binding to RNA-binding proteins, or any combination thereof. In some embodiments, the composition further comprises engineered U1 snRNA (ESM) that binds to the trans-splicing RNA molecule and facilitates trans-splicing.
[0057] In some implementations, the trans-splicing molecule promotes trans-splicing in the absence of CRISPR / Cas. In other implementations, the trans-splicing molecule promotes trans-splicing in the presence of CRISPR / Cas.
[0058] Antonym domain This disclosure provides nucleic acid molecules comprising a nucleic acid sequence encoding or containing one or more antisense domains. The nucleic acid may comprise RNA, DNA, a DNA / RNA hybrid, and / or at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. The nucleic acid may comprise RNA. A nucleic acid containing RNA may encode one or more antisense domains. A nucleic acid containing RNA may be a trans-spliced RNA molecule. The nucleic acid may comprise DNA. A nucleic acid containing DNA may encode one or more antisense domains. One or more antisense domains of a nucleic acid containing DNA can be transcribed into a trans-spliced RNA molecule containing one or more antisense domains. The antisense domains may facilitate the association of two or more exon domains.
[0059] One or more antisense domains can be provided on a nucleic acid molecule. An antisense domain can bind to another antisense domain. In some embodiments, the antisense domain binds to another antisense domain via a covalent bond. In some embodiments, the antisense domain binds to another antisense domain via a non-covalent bond. In some embodiments, the antisense domain comprises one or more nucleic acid sequences complementary to another antisense domain. The antisense domain can bind to a target RNA. In some embodiments, the antisense domain binds to the target RNA via a covalent bond. In some embodiments, the antisense domain binds to another target RNA via a non-covalent bond. In some embodiments, the antisense domain comprises one or more nucleic acid sequences complementary to the target RNA.
[0060] In some embodiments of the compositions disclosed herein, the target RNA molecule is a pathogenic RNA molecule. In some embodiments, the target RNA comprises a target sequence complementary to the antisense domain of the trans-splicing RNA of this disclosure.
[0061] In some embodiments of the compositions and methods disclosed herein, the target sequence comprises or consists of 5 to 500 nucleotides. In some embodiments, the target sequence comprises or consists of 50 to 250 nucleotides.
[0062] In some embodiments of the compositions and methods disclosed herein, the target sequence is contained within a single contiguous segment of the target RNA. In some embodiments, the target sequence may consist of one or more nucleotides that are not dispersed within a single contiguous segment of the target RNA.
[0063] In some embodiments of this disclosure, the antisense domain of this disclosure binds to a target sequence. In some embodiments of this disclosure, the antisense domain of this disclosure binds to a target RNA.
[0064] In some embodiments of this disclosure, an antisense domain is selected such that successful trans-splicing results in the removal of microopen reading frames from the target RNA. In this way, the trans-splicing system removes microopen reading frames and increases the production of proteins from the target RNA.
[0065] In some embodiments of the compositions disclosed herein, the sequence comprising the antisense domain has complementarity with the target RNA sequence of at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 87%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any percentage therebetween. In some embodiments, the antisense domain has 100% complementarity with the target RNA sequence. In some implementations, the antisense domain comprises or consists of approximately 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, or more nucleotides complementary to the target RNA sequence.
[0066] In some implementations, the antisense domain is inversely complementary to RNA transcribed from genes selected from the group consisting of: TNFRSF13B [ENSG00000240505] (common variant immunodeficiency); ADA, CECR1 [ENSG00000196839, ENSG00000093072] (adenosine deaminase deficiency); IL2RG [ENSG00000147168] (X-linked severe combined immunodeficiency); HBB [ENSG00000244734] (β-thalassemia); HBA1, HBA2 [ENSG00000206172, ENSG00000188536] (α-thalassemia); U2AF1 [ENSG00000160201] (myelodysplastic syndrome); SOD1, TARDBP, FUS, MATR3, SOD1, C9ORF72 [ENSG00000142168, ENSG00000120948, ENSG00000089280, ENSG00000015479, ENSG00000142168, ENSG00000147894] (Amyotrophic Lateral Sclerosis); MAPT, PGRN [ENSG00000186868, ENSG00000030582] (Frontotemporal Dementia with Parkinson's Syndrome); CDH23, MYO7A, USH2A [ENSG00000107736, ENSG00000137474, ENSG00000042781] (Usher's Syndrome); GALC [ENSG00000054983] (Krabbe's Disease) Niemann Pick disease; SMPD1, NPC1, NPC2 [ENSG00000166311, ENSG00000141458, ENSG00000119655] (Niemann Pick disease); PRNP [ENSG00000171867] (prion disease); SCN1A [ENSG00000144285] (Dravet syndrome); PINK1, ATPGAP2 [ENSG00000158828] (early-onset Parkinson's disease);ATXN1, ATXN2, ATXN3, PLEKHG4, SPTBN2, CACNA1A, ATXN7, TTBK2, PPP2R2B, KCNC3, PRKCG, ITPR1, TBP, KCND1, FGF14 [ENSG00000124788, ENSG00000204842, ENSG00000066427, ENSG00000196155, ENSG0000 0173898, ENSG00000141837, ENSG00000163635, ENSG00000128881, ENSG00000156475, ENSG00000131398, ENSG00000126583, ENSG00000150995, ENSG00000112592, ENSG00000102057, ENSG00000102466] (Spinocerebellar ataxia); SCN1A, SCN2A, CACNA1A, GRIN2B, GRIN2A, MECP2, FOXG1, SLC6A1, PRRT2, PTEN, KCNQ2, KCNQ3, STARD7, CLRN1 [ENSG00000144285, ENSG00000136531, ENSG00000141837, ENSG00000273079, ENSG00000183454, ENSG00000169057, ENSG00000176165, ENSG00000157103, ENSG00000167371, ENSG00000171862, ENSG00000075043, ENSG00000184156, ENSG00000084090, ENSG00000163646](hereditary epilepsy); ATM [ENSG00000149311](ataxia-telangiectasia); GLB1 [ENSG00000170266] (GM1 ganglioside storage disorder); GBA [ENSG00000177628] (Gaucher disease); GM2A [ENSG00000196743] (GM2 ganglioside storage disorder); UBE3A [ENSG00000114062] (Angelman syndrome); SLC2A1 [ENSG00000117394] (Type 1 glucose transporter deficiency); LAMP2 [ENSG00000005893] (Danon disease);GLA [ENSG00000102393] (Fabry disease); PKD1, PKD2 [ENSG00000008710, ENSG00000118762] (autosomal dominant polycystic kidney disease); GAA [ENSG00000171298] (Pompe disease); PCSK9, LDLR, APOB, APOE [ENSG00000169174, ENSG00000130164, ENSG00000084674, ENSG00000130203] (familial hypercholesterolemia); MYOC, OPTN, TBK1, WDR36, CYPIB1 [ENSG00000034971, ENSG00000123240, ENSG00000183735, ENSG00000134987, ENSG00000138061] (Open-angle glaucoma); IDUA [ENSG00000127415] (Hurler syndrome or mucopolysaccharidosis 1); IDS [ENSG00000010404] (Hunter syndrome or mucopolysaccharidosis 2); CLN3 [ENSG00000188603] (Batten disease); DMD [ENSG00000198947] (Duchenne muscular dystrophy); LMNA [ENSG00000160789](Type 1B limb-girdle muscular dystrophy); DYSF [ENSG00000135636](Type 2B limb-girdle muscular dystrophy); SGCA [ENSG00000108823](Type 2D limb-girdle muscular dystrophy); SGCB [ENSG00000163069](Type 2E limb-girdle muscular dystrophy); SGCG [ENSG00000102683](Type 2C limb-girdle muscular dystrophy); SGCD [ENSG00000170624](Type 2F limb-girdle muscular dystrophy); DUX4 [ENSG00000260596](facioscapulohumeral muscular dystrophy); F9 [ENSG00000101981](hemophilia B); F8 [ENSG00000185010](Hemophilia A);USH2A, RPGR, RP2, RHO, PRPF31, USH1F, PRPF3, PRPF6 [ENSG00000156313, ENSG00000102218, ENSG00000163914, ENSG00000105618, ENSG00000150275, ENSG00000117360, ENSG00000101161] (Retinitis pigmentosa); CFTR [ENSG00000001626] (cystic fibrosis); GJB2, GJB6, STRC, DFNA1, WFS1 [ENSG00000165474, ENSG00000121742, ENSG00000242866, ENSG00000131504, ENSG00000109501] (autosomal dominant hearing loss); POU3F3 [ENSG00000198914] (non-syndromic hearing loss).
[0067] In some embodiments, the antisense domain may be adjacent to the 5' end of the trans-splicing molecule. In some embodiments, the antisense domain is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 31, 32, 33, 34, 35, 36, or 37 nucleotides from the 5' end of the trans-splicing molecule. Nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, or at least 500 nucleotides or more.
[0068] In some embodiments, the antisense domain may be adjacent to the 3' end of the trans-splicing molecule. In some embodiments, the antisense domain is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 31, 32, 33, 34, 35, 36, or 37 nucleotides from the 3' end of the trans-splicing molecule. Nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, or at least 500 nucleotides or more.
[0069] In some implementations, the antisense domain may be at least 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 3 6 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, or at least 500 nucleotides or more.
[0070] In some implementations, the antisense domain may be at least 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 3 6 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, or at least 500 nucleotides or more.
[0071] In some embodiments, the trans-splicing molecule may include an antisense domain. In some embodiments, the trans-splicing molecule may include two or more antisense domains. In some embodiments, the trans-splicing molecule includes 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 75, 100, 200, 300 or more antisense domains.
[0072] 3' structural domain In some embodiments, the trans-spliced nucleic acid molecules of this disclosure encode or contain one or more 3' domains. The nucleic acid may comprise RNA, DNA, a DNA / RNA hybrid, and / or at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. The nucleic acid may comprise RNA. Nucleic acids containing RNA may contain one or more 3' domains. Nucleic acids containing RNA may be trans-spliced RNA molecules. Nucleic acids may comprise DNA. Nucleic acids containing DNA may encode one or more 3' domains. Nucleic acids containing DNA encoding one or more 3' domains may be transcribed into RNA, such as trans-spliced RNA molecules.
[0073] The 3' domain is configured to facilitate the processing of trans-spliced RNA in a manner that increases the safety and efficiency of the trans-splicing therapeutic system. The 3' domain can prevent the generation of translated protein products from the trans-spliced RNA. If the trans-spliced RNA fails to react successfully with the target RNA, the 3' domain may prevent the translation of the trans-spliced RNA and avoid the generation of truncated protein products encoded by the exon domain. The 3' domain can also promote nuclear retention of the trans-spliced RNA in a manner that increases the efficiency of the trans-splicing reaction. Thus, the 3' domain can reduce the frequency of adverse events resulting from exposure to the nucleic acid sequences provided herein. In some embodiments, the 3' domain can reduce the frequency of systemic toxicity.
[0074] In some implementations, the 3' domain comprises three subdomains: a stabilization domain, a kernel-preserving domain, and a cleavage domain.
[0075] In some embodiments, the cleavage domain is configured to remove the polyadenylated tail of mRNA. In some embodiments, the 3' domain is configured to eliminate the trans-spliced RNA molecule via nonsense-mediated or non-discontinuous RNA decay (NMD or NSD). In some embodiments, the cleavage domain comprises or encodes one or more substrates of a cellular nuclease. In some embodiments, the 3' domain comprises or encodes one or more ribozymes (e.g., ribonucleases). In some embodiments, the ribozyme encoded by the trans-spliced RNA provided herein cleaves the trans-spliced RNA molecule or a portion thereof. In some embodiments, the cleavage domain comprises or encodes a nucleolytic ribozyme, such as RNase P. In some embodiments, the nucleolytic ribozyme includes hairpin ribozymes, VS ribozymes, torsion ribozymes, HDV ribozymes, TS ribozymes, hammerhead ribozymes, pistol ribozymes, or... glmS Ribozymes. In some embodiments, the cleavage domain is isolated from or derived from the sequence of a substrate used for small non-coding RNA processing (such as an integration complex, microprocessor complex, or other small non-coding RNA processing enzyme).
[0076] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAgtttgaaaaatgtgaaggactttcgtaacggaagtaattcaagatcaagagtaattaccaacttaatgtttttgcattggactttgagttaagattattttttaaatcctgaggactagcattaattgacagctgacccaggtgctacacagaagtggattcagtgaatctaggaagacagcagcagacaggattccaggaaccagtgtttgatgaagctaggactgaggagcaagcgagcaagcagcagttcgtggtgaagataggaaaagagtccaggagccagtgcgatttggtgaaggaagctaggaagaaggaaggagcgctaacgatttggtggtgaagctaggaaaaaggattccaggaaggagcgagtgcaatCCCAAtttttcttttGAATTCTCTAGAGAATTCttttgctttttCTTCaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO:103).
[0077] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAatttttaggtaaaatgctttttgttcatttctggtggtgggaggggactgaagcctttagtcttttccagatgcaaccttaaaatcagtgacaagaaacattccaaacaagcaacagtcttcaagaaattaaactggcaagtggaaatgtttaaacagttcagtgatctttagtgcattgtttatgtgtgggtttctctctcccctcccttggtcttaattcttacatgcaggaacactcagcagacacacgtatgcgaagggccagagaagccagacccagtaagaaaaaatagcctatttactttaaataaaccaaacattccattttaaatgtggggattgggaaccactagttctttcagatggtattcttcagactatagaaggaggattcgtcagtagggttgtaaaggtttttcttttcctgagaaaacaaccttttgttttctcaggttttgctttttggcctttccctagctttaaaaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO:104).
[0078] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAatttttaggtaaaatgctttttgttcatttctggtggtgggaggggactgaagcctttagtcttttccagatgcaaccttaaaatcagtgacaagaaacattccaaacaagcaacagtcttcaagaaattaaactggcaagtggaaatgtttaaacagttcagtgatctttagtgcattgtttatgtgtgggtttctctctcccctcccttggtcttaattcttacatgcaggaacactcagcagacacacgtatgcgaagggccagagaagccagacccagtaagaaaaaatagcctatttactttaaataaaccaaacattccattttaaatgtggggattgggaaccactagttctttcagatggtattcttcagactatagaaggagaagcaaagacaccgcagggacttgaaccccgtcctggaaaccaggagtgccagccaccagcgtcttttgcttttttttttttaaagctagggaaaggccaaaaagcaaaacctgagaaaacaaaaggttgttttctcaggaaaagaaaaacctttacaaccctactgacgaatcTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO:105).
[0079] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAatttttaggtaaaatgctttttgttcatttctggtggtgggaggggactgaagcctttagtcttttccagatgcaaccttaaaatcagtgacaagaaacattccaaacaagcaacagtcttcaagaaattaaactggcaagtggaaatgtttaaacagttcagtgatctttagtgcattgtttatgtgtgggtttctctctcccctcccttggtcttaattcttacatgcaggaacactcagcagacacacgtatgcgaagggccagagaagccagacccagtaagaaaaaatagcctatttactttaaataaaccaaacattccattttaaatgtggggattgggaaccactagttctttcagatggtattcttcagactatagaaggagaaaggtttttcttttcctgagaaatttctcaggttttgctttttaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO:106).
[0080] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAatttttaggtaaaatgctttttgttcatttctggtggtgggaggggactgaagcctttagtcttttccagatgcaaccttaaaatcagtgacaagaaacattccaaacaagcaacagtcttcaagaaattaaactggcaagtggaaatgtttaaacagttcagtgatctttagtgcattgtttatgtgtgggtttctctctcccctcccttggtcttaattcttacatgcaggaacactcagcagacacacgtatgcgaagggccagagaagccagacccagtaagaaaaaatagcctatttactttaaataaaccaaacattccattttaaatgtggggattgggaaccactagttctttcagatggtattcttcagactatagaaggagCCCAAtttttcttttGAATTCTCTAGAGAATTCttttgctttttCTTCaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO:107).
[0081] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAtctgcagtattgcatgttagggataagtgcttatttttaagagctgtggagttcttaaatatcaaccatggcactttctcctgaccccttccctaggggatttcaggattgagaaatttttccatcgagcctttttaaaattgtaggacttgttcctgtgggcttcagtgatgggatagtacacttcactcagaggcatttgcatctttaaataatttcttaaaagcctctaaagtgatcagtgccttgatgccaactaaggaaatttgtttagcattgaatctctgaaggctctatgaaaggaatagcatgatgtgctgttagaatcagatgttactgctaaaatttacatgttgtgatgtaaattgtgtagaaaaccattaaatcattcaaaataataaactatttttattagagaatgtatacttttagaaagctgtctccttatttaaataaaatagtgtttgtctgtagttcagtgaaaggtttttcttttcctgagaaatttctcaggttttgctttttaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC (SEQ ID NO:108).
[0082] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAtctgcagtattgcatgttagggataagtgcttatttttaagagctgtggagttcttaaatatcaaccatggcactttctcctgaccccttccctaggggatttcaggattgagaaatttttccatcgagcctttttaaaattgtaggacttgttcctgtgggcttcagtgatgggatagtacacttcactcagaggcatttgcatctttaaataatttcttaaaagcctctaaagtgatcagtgccttgatgccaactaaggaaatttgtttagcattgaatctctgaaggctctatgaaaggaatagcatgatgtgctgttagaatcagatgttactgctaaaatttacatgttgtgatgtaaattgtgtagaaaaccattaaatcattcaaaataataaactatttttattagagaatgtatacttttagaaagctgtctccttatttaaataaaatagtgtttgtctgtagttcagtgCCCAAtttttcttttGAATTCTCTAGAGAATTCttttgctttttCTTCaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC(SEQ ID NO:109).
[0083] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAgattcttctctaatctttcagaaactttgtctgcgaacactctttaatggaccagatcaggatttgagcggaagaacgaatgtaactttaaggcaggaaagacaaattttattcttcataaagtgatgagcatataataattccaggcacatggcaatagaggccctctaaataaggaataaataacctcttagacaggtgggagattatgatcagagtaaaaggtaattacacattttatttccagaaagtcaggggtctataaattgacagtgattagagtaatactttttcacatttccaaagtttgcatgttaactttaaatgcttacaatcttagagtggtaggcaatgttttacactattgaccttatatagggaagggagggggtgcctgtggggttttaaagaattttcctttgcagaggcataaaggtttttcttttcctgagaaatttctcaggttttgctttttaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC(SEQ ID NO:110).
[0084] In some embodiments, the 3' domain disclosed herein comprises GGTCTCcggagCAGTCTCGGTAAGACACGGTCGTCTCtGATAgattcttctctaatctttcagaaactttgtctgcgaacactctttaatggaccagatcaggatttgagcggaagaacgaatgtaactttaaggcaggaaagacaaattttattcttcataaagtgatgagcatataataattccaggcacatggcaatagaggccctctaaataaggaataaataacctcttagacaggtgggagattatgatcagagtaaaaggtaattacacattttatttccagaaagtcaggggtctataaattgacagtgattagagtaatactttttcacatttccaaagtttgcatgttaactttaaatgcttacaatcttagagtggtaggcaatgttttacactattgaccttatatagggaagggagggggtgcctgtggggttttaaagaattttcctttgcagaggcatCCCAAtttttcttttGAATTCTCTAGAGAATTCttttgctttttCTTCaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgcttTACGtGAGACGGCAGAACTTACGAGCCAGTGccataGAGACC(SEQ ID NO:111).
[0085] In some embodiments, the 3' domain disclosed herein comprises gtttgaaaaatgtgaaggactttcgtaacggaagtaattcaagatcaagagtaattaccaacttaatgtttttgcattggactttgagttaagattattttttaaatcctgaggactagcattaattgacagctgacccaggtgctacacagaagtggattcagtgaatctaggaagacagcagcagacaggattccaggaaccagtgtttgatgaagctaggactgaggagcaagcgagcaagcagcagttcgtggtgaagataggaaaagagtccaggagccagtgcgatttggtgaaggaagctaggaagaaggaaggagcgctaacgatttggtggtgaagctaggaaaaaggattccaggaaggagcgagtgcaataaaggtttttcttttcctgagaaatttctcaggttttgctttttaaaaaaaaagcaaaagacgctggtggctggcactcctggtttccaggacggggttcaagtccctgcggtgtctttgctt (SEQ ID NO:112).
[0086] In some implementations, the 3' domain disclosed herein includes (SEQ ID NO:113).
[0087] Exon domains In some embodiments, this document describes trans-spliced ribonucleic acid comprising an exon domain. In some embodiments, the exon domain is derived from or isolated from the target RNA. In some embodiments, the exon domain is a heterologous sequence. In some embodiments, the exon domain encodes an engineered protein. In some embodiments, the exon domain encodes a molecule (e.g., a protein) that functions in immunotherapy. In some embodiments, the exon domain is a chimeric antigen receptor.
[0088] In some embodiments, the exon domains consist of sequences derived from or isolated from human genes. In some embodiments of the compositions disclosed herein, the sequence comprising the exon domain has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 87%, 90%, 95%, 97%, 99%, or any percentage therebetween that has the same identity as a human gene. In some embodiments, the exon domains have about 100% identity with the sequences derived from or isolated from human genes. In some embodiments, the exon domain comprises or consists of the following: about 2 nucleotides, about 5 nucleotides, about 10 nucleotides, about 20 nucleotides, about 30 nucleotides, about 40 nucleotides, about 50 nucleotides, about 60 nucleotides, about 70 nucleotides, about 80 nucleotides, about 90 nucleotides, about 100 nucleotides, about 110 nucleotides, about 120 nucleotides, about 130 nucleotides, about 140 nucleotides, about 150 nucleotides, about 160 nucleotides, about 170 nucleotides, about 180 nucleotides, about 190 nucleotides, about 200 nucleotides, about 210 nucleotides, about 220 nucleotides, about 230 nucleotides, about 240 nucleotides, about 250 nucleotides, about 260 nucleotides, about 270 nucleotides, about 270 nucleotides, or more.
[0089] Exon domains may include, but are not limited to, nucleic acid (e.g., RNA) sequences derived from or isolated from the following genes (gene accession IDs in square brackets, and associated diseases in brackets), such as TNFRSF13B [ENSG00000240505] (common variant immunodeficiency); ADA, CECR1 [ENSG00000196839, ENSG00000093072] (adenosine deaminase deficiency); IL2RG [ENSG00000147168] (X-linked severe combined immunodeficiency); HBB [ENSG00000244734] (β-thalassemia); HBA1, HBA2 [ENSG00000206172, ENSG00000188536] (α-Thalassemia); U2AF1 [ENSG00000160201] (myelodysplastic syndrome); SOD1, TARDBP, FUS, MATR3, SOD1, C9ORF72 [ENSG00000142168, ENSG00000120948, ENSG00000089280, ENSG00000015479, ENSG00000142168, ENSG00000147894] (amyotrophic lateral sclerosis); MAPT, PGRN [ENSG00000186868, ENSG00000030582] (Frontotemporal dementia with Parkinson's syndrome); CDH23, MYO7A, USH2A, PCDH15 [ENSG00000107736, ENSG00000137474, ENSG00000042781, ENSG00000150275] (Ussell's syndrome); GALC [ENSG00000054983] (Clabberg disease); SMPD1, NPC1, NPC2 [ENSG00000166311, ENSG00000141458, ENSG00000119655] (Niemann-Pick disease); PRNP [ENSG00000171867] (prions); SCN1A [ENSG00000144285] (Dlavit syndrome); PINK1, ATPGAP2 [ENSG00000158828] (early-onset Parkinson's disease);ATXN1, ATXN2, ATXN3, PLEKHG4, SPTBN2, CACNA1A, ATXN7, TTBK2, PPP2R2B, KCNC3, PRKCG, ITPR1, TBP, KCND1, FGF14 [ENSG00000124788, ENSG00000204842, ENSG00000066427, ENSG00000196155, ENSG00000173898, ENSG00000141837, ENSG00000163635, ENSG000 00128881, ENSG00000156475, ENSG00000131398, ENSG00000126583, ENSG00000150995, ENSG00000112592, ENSG00000102057, ENSG00000102466] (Spinocerebellar ataxia); SCN1A, SCN2A, CACNA1A, GRIN2B, GRIN2A, MECP2, FOXG1, SLC6A1, PRRT2, PTEN, KCNQ2, KCNQ3, STARD7, CLRN1 [ENSG00000144285, ENSG00000136531, ENSG00000141837, ENSG00000273079, ENSG [00000183454, ENSG00000169057, ENSG00000176165, ENSG00000157103, ENSG00000167371, ENSG00000171862, ENSG00000075043, ENSG00000184156, ENSG00000084090, ENSG00000163646] (Hereditary Epilepsy); ATM [ENSG00000149311] (Ataxia-telangiectasia); GLB1 [ENSG00000170266] (GM1 ganglioside storage disorder); GBA [ENSG00000177628] (Gaucher disease); GM2A [ENSG00000196743] (GM2 ganglioside storage disorder); UBE3A [ENSG00000114062] (Angelman syndrome); SLC2A1 [ENSG00000117394] (Type 1 glucose transporter deficiency); LAMP2 [ENSG00000005893] (Dano's disease); GLA [ENSG00000102393] (Fabry disease); PKD1, PKD2 [ENSG00000008710, ENSG00000118762] (autosomal dominant polycystic kidney disease);GAA [ENSG00000171298] (Pompe disease); PCSK9, LDLR, APOB, APOE [ENSG00000169174, ENSG00000130164, ENSG00000084674, ENSG00000130203] (familial hypercholesterolemia); MYOC, OPTN, TBK1, WDR36, CYPIB1 [ENSG00000034971, ENSG00000123240, ENSG00000183735, ENSG00000134987, ENSG00000138061] (open-angle glaucoma); IDUA [ENSG00000127415] (Heller's syndrome or mucopolysaccharidosis 1); IDS [ENSG00000010404] (Hunter's syndrome or mucopolysaccharidosis 2); CLN3 [ENSG00000188603] (Barten's disease); DMD [ENSG00000198947] (Duchenne muscular dystrophy); LMNA [ENSG00000160789] (Type 1B limb-girdle muscular dystrophy); DYSF [ENSG00000135636] (Type 2B limb-girdle muscular dystrophy); SGCA [ENSG00000108823] (Type 2D limb-girdle muscular dystrophy); SGCB [ENSG00000163069] (Type 2E limb-girdle muscular dystrophy); SGCG [ENSG00000102683] (Type 2C limb-girdle muscular dystrophy); SGCD [ENSG00000170624](Type 2F limb-girdle muscular dystrophy); DUX4[ENSG00000260596](facioscapulohumeral muscular dystrophy); F9 [ENSG00000101981](hemophilia B); F8[ENSG00000185010] (Hemophilia A); USH2A, RPGR, RP2, RHO, PRPF31, USH1F, PRPF3, PRPF6 [ENSG00000156313, ENSG00000102218, ENSG00000163914, ENSG00000105618, ENSG00000150275, ENSG00000117360, ENSG00000101161] (Retinitis pigmentosa); CFTR [ENSG00000001626] (Cystic fibrosis);GJB2, GJB6, STRC, DFNA1, WFS1 [ENSG00000165474, ENSG00000121742, ENSG00000242866, ENSG00000131504, ENSG00000109501] (autosomal dominant hearing loss); POU3F3 [ENSG00000198914] (nonsyndromic hearing loss); CEP290 [ENSG00000198707] (LCA10); COL7A1 [ENSG00000114270] (epidermolysis bullosa); ATP7B [ENSG00000123191] (Wilson's disease); ABCA4 [ENSG00000198691] (Stargardt's disease), OTOF [ENSG00000115155] (Otoferlin syndrome).
[0090] In some implementations, the exon domains may be codon-optimized. In some implementations, the exon domains may be codon-optimized, which may increase stability, translation, or other desired features.
[0091] In addition to nucleic acid sequences derived from or isolated from human genes, exon domains may contain nucleic acid sequences derived from or isolated from other organisms to alter the stability, translation, processing, or localization of target RNA. In some embodiments, exon domains derived from or isolated from non-human sources may include, but are not limited to, nucleic acid sequences that enhance protein production, such as those derived from or isolated from Woodchuck Hepatitis Virus (WHV) post-transcriptional regulatory elements (WPREs), triplets from MALAT1, PREs of Hepatitis B virus (HPREs), and iron-response elements in the form of CAGYCX (Y = U or A; X = U, C, or A).
[0092] The compositions described herein can modulate the levels of the produced proteins. Besides replacing specific mutated sequences within the target RNA with non-mutated sequences, another useful operation of the compositions described herein is to increase the production of proteins encoded by the target RNA. For this purpose, one or more exon domains can be configured to amplify the translation of the target RNA. Furthermore, the exon domains described herein can have greater target specificity to achieve therapeutic targeting of the appropriate target RNA, and thereby increase the production of proteins encoded by the target RNA.
[0093] The exon domain may contain one or more untranslated regions that enhance the translation of the exon domain. In some embodiments, the exon domain further includes a 3' untranslated region and / or a 5' untranslated region. In some embodiments, the untranslated regions that enhance the translation of the exon domain contain sequences derived from or isolated from the group consisting of: marmot hepatitis virus (WHV) posttranscriptional regulatory element (WPRE), a triplet from MALAT1, hepatitis B virus PRE (HPRE), and an iron response element.
[0094] Exon domains can encode regulatory elements. In some embodiments, the regulatory element comprises a promoter capable of expressing the exon domain or trans-spliced RNA molecules in eukaryotic cells. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, tissue-specific expression of trans-spliced RNA molecules can be achieved via a tissue-specific promoter.
[0095] Intronic domains The compositions provided herein may comprise a nucleic acid sequence encoding one or more intronic domains. The nucleic acid may comprise RNA, DNA, a DNA / RNA hybrid, and / or at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. The nucleic acid may comprise DNA encoding one or more intronic domains. The one or more intronic domains may be transcribed into RNA. The nucleic acid comprising DNA encoding one or more intronic domains may be transcribed into trans-spliced RNA. The nucleic acid may comprise RNA encoding one or more intronic domains. The intronic domain may be configured to facilitate RNA splicing of one or more exon domains of a trans-spliced RNA molecule or a portion thereof. In some embodiments, the intronic domain may carry a binding site preferentially targeted by a disease-causing mutant RNA-binding protein. In some embodiments, the dissociation constants of these mutant RNA-binding proteins and the intronic domain may be lower than the dissociation constants of non-mutant RNA-binding proteins and the intronic domain.
[0096] In some embodiments, the intronic domain further comprises one or more nucleic acid sequences configured to enhance trans-splicing of one or more exon domains. In some embodiments, the one or more sequences configured to enhance trans-splicing of exon domains may be trans-splicing enhancer sequences (or trans-splicing enhancer sequences). In some embodiments, one or more sequences may be configured to bind engineered U1 snRNA (ESM). In some embodiments, the ESM may comprise engineered small nuclear RNA (esnRNA). In some embodiments, one or more sequences may contain binding sites preferentially targeted by the engineered snRNA. In some embodiments, the engineered small nuclear RNA may be a modified form of U1 snRNA. In some embodiments, such modified U1 snRNA may increase the trans-splicing efficiency of trans-splicing nucleic acid molecules. In some embodiments, the engineered snRNA (esnRNA) disclosed herein includes any esnRNA described in US 2024 / 0011026 A1, which is incorporated herein by reference in its entirety for all purposes.
[0097] In some embodiments, the trans-splicing enhancer sequence comprises 5'-X1X2X3X4X5X6-3', where X1 is uracil (U) or guanine (G); X2 is adenine (A), uracil (U), or guanine (G); X3 is adenine (A), uracil (U), and guanine (G); X4 is adenine (A), uracil (U), cytosine (C), or guanine (G); X5 is adenine (A), cytosine (C), uracil (U), or guanine (G); and X6 is adenine (A), uracil (U), or guanine (G).
[0098] In some embodiments, the trans-splicing enhancer sequence comprises 5'-X1X2X3X4X5X6-3', wherein: X1 is selected from the group consisting of adenine (A), uracil (U), and guanine (G); X2 is selected from the group consisting of adenine (A), uracil (U), and guanine (G); X3 is selected from the group consisting of adenine (A), uracil (U), and guanine (G); X4 is selected from the group consisting of adenine (A), uracil (U), and guanine (G); X5 is selected from the group consisting of adenine (A), uracil (U), and guanine (G); and X6 is selected from the group consisting of uracil (U) and guanine (G).
[0099] In some embodiments, the trans-splicing enhancer sequence comprises 5'-X1X2X3X4X5X6-3', wherein: X1 is selected from the group consisting of adenine (A), uracil (U), and guanine (G); X2 is selected from the group consisting of uracil (U) and guanine (G); X3 is selected from the group consisting of adenine (A), uracil (U), and guanine (G); X4 is selected from the group consisting of uracil (U) and guanine (G); X5 is selected from the group consisting of uracil (U) and guanine (G); and X6 is selected from the group consisting of uracil (U) and guanine (G).
[0100] In some implementations, the trans-splicing enhancement sequence (trans-splicing enhancement sub-sequence) described herein may include any sequence that effectively promotes trans-splicing. In some embodiments, the trans-splicing enhancer sequence may include any one or more of the following: TTACGG (UUACGG in RNA sequence), TACGG (UAACGG in RNA sequence), GGGTTT (GGGUUU in RNA sequence), GTTTTG (GUUUUG in RNA sequence), GGTTTT (GGUUUU in RNA sequence), GGTTTG (GGUUUG in RNA sequence), GGTTGG (GGUUGG in RNA sequence), GTTAGG (GUUAGG in RNA sequence), TGGTTG (UGGUUG in RNA sequence), GGGTAG (GGGUAG in RNA sequence), GGTAGG (GGUAGG in RNA sequence), GGTAGT (GGUAGU in RNA sequence), GTAGTT (GUAGUU in RNA sequence), GTTGGT (GUUGGU in RNA sequence), GTGGTT (GUGGUU in RNA sequence), GGTGGT (GGUGGU in RNA sequence), TGGTGG (UGGUGG in RNA sequence), TTGGTG (UUGGUG in RNA sequence), GTAAGG (GUAAGG in RNA sequence), TAAGGG (UAAGGG in RNA sequence), TTAGGG (UUAGGG in RNA sequence), TAGGGG (UAGGGG in RNA sequence), TTGGGG (UUGGGG in RNA sequence), GTTGGG (GUUGGG in RNA sequence), GTAGGG (GUAGGG in RNA sequence), TATTGGG (UAUUGG in RNA sequence), TGTTGG (UGUUGG in RNA sequence), TATGGG (UAUGGG in RNA sequence), TTTGGG (UUUGGG in RNA sequence), TGTGGG (UGUGGG in RNA sequence), TTTTGGG (UUGUGG in RNA sequence), GAGTGT (GAGUGU in RNA sequence), GAGGTA (GAGGUA in RNA sequence), GGAGGT (GGAGGU in RNA sequence), TGGGAG (UGGGAG in RNA sequence), GGGGTG (GGGGUG in RNA sequence), GGGGGA (GGGGGA in RNA sequence), GGGGGT (GGGGGU in RNA sequence), GGGGTA (GGGGUA in RNA sequence), GGGAGG(GGGAGG in RNA sequence), GGGTGG (GGGUGG in RNA sequence), GGAGGG (GGAGGG in RNA sequence), GGTGGG (GGUGGG in RNA sequence), GAGGGG (GAGGGG in RNA sequence), GTGGGG (GUGGGG in RNA sequence), GAGGTGG (GAGUGG in RNA sequence), GTATGG (GUAUGG in RNA sequence), GGTATT (GGUAUU in RNA sequence), GTATTT (GUAUUU in RNA sequence), GTATTG (GUAUUG in RNA sequence), AGTTTA (AGUUUA in RNA sequence), AGGTTA (AGGUUA in RNA sequence), GTAACG (GUAACG in RNA sequence), AGGTAA (AGGUAA in RNA sequence), GGTAAG (GGUAAG in RNA sequence), TGGGGG (UGGGGG in RNA sequence), AGGGTT (AGGGUU in RNA sequence). AGGTTG (AGGUUG in RNA sequence), AGGTAG (AGGUAG in RNA sequence), ATTTGG (AUUUGG in RNA sequence), ATTTGG (AGUUGG in RNA sequence), TCTGGG (UCUGGG in RNA sequence), AGAGTG (AGAGUG in RNA sequence), AGAGGG (AGAGGG in RNA sequence), AGTGTG (AGUGUG in RNA sequence), AGAGGT (AGAGGU in RNA sequence), AGGGAG (AGGGAG in RNA sequence), AGGGTG (AGGGUG in RNA sequence), AGGGGG (AGGGGG in RNA sequence), AGGGGT (AGGGGU in RNA sequence), AGTGGG (AGUGGG in RNA sequence), AGTATG (AGUAUG in RNA sequence), AGGTAT (AGGUAU in RNA sequence), GTATTC (GUAUUC in RNA sequence), and GGTAAC (GGUAAC in RNA sequence).
[0101] In some implementations, one, some, or all of the thymidine bases in the trans-splicing enhancement sequence can be replaced by uracil.
[0102] Kernel-reserved domains The compositions provided herein may further comprise one or more nucleic acid sequences encoding or comprising a nuclear-reserved domain. The nucleic acid may comprise RNA, DNA, a DNA / RNA hybrid, and / or at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. The nucleic acid sequence may comprise RNA. Nucleic acid sequences comprising RNA may comprise a nuclear-reserved domain. In some embodiments, the nucleic acid sequence may comprise DNA encoding a nuclear-reserved domain. In some embodiments, the DNA encoding the nuclear-reserved domain may be transcribed into a trans-spliced RNA molecule or a portion thereof. The nuclear-reserved domain may increase the accumulation of exon domains in the cell nucleus or in specific structures in the cell nucleus, such as nuclear spots or parasporals. In some embodiments, the nuclear-reserved domain is configured to promote the trans-splicing of exon domains into target RNA. In some embodiments, the nuclear-reserved domain is configured to promote trans-splicing events. In some embodiments, the nuclear-reserved domain is configured to reduce the translation of trans-spliced RNA.
[0103] In some embodiments, the trans-splicing molecule (e.g., a trans-splicing RNA molecule) or a portion thereof comprises a nuclear-reserved domain. In some embodiments, the trans-splicing molecules provided herein do not comprise a nuclear-reserved domain. In some embodiments, a nuclear-reserved domain that increases trans-splicing activity or trans-splicing occurrence may also increase the level of trans-splicing molecules in the cell nucleus. In some embodiments, the nuclear-reserved domain is derived from or isolated from mRNA, long non-coding RNA, or synthetic sequences that can alter the localization of different transcript types within the cell nucleus. In some embodiments, the nuclear-reserved domain functions specifically in the context of RNA trans-splicing. In some embodiments, the localization sequences described herein may function universally (e.g., in any system).
[0104] The nuclear-reserving domain is configured to facilitate the transport of trans-spliced nucleic acid molecules to the cell nucleus or a specific location within the cell nucleus. The nuclear-reserving domain may contain one or more localizing sequences that bind to enzymes involved in transcription (such as polymerase II or transcription-associated enzymes), RNA splicing, or nuclear dot formation. Various mechanisms exist for facilitating RNA trans-splicing, and this disclosure focuses on RNA trans-splicing mediated by the spliceosome. Since components on the spliceosome can be located both inside and within the cell nucleus, the nuclear-reserving domain is configured to increase RNA trans-splicing activity by facilitating the accumulation of RNA trans-spliced molecules at the spliceosome site. In other embodiments, this disclosure provides compositions comprising nucleic acid sequences encoding trans-spliced nucleic acid molecules.
[0105] In some embodiments, the nuclear-reserved domain may carry a sequence that promotes nuclear localization of trans-splicing molecules and is derived from or isolated from genes selected from the group consisting of: CDKN2B-AS1 [NR_003529]; BANCR [NR_047671]; CASC15 [NR_015410]; CRNDE [NR_034105]; EMX2OS [NR_002791]; EVF2 [NR_015448]; FENDRR [NR_036444]; FTX [NR_028379]; GAS5 [NR_002578]; HOTAIR [NR_003716]; HOTAIRM1 [NR_038366]; HOXA-AS3 [NR_038832]; HOXA11-AS [NR_002795]; JPX [NR_024582]; LHX5-AS1 [NR_126425]; LINC01578 [NR_037600]; LINC00261 [NR_001558]; MALAT1 [NR_002819.4]; MEG3 [NR_046473]; TUNAR [NR_038861]; MIAT [NR_033320]; NEAT1 [NR_028272]; NR2F1-AS1 [NR_021490]; LINC-PINT [NR_015431]; PSMA3-AS1 [NR_029434]; EMX2OS [ENSG00000229847]; PVT1 [NR_003367];MEG8 [NR_024149]; RMST [NR_024037]; SENCR [NR_038908]; SIX3-AS1 [NR_103786]; SOX21-AS1 [NR_046514]; TERC [NR_001566]; TUG1 [NR_002323]; XIST [NR_001564]; malat1 [NR_002847.3]; Nfx1 [NM_023739.3]; Ogt [NM_139144.4]; Nlrp6 [NM_133946.2]; Mlxipl [NM_021455.5]; Leng8 [NM_001374609.1]; Gcgr [NM_008101.2]; Gck [NM_001287386.1]; Acly [NM_001199296.1]; Ccnl1 [NM_001355433.1]; Ccnl2 [NM_207678.2]; Chkb [NM_007692.6].
[0106] In some implementations, the nuclear-retained domain can bind polymerase II and is derived from or isolated from aptamers or long non-coding RNAs.
[0107] In some embodiments, the nuclear-retaining domain is derived from or isolated from short-tinters-persed elements (SINEs). In some embodiments, the SINEs are derived from or isolated from genes selected from the group consisting of: ENSMUST00000064097, ENSMUST00000066988, ENSMUST00000074862, ENSMUST00000093950, ENSMUST00000095448, ENSMUST00000099693, ENSMUST00000105109, ENSMUST00000108741, ENSMUST00000109431, ENSMUST00000123368, ENSMUST 00000124068, ENSMUST00000124095, ENSMUST00000124363, ENSMUST00000124434, ENSMUST00000124813, ENSMUST00000124848, ENSMUST00 000125374, ENSMUST00000126063, ENSMUST00000126467, ENSMUST00000127001, ENSMUST00000127328, ENSMUST00000128305, ENSMUST0000 0129082, ENSMUST00000129910, ENSMUST00000130092, ENSMUST00000130362, ENSMUST00000130582, ENSMUST00000130679, ENSMUST000001 31042, ENSMUST00000132070, ENSMUST00000132337, ENSMUST00000132370, ENSMUST00000132414, ENSMUST00000133960, ENSMUST00000134 264. ENSMUST00000134795, ENSMUST00000134921, ENSMUST00000135423, ENSMUST00000135564, ENSMUST00000135987, ENSMUST0000013655 5. ENSMUST00000136749, ENSMUST00000137629, ENSMUST00000137706, ENSMUST00000137776, ENSMUST00000138291, ENSMUST00000138295,ENSMUST00000138574、ENSMUST00000139190、ENSMUST00000139424、ENSMUST00000139529、ENSMUST00000139576、ENSMUST00000139973、ENSMUST00000140009、ENSMUST00000140203、ENSMUST00000140298、ENSMUST00000141088、ENSMUST00000141452、ENSMUST00000141869、ENSMUST00000142279、ENSMUST00000142569、ENSMUST00000142581、ENSMUST00000143133、ENSMUST00000143260、ENSMUST00000143346、ENSMUST00000143649、ENSMUST00000143964、ENSMUST00000144006、ENSMUST00000144043、ENSMUST00000144368、ENSMUST00000144607、ENSMUST00000145549、ENSMUST00000146043、ENSMUST00000146372、ENSMUST00000146404、ENSMUST00000146531、ENSMUST00000146587、ENSMUST00000146644、ENSMUST00000146690、ENSMUST00000146963、ENSMUST00000147541、ENSMUST00000147722、ENSMUST00000148405、ENSMUST00000148534、ENSMUST00000148548、ENSMUST00000149025、ENSMUST00000149382、ENSMUST00000149481、ENSMUST00000149618、ENSMUST00000149815、ENSMUST00000150171、ENSMUST00000150265、ENSMUST00000150455、ENSMUST00000150482、ENSMUST00000150628、ENSMUST00000151038、ENSMUST00000151599、ENSMUST00000151979、ENSMUST00000152025、ENSMUST00000152172、ENSMUST00000152439、ENSMUST00000152815、ENSMUST00000152825、ENSMUST00000152987、ENSMUST00000153589、ENSMUST00000153817、ENSMUST00000154085、ENSMUST00000155540、ENSMUST00000155758、ENSMUST00000156149、ENSMUST00000156150、ENSMUST00000156331、ENSMUST00000156350、ENSMUST00000156633、ENSMUST00000162565、ENSMUST00000163052、ENSMUST00000163302、ENSMUST00000164379、ENSMUST00000165505、ENSMUST00000170933、ENSMUST00000172285、ENSMUST00000172817、ENSMUST00000172838、ENSMUST00000174057、ENSMUST00000174630、ENSMUST00000174768、ENSMUST00000176201、ENSMUST00000176366、ENSMUST00000177104、ENSMUST00000177482、ENSMUST00000178424、ENSMUST00000178920、ENSMUST00000179324、ENSMUST00000180379、ENSMUST00000180382、ENSMUST00000180383、ENSMUST00000180404、ENSMUST00000180410、ENSMUST00000180411、ENSMUST00000180426、ENSMUST00000180434、ENSMUST00000180445、ENSMUST00000180452、ENSMUST00000180466、ENSMUST00000180467、ENSMUST00000180468、ENSMUST00000180477、ENSMUST00000180485、ENSMUST00000180495、ENSMUST00000180505、ENSMUST00000180506、ENSMUST00000180509、ENSMUST00000180512、ENSMUST00000180518、ENSMUST00000180527、ENSMUST00000180529、ENSMUST00000180534、ENSMUST00000180538、ENSMUST00000180558、ENSMUST00000180562、ENSMUST00000180576、ENSMUST00000180586、ENSMUST00000180590、ENSMUST00000180595、ENSMUST00000180598、ENSMUST00000180599、ENSMUST00000180601、ENSMUST00000180609、ENSMUST00000180613、ENSMUST00000180623、ENSMUST00000180650、ENSMUST00000180653、ENSMUST00000180670、ENSMUST00000180671、ENSMUST00000180679、ENSMUST00000180682、ENSMUST00000180685、ENSMUST00000180691、ENSMUST00000180693、ENSMUST00000180712、ENSMUST00000180732、ENSMUST00000180733、ENSMUST00000180738、ENSMUST00000180741、ENSMUST00000180748、ENSMUST00000180750、ENSMUST00000180751、ENSMUST00000180779、ENSMUST00000180783、ENSMUST00000180785、ENSMUST00000180797、ENSMUST00000180800、ENSMUST00000180807、ENSMUST00000180809、ENSMUST00000180812、ENSMUST00000180815、ENSMUST00000180832、ENSMUST00000180834、ENSMUST00000180841、ENSMUST00000180842、ENSMUST00000180855、ENSMUST00000180860、ENSMUST00000180864、ENSMUST00000180865、ENSMUST00000180875、ENSMUST00000180876、ENSMUST00000180882、ENSMUST00000180892、ENSMUST00000180896、ENSMUST00000180908、ENSMUST00000180917、ENSMUST00000180926、ENSMUST00000180927、ENSMUST00000180936、ENSMUST00000180942、ENSMUST00000180969、ENSMUST00000180970、ENSMUST00000180975、ENSMUST00000180981、ENSMUST00000181000、ENSMUST00000181003、ENSMUST00000181005、ENSMUST00000181020、ENSMUST00000181022、ENSMUST00000181029、ENSMUST00000181030、ENSMUST00000181041、ENSMUST00000181052、ENSMUST00000181056、ENSMUST00000181066、ENSMUST00000181073、ENSMUST00000181083、ENSMUST00000181085、ENSMUST00000181090、ENSMUST00000181097、ENSMUST00000181106、ENSMUST00000181113、ENSMUST00000181119、ENSMUST00000181124、ENSMUST00000181125、ENSMUST00000181133、ENSMUST00000181140、ENSMUST00000181144、ENSMUST00000181148、ENSMUST00000181149、ENSMUST00000181152、ENSMUST00000181153、ENSMUST00000181160、ENSMUST00000181167、ENSMUST00000181175、ENSMUST00000181180、ENSMUST00000181191、ENSMUST00000181193、ENSMUST00000181197、ENSMUST00000181200、ENSMUST00000181203、ENSMUST00000181206、ENSMUST00000181207、ENSMUST00000181220、ENSMUST00000181230、ENSMUST00000181255、ENSMUST00000181262、ENSMUST00000181265、ENSMUST00000181270、ENSMUST00000181274、ENSMUST00000181301、ENSMUST00000181302、ENSMUST00000181303、ENSMUST00000181304、ENSMUST00000181305、ENSMUST00000181307、ENSMUST00000181311、ENSMUST00000181315、ENSMUST00000181317、ENSMUST00000181328、ENSMUST00000181371、ENSMUST00000181382、ENSMUST00000181395、ENSMUST00000181400、ENSMUST00000181405、ENSMUST00000181416、ENSMUST00000181418、ENSMUST00000181425、ENSMUST00000181426、ENSMUST00000181440、ENSMUST00000181453、ENSMUST00000181454、ENSMUST00000181457、ENSMUST00000181458、ENSMUST00000181460、ENSMUST00000181462、ENSMUST00000181481、ENSMUST00000181482、ENSMUST00000181486、ENSMUST00000181491、ENSMUST00000181498、ENSMUST00000181499、ENSMUST00000181500、ENSMUST00000181503、ENSMUST00000181506、ENSMUST00000181522、ENSMUST00000181526、ENSMUST00000181531、ENSMUST00000181534、ENSMUST00000181538、ENSMUST00000181539、ENSMUST00000181540、ENSMUST00000181546、ENSMUST00000181552、ENSMUST00000181555、ENSMUST00000181556、ENSMUST00000181561、ENSMUST00000181570、ENSMUST00000181574、ENSMUST00000181576、ENSMUST00000181578、ENSMUST00000181587、ENSMUST00000181612、ENSMUST00000181617、ENSMUST00000181631、ENSMUST00000181637、ENSMUST00000181664、ENSMUST00000181668、ENSMUST00000181680、ENSMUST00000181682、ENSMUST00000181687、ENSMUST00000181706、ENSMUST00000181713、ENSMUST00000181717、ENSMUST00000181719、ENSMUST00000181720、ENSMUST00000181723、ENSMUST00000181727、ENSMUST00000181729、ENSMUST00000181732、ENSMUST00000181746、ENSMUST00000181765、ENSMUST00000181769、ENSMUST00000181771、ENSMUST00000181801、ENSMUST00000181803、ENSMUST00000181805、ENSMUST00000181807、ENSMUST00000181811、ENSMUST00000181831、ENSMUST00000181842、ENSMUST00000181846、ENSMUST00000181858、ENSMUST00000181866、ENSMUST00000181872、ENSMUST00000181875、ENSMUST00000181885、ENSMUST00000181890、ENSMUST00000181891、ENSMUST00000181915、ENSMUST00000181918、ENSMUST00000181920、ENSMUST00000181925、ENSMUST00000181928、ENSMUST00000181942, ENSMUST00000181973. ,
[0108] In some implementations, the nuclear-reserved domain can bind to proteins involved in transcription. In some implementations, the nuclear-reserved domain can bind to proteins involved in RNA splicing.
[0109] In some embodiments, the nuclear-reserved domain can promote the accumulation of trans-splicing molecules in nuclear parasporal spots. In some embodiments, the nuclear-reserved domain is configured to promote the accumulation of trans-splicing molecules in nuclear parasporal spots that may be derived from or isolated from genes selected from the group consisting of: lnc-LTBP3-10 [lnc-LTBP3-10], SLC29A2 [ENSG00000174669.12], SNHG1 [ENSG00000255717.7], MUS81 [ENSG00000172732.12], TCIRG1 [ENSG00000110719.10], INPPL1 [ENSG00000165458.14], lnc-ANAPC11-7 [lnc-ANAPC11-7], IL18BP [ENSG00000137496.18], POLA2[ENSG00000014138.9], PCNX3 [ENSG00000197136.4], PC [ENSG00000173599.15], RBM4[ENSG00000173933.20], lnc-KCNK7-6 [lnc-KCNK7-6], EML3 [ENSG00000149499.11], PGGHG [ENSG00000142102.16], RBM14 [ENSG00000239306.4], LTBP3 [ENSG00000168056.16], ATG2A [ENSG00000110046.13], XLOC_026224 [XLOC_026224], HERC2P2 [ENSG00000276550.4], WDR90 [ENSG00000161996.19], lnc-LTBP3-2 [lnc-LTBP3-2], LENG8 [ENSG00000167615.16], TPCN2 [ENSG00000162341.18], lnc-TCIRG1-1[lnc-TCIRG1-1], ATG16L2 [ENSG00000168010.11], MROH1 [ENSG00000179832.17], CCDC57[ENSG00000176155.19], lnc-LTBP3-11 [lnc-LTBP3-11], PIDD1 [ENSG00000177595.18], lnc-VSTM5-1 [lnc-VSTM5-1], NEAT1 [ENSG00000245532.9]、XLOC_079850 [XLOC_079850]、XLOC_028656 [XLOC_028656]、DNHD1 [ENSG00000179532.12]、ABCA7[ENSG00000064687.12]、XLOC_000636 [XLOC_000636]、MAN2C1 [ENSG00000140400.17]、lnc-SSH3-5 [lnc-SSH3-5]、MIRLET7BHG [ENSG00000197182.14]、MAMDC4[ENSG00000177943.14]、NAA40 [ENSG00000110583.13], ANKRD13D [ENSG00000172932.14], lnc-NUMA1-3 [lnc-NUMA1-3], ADAMTS10 [ENSG00000142303.14], XLOC_083799 [XLOC_083799], ARHGEF17 [ENSG00000110237.5], CDC42BPG [ENSG00000171219.9], SNAPC4 [ENSG00000165684.4], lnc-CFL1-1 [lnc-CFL1-1], B4GALNT4 [ENSG00000182272.12], XLOC_027567 [XLOC_027567]、XLOC_000644 [XLOC_000644]、XLOC_024022 [XLOC_024022]、LTO1 [ENSG00000149716.12]、AC064843.1[ENSG00000286621.1]、CHRND [ENSG00000135902.10]、ASPSCR1 [ENSG00000169696.16]、RAD9A [ENSG00000172613.8]、lnc-RTN4R-1 [lnc-RTN4R-1]、lnc-MRPL11-1 [lnc-MRPL11-1]、SSH3 [ENSG00000172830.13]、XLOC_000637 [XLOC_000637]、AP000873.2[ENSG00000247137.9]、lnc-TRPT1-4 [lnc-TRPT1-4]、XLOC_027568 [XLOC_027568]、LINC01503 [ENSG00000233901.6]、RNASEH2C [ENSG00000172922.9]、XLOC_000634 [XLOC_000634]、MYO7A [ENSG00000137474.22]、XLOC_000633 [XLOC_000633]、lnc-BCL3-1 [lnc-BCL3-1]、MTMR9LP [ENSG00000220785.7]、AP5B1 [ENSG00000254470.3]、lnc-EDF1-2[lnc-EDF1-2]、lnc-UNC93B1-1 [lnc-UNC93B1-1]、GOLGA8B [ENSG00000215252.11]、MSH5[ENSG00000204410.15]、AP003119.1 [ENSG00000254632.2]、GUSBP11[ENSG00000228315.12]、RPS6KB2 [ENSG00000175634.15]、EME2 [ENSG00000197774.13]、XLOC_028057 [XLOC_028057]、FRMD8 [ENSG00000126391.14]、lnc-OGFOD3-1 [lnc-OGFOD3-1]、XLOC_152482 [XLOC_152482]、XLOC_028434 [XLOC_028434]、ZNF276[ENSG00000158805.12]、AP000944.5 [ENSG00000285816.1]、NRBP2[ENSG00000185189.18]、NDOR1 [ENSG00000188566.13]、lnc-PHYHD1-1 [lnc-PHYHD1-1]、lnc-RECQL4-3 [lnc-RECQL4-3]、lnc-UAP1L1-4 [lnc-UAP1L1-4]、MSH5-SAPCD1[ENSG00000255152.8]、lnc-P2RY6-1 [lnc-P2RY6-1]、RELT [ENSG00000054967.13]、CPNE7[ENSG00000178773.15]、XLOC_028557 [XLOC_028557]、XLOC_156663 [XLOC_156663]、CORO6 [ENSG00000167549.18]、RTEL1 [ENSG00000258366.8]、MIR34AHG[ENSG00000228526.7]、STPG3-AS1 [ENSG00000275549.1]、lnc-WFIKKN2-4 [lnc-WFIKKN2-4]、SYNGAP1 [ENSG00000197283.17]、LRRC45 [ENSG00000169683.8]、KIAA0895L[ENSG00000196123.13]、PNKP [ENSG00000039650.12]、lnc-EIF1AD-5 [lnc-EIF1AD-5]、TM7SF2 [ENSG00000149809.15]、NSUN5P2 [ENSG00000106133.18]、lnc-POLR2L-1 [lnc-POLR2L-1]、lnc-PPP1R27-1 [lnc-PPP1R27-1]、AC110285.2 [ENSG00000262877.5]、lnc-LRRC32-5 [lnc-LRRC32-5]、AC131009.4 [ENSG00000279283.1]、BBS1[ENSG00000174483.20]、XLOC_061408 [XLOC_061408]、lnc-SERPINH1-3 [lnc-SERPINH1-3]、AC027601.6 [ENSG00000287431.1]、lnc-NFAM1-3 [lnc-NFAM1-3]、EXD3[ENSG00000187609.16]、AC009022.1 [ENSG00000196696.12]、MC1R[ENSG00000258839.3]、PKD1P6 [ENSG00000250251.6]、lnc-KLHL35-6 [lnc-KLHL35-6]、Z97832.2 [ENSG00000272374.1]、C19orf25 [ENSG00000119559.16]、lnc-TMEM138-3[lnc-TMEM138-3]、AL031595.3 [ENSG00000280434.1]、lnc-LRRC56-3 [lnc-LRRC56-3]、lnc-STIP1-2 [lnc-STIP1-2]、XLOC_095699 [XLOC_095699]、SSSCA1-AS1[ENSG00000260233.3]、NPDC1 [ENSG00000107281.10]、lnc-NR1D1-1 [lnc-NR1D1-1]、lnc-RPL12-1 [lnc-RPL12-1]、lnc-MRPL49-1 [lnc-MRPL49-1]、XLOC_061398 [XLOC_061398]、TOB1-AS1 [ENSG00000229980.5]、AC127502.1 [ENSG00000215302.8]、XLOC_149046[XLOC_149046]、lnc-TRMT112-4 [lnc-TRMT112-4]、LINC02593 [ENSG00000223764.2]、KLHL17 [ENSG00000187961.14]、lnc-KLHL35-7 [lnc-KLHL35-7]、lnc-TMEM258-2 [lnc-TMEM258-2]、AP002495.1 [ENSG00000254469.7]、XLOC_024025 [XLOC_024025]、GPSM1[ENSG00000160360.13]、XLOC_152839 [XLOC_152839]、LBHD1 [ENSG00000162194.12]、GATD1 [ENSG00000177225.17]、XLOC_149045 [XLOC_149045]、LENG8-AS1[ENSG00000226696.6]、MAP4K2 [ENSG00000168067.12]、C11orf80[ENSG00000173715.16]、MAPK8IP3 [ENSG00000138834.12]、XLOC_090526 [XLOC_090526]、KIFC2 [ENSG00000167702.12]、LRP5L [ENSG00000100068.13]、SEC31B[ENSG00000075826.17]、XLOC_024171 [XLOC_024171]、PPP2R5B [ENSG00000068971.14]、lnc-GIPC3-3 [lnc-GIPC3-3]、AC020916.1 [ENSG00000267519.6]、XLOC_156901 [XLOC_156901]、AP006333.1 [ENSG00000256341.1]、lnc-ZNF778-3 [lnc-ZNF778-3]、lnc-LAMA5-1 [lnc-LAMA5-1]、lnc-TMEM106A-3 [lnc-TMEM106A-3]、lnc-ACER3-1 [lnc-ACER3-1]、RHPN1 [ENSG00000158106.14]、XLOC_028558 [XLOC_028558]、XLOC_088401 [XLOC_088401]、BX255925.3 [ENSG00000284976.1]、GUCY2EP [ENSG00000204529.4]、XLOC_152506 [XLOC_152506]、NOXA1 [ENSG00000188747.8]、lnc-ARRDC1-2 [lnc-ARRDC1-2]、XLOC_145191 [XLOC_145191]、BSCL2 [ENSG00000168000.14]、lnc-MACROD1-1 [lnc-MACROD1-1]、AL162586.1 [ENSG00000225032.5]、AP000944.7 [ENSG00000287917.1]、AC091196.1 [ENSG00000285581.1]、ZNRD2 [ENSG00000173465.8]、XLOC_026268 [XLOC_026268]、OSBPL7 [ENSG00000006025.12]、lnc-SSH3-4 [lnc-SSH3-4]、C9orf106[ENSG00000179082.3]、AP000437.1 [ENSG00000279549.1]、lnc-NCOA3-14 [lnc-NCOA3-14]、NADSYN1 [ENSG00000172890.13]、XLOC_060204 [XLOC_060204]、lnc-SHANK2-1 [lnc-SHANK2-1]、MEGF6 [ENSG00000162591.16]、AC099811.1 [ENSG00000236194.3]、ME3[ENSG00000151376.16]、XLOC_028655 [XLOC_028655]、GDPD5 [ENSG00000158555.15]、lnc-SPDYC-2 [lnc-SPDYC-2]、AC008105.3 [ENSG00000267121.6]、lnc-NCOA3-21 [lnc-NCOA3-21]、lnc-FEN1-6 [lnc-FEN1-6]、lnc-HYOU1-1 [lnc-HYOU1-1]、AC102953.2[ENSG00000273230.1]、XLOC_095073 [XLOC_095073]、LINC00235 [ENSG00000277142.1]、AL355987.4 [ENSG00000273066.5]、XLOC_152404 [XLOC_152404]、lnc-CDK12-1 [lnc-CDK12-1]、XLOC_028004 [XLOC_028004]、lnc-CCDC154-2 [lnc-CCDC154-2]、lnc-CCDC87-1[lnc-CCDC87-1]、INPP5E [ENSG00000148384.13]、XLOC_021222 [XLOC_021222]、AJM1[ENSG00000232434.2]、HSF4 [ENSG00000102878.16]、LINC00313 [ENSG00000185186.10]、lnc-UNC93B1-7 [lnc-UNC93B1-7]、lnc-PIDD1-2 [lnc-PIDD1-2]、lnc-CSNK1G2-5 [lnc-CSNK1G2-5]、lnc-UNC93B1-5 [lnc-UNC93B1-5]、AP006621.3 [ENSG00000255284.2]、CCDC78 [ENSG00000162004.17]、lnc-HAAO-7 [lnc-HAAO-7]、EFEMP2[ENSG00000172638.13]、XLOC_000635 [XLOC_000635]、XLOC_147952 [XLOC_147952]、lnc-PKNOX1-1 [lnc-PKNOX1-1]、lnc-LTBP3-9 [lnc-LTBP3-9]、AC008895.1[ENSG00000279948.1]、lnc-TBC1D3H-7 [lnc-TBC1D3H-7]、lnc-TMEM250-3 [lnc-TMEM250-3]、lnc-CDC42EP2-1 [lnc-CDC42EP2-1]、AC087741.1 [ENSG00000262580.5]、XLOC_156972[XLOC_156972]、lnc-PC-3 [lnc-PC-3]、AC090589.3 [ENSG00000270060.1]、XLOC_045084[XLOC_045084]、TIAF1 [ENSG00000221995.5]、lnc-CYBA-4 [lnc-CYBA-4]、lnc-SLC11A2-7[lnc-SLC11A2-7]、AC141586.1 [ENSG00000215154.6]、AP003559.1[ENSG00000256443.1]、XLOC_095076 [XLOC_095076]、PNPLA7 [ENSG00000130653.16]、lnc-RNF166-5 [lnc-RNF166-5]、XLOC_023911 [XLOC_023911]、AC092127.1[ENSG00000260417.1]、lnc-TRPT1-3 [lnc-TRPT1-3]、XLOC_028195 [XLOC_028195]、XLOC_080106 [XLOC_080106]、XLOC_026739 [XLOC_026739]、lnc-NUP98-1 [lnc-NUP98-1]、HDAC10 [ENSG00000100429.18]、DRD4 [ENSG00000069696.7]、lnc-DOC2B-3 [lnc-DOC2B-3]、lnc-DOLK-1 [lnc-DOLK-1]、CNIH2 [ENSG00000174871.11]、RGL3[ENSG00000205517.12]、GALT [ENSG00000213930.11]、AP001107.9[ENSG00000255468.7]、lnc-MKNK2-1 [lnc-MKNK2-1]、AL033543.1 [ENSG00000279175.1]。.
[0110] In some embodiments, the nuclear-reserving domain can promote the accumulation of trans-splicing molecules into nuclear spots. In some embodiments, the nuclear-reserving domain is configured to promote the accumulation of trans-splicing molecules into nuclear spots that may be derived from or isolated from genes selected from the group consisting of: MALAT1 [NR_002819.4], MEG3 [ENSG00000214548], XLOC_003526 [ENSG00000250657]. In some embodiments, the nuclear-retaining domain is configured to promote the accumulation of trans-splicing molecules into nuclear spots via binding to proteins selected from the group consisting of: SRSF1 [ENSG00000136450], SRSF2 [ENSG00000161547], SRSF3 [ENSG00000112081], SRSF4 [ENSG00000116350], SFSF6 [ENSG00000124193], SFSF7 [ENSG00000115875], SRSF10 [ENSG00000188529], SRSF11 [ENSG00000116754], CLK1 [ENSG00000013441], and CLK2 [ENSG00000176444].
[0111] In some implementations, the nuclear-retaining domain can promote the accumulation of trans-splicing molecules in nuclear spots by associating with proteins. In some implementations, the protein is selected from the group consisting of: ADNP [ENSG00000101126], ANXA7 [ENSG00000138279], API5 [ENSG00000166181], AQR [ENSG00000021776], ATAD2 [ENSG00000156802], BAZ1B [ENSG00000009954], BCLAF1 [ENSG00000029363], BTAF1 [ENSG00000095564], CCAR1 [ENSG00000060339], CCAR2 [ENSG00000158941], CDC5L [ENSG00000096401], CDC73 [ENSG00000134371], CDK11B [ENSG00000248333], CDK12 [ENSG00000167258], CDKN2AIP [ENSG00000168564], CHD3 [ENSG00000170004], CHD4 [ENSG00000111642], CHTF18 [ENSG00000127586], CPSF1 [ENSG00000071894], CSTF3 [ENSG00000176102], CTR9 [ENSG00000198730], CUL3 [ENSG00000036257], CUL4B [ENSG00000158290], CWC22 [ENSG00000163510], CWF19L1 [ENSG00000095485], DDX23 [ENSG00000174243], DDX39A [ENSG00000123136], DDX42 [ENSG00000198231], DDX46 [ENSG00000145833], DHX16 [ENSG00000204560], DHX38 [ENSG00000140829], DNMT1 [ENSG00000130816], ELOA [ENSG00000011007], EWSR1 [ENSG00000182944], FAF1 [ENSG00000185104], FBXO22 [ENSG00000167196], FKBP5 [ENSG00000096060], FUBP1 [ENSG00000162613], FUBP3[ENSG00000107164]、GPATCH8[ENSG00000186566]、GPS1 [ENSG00000169727]、GTF3C1 [ENSG00000077235]、GTF3C4[ENSG00000125484]、GTF3C5 [ENSG00000148308]、HCFC1 [ENSG00000172534]、HELLS[ENSG00000119969]、IK [ENSG00000113141]、ILF2 [ENSG00000143621]、INTS13[ENSG00000064102]、KDM1A [ENSG00000004487]、KHDRBS1 [ENSG00000121774]、KHSRP[ENSG00000088247]、LIG1 [ENSG00000105486]、MATR3 [ENSG00000280987]、METTL1[ENSG00000037897]、MRE11 [ENSG00000020922]、MSH2 [ENSG00000095002]、MSH3[ENSG00000113318]、MSH6 [ENSG00000116062]、NBN [ENSG00000104320]、NCBP1[ENSG00000136937]、NONO [ENSG00000147140]、PAF1 [ENSG00000006712]、PDS5B[ENSG00000083642]、POLD1 [ENSG00000062822]、POLR2A [ENSG00000181222]、POLR2B[ENSG00000047315]、PPM1G [ENSG00000115241]、PPP1R10 [ENSG00000204569]、PRPF19[ENSG00000110107]、PRPF3 [ENSG00000117360]、PRPF31 [ENSG00000105618]、PRPF40A[ENSG00000196504]、PRPF4B [ENSG00000112739]、PRPF6 [ENSG00000101161]、PSPC1[ENSG00000121390]、PTBP2 [ENSG00000117569]、PUS7 [ENSG00000091127]、RAD21[ENSG00000164754]、RAD50 [ENSG00000113522]、RALY[ENSG00000125970]、RBM10[ENSG00000182872]、RBM12 [ENSG00000244462]、RBM14 [ENSG00000239306]、RBM17[ENSG00000134453]、RBM25 [ENSG00000119707]、RBM26 [ENSG00000139746]、RBM4[ENSG00000173933]、RBMX [ENSG00000147274]、RFC1 [ENSG00000035928]、RFC4[ENSG00000163918]、RNF20 [ENSG00000155827]、RNF40 [ENSG00000103549]、RNMT[ENSG00000101654]、RPL35A [ENSG00000182899]、RPRD1B [ENSG00000101413]、RPRD2[ENSG00000163125]、SAMHD1 [ENSG00000101347]、SART1 [ENSG00000175467]、SART3[ENSG00000075856]、SBNO1 [ENSG00000139697]、SF3A1 [ENSG00000099995]、SF3B1[ENSG00000115524]、SF3B2 [ENSG00000087365]、SFPQ [ENSG00000116560]、SIN3A[ENSG00000169375]、SLC4A1AP [ENSG00000163798]、SMARCC1 [ENSG00000173473]、SMU1[ENSG00000122692]、SON [ENSG00000159140]、STAG2 [ENSG00000101972]、SUGT1[ENSG00000165416]、SUPT5H [ENSG00000196235]、SUPT6H [ENSG00000109111]、SYMPK[ENSG00000125755]、TARDBP [ENSG00000120948]、TCERG1 [ENSG00000113649]、THOC2[ENSG00000125676]、THOC5 [ENSG00000100296]、TP53BP1 [ENSG00000067369]、TRMT1[ENSG00000104907]、TRMT1L [ENSG00000121486]、TSR1[ENSG00000167721]、UBR5[ENSG00000104517]、UHRF1 [ENSG00000276043]、USP39 [ENSG00000168883]、USP48[ENSG00000090686]、USP7 [ENSG00000187555]、WAC [ENSG00000095787]、WDHD1[ENSG00000198554]、WRNIP1 [ENSG00000124535]、XPO5 [ENSG00000124571]、XPO7[ENSG00000130227]、XPOT [ENSG00000184575]、YLPM1 [ENSG00000119596]、ZC3H11A[ENSG00000058673]、ZC3H14 [ENSG00000100722]、ZMYND8 [ENSG00000101040]、ZNF326[ENSG00000162664]。
[0112] In some implementations, the nuclear-conserved domain sequence may be isolated from or derived from long non-coding RNAs involved in transcriptional regulation. In some implementations, the long non-coding RNAs include Air, α250 / α280, ANRIL, β-globin transcript, β-MHC antisense transcript, CAR gene intergenic 10, CCND1-related ncRNA, COLDAIR, COOLAIR, DHFR upstream transcript, Emx2os, Evf2, fbp1+ promoter RNA, GAL10-ncRNA, H19, H19 antisense, H19 upstream conserved 1 and 2, H19 ICRncRNA, HOTAIRM1, HOTTIP, Hoxa11as, ICR1, Kcnq1ot1, Khps1a, L1PA16, LINoCRb, MEG3, Mistral, Msx1as, Nespas, ncR-Upar, and PHO5. lncRNA, PHO84 antisense, pRNA, PWR1, RTL, SRG1, TEAncRNA, TIR1axut, TPO1axut, Tsix, Xist, 7SK, B2 SINE RNA, GAS5, HOTAIR, Jpx, LXRBSV, PR antisense transcript, VL30 RNA, Adapt33, antiPeg11, Gtl2-as, HOXA3as, HOXA6as, linc1242, linc1257, linc1368, linc1547, linc1582, linc1609, linc1610, lincRNA-p21, lincRNA-RoRb, Malat1-as, MEG9, NDM29, NEAT1, PANDA, PCAT-1, Rian, SatIII transcript, SNHG3, SRA, Tmevpg1, TncRNA, TUG1, or another combination thereof.
[0113] In some embodiments, the nuclear-reserved domain sequence may be isolated from or derived from a long non-coding RNA involved in splicing regulation. In some embodiments, the long non-coding RNA includes MIAT, LUST, Malat1, SAF, VL30 RNA, Zeb2NAT, or any combination thereof.
[0114] In some implementations, the nuclear-reserved domain sequence may be directly adjacent to the antisense domain. In some implementations, the nuclear-reserved domain sequence may be directly adjacent to the exon domain.
[0115] In some embodiments, the nuclear-reserved domain may be adjacent to the 5' end of the trans-splicing molecule. In some embodiments, the nuclear-reserved domain is located at the following distances from the 5' end of the trans-splicing molecule: 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, or 38 nucleotides. Acids, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, more than 500 nucleotides, or any number of nucleotides in between.
[0116] In some embodiments, the nuclear-reserved domain may be adjacent to the 3' end of the trans-splicing molecule. In some embodiments, the nuclear-reserved domain is located at the following distances from the 3' end of the trans-splicing molecule: 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, or 38 nucleotides. Acids, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, more than 500 nucleotides, or any number of nucleotides in between.
[0117] In some implementations, the nuclear-reserved domain may be the first nucleotide at the 5' direction from the exon domain or antisense domain: 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides. nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, more than 500 nucleotides, or any number of nucleotides in between.
[0118] In some implementations, the nuclear-reserved domain may be the last nucleotide in the 3' direction from the exon domain or antisense domain: 1 nucleotide, 2 nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides. nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 nucleotides, 49 nucleotides, 50 nucleotides, 55 nucleotides, 60 nucleotides, 65 nucleotides, 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 110 nucleotides, 120 nucleotides, 130 nucleotides, 140 nucleotides, 150 nucleotides, 160 nucleotides, 170 nucleotides, 180 nucleotides, 190 nucleotides, 200 nucleotides, 250 nucleotides, 300 nucleotides, 400 nucleotides, 500 nucleotides, more than 500 nucleotides, or any number of nucleotides in between.
[0119] In some embodiments, the trans-splicing molecule may include a nuclear-reserved domain. In some embodiments, the trans-splicing molecule may include two or more nuclear-reserved domains. In some embodiments, the trans-splicing molecule includes 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 75, 100, 200, 300 or more nuclear-reserved domains.
[0120] Compositions containing the localization sequences disclosed herein may include any sequence that promotes nuclear or subnuclear localization of trans-splicing molecules. Non-limiting examples of localization sequences may include sequences that promote the localization of trans-splicing molecules from the cytoplasm to the nucleus or to specific structures within the nucleus, such as nuclear spots or parasporals. In some embodiments, the localization sequence may also include sequences that promote association of trans-splicing molecules with nuclear localization proteins and protein complexes, such as spliceosomes, transcription proteins, or splicing factors.
[0121] Stabilized domain The compositions provided herein may include one or more stabilizing domains to prevent or mitigate degradation of the nucleic acid molecules and / or trans-splicing molecules provided herein. Nucleic acids may comprise RNA, DNA, DNA / RNA hybrids, and / or may comprise at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. In some embodiments, the RNA molecules provided herein include one or more stabilizing domains to prevent RNA molecule degradation. Nucleic acid molecules containing DNA may encode one or more stabilizing domains. DNA molecules encoding one or more stabilizing domains may be transcribed into RNA molecules containing one or more stabilizing domains (e.g., the stabilizing domain in an RNA trans-splicing molecule may be complementary to the stabilizing domain in a DNA molecule decoding the RNA trans-splicing molecule). Degradation of nucleic acids may be caused by, for example, the activity of exonucleases. Exonucleases may function in a 5' to 3' orientation or a 3' to 5' orientation. In some embodiments, the stabilizing domains protect the 5' end of the nucleic acid molecules and / or trans-splicing molecules provided herein. In some embodiments, the stabilization domain protects the 3' end of the nucleic acid molecule and / or trans-splicing molecule provided herein. In some embodiments, the stabilization domain is located within the 3' domain of the RNA trans-splicing molecule and protects the 3' end of the RNA trans-splicing molecule from degradation.
[0122] In some embodiments, the stabilization domain comprises RNA. In some embodiments, the stabilization domain comprises DNA. In some embodiments, the DNA-containing stabilization domain encodes an RNA-containing stabilization domain. In some embodiments, the DNA molecule is transcribed into messenger RNA.
[0123] In some embodiments of the compositions disclosed herein, the stabilizing domain is derived from flaviviruses. In some implementations, the stabilizing domain is an exonuclease-resistant RNA (“xrRNA”) that blocks 5'-3' exonuclease activity and is derived from or isolated from the genome of a virus selected from the group consisting of: Turnip yellowmosaic virus, Apoi virus, Aroa virus, Bagaza virus, Banzi virus, Bouboui virus, Bukalasa bat virus, Cacipacore virus, Carey Island virus, Dakar bat virus, Cowbone Ridge virus, Dengue virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, and Ilheus virus. The following viruses are listed: Israel-Turkey meningoencephalomyelitis virus, Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kunjin virus, Kedougou virus, Kokobera virus, Koutango virus, Kyasanur forest disease virus, Langat virus, Loupingill virus, Meaban virus, Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, and Omsk hemorrhagic fever virus.Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Saboya virus, Saint Louis encephalitis virus, Sal Vieja virus, San Perlita virus, Saumarez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Uganda S virus, Wesselsbron virus, Usutu virus, West Nile virus, Yaounde virus, Yellow fever virus, Yokose virus Zika virus.
[0124] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or relating to Kunzin virus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from Kunzin virus comprises or is composed of the following sequence: TTAGTGAGGATGTCAGACCACGGCCATGGCGTGCCACTCTGCGGAGAGTGCAGTCTGCGACAGTGCCCCAGGAGGACTGGG (SEQ ID NO: 1). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 1. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 1. The stabilizing domain can be transcribed into an RNA molecule.
[0125] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a cell fusion agent virus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from the cell fusion agent virus comprises or is composed of the following sequence: ACAGGAGCAGGGCATGAAAATGTCGGGCATGACGAACCCGCTCCCCCGAGTCCCCTGGCAACAGGGT (SEQ ID NO: 2). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 2. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO: 2. The stabilizing domain can be transcribed into an RNA molecule.
[0126] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or related to flavivirus tick-borne encephalitis virus. This sequence may contain a DNA sequence. This sequence may contain an RNA sequence. In some embodiments, the sequence from flavivirus tick-borne encephalitis virus comprises or is composed of the following sequence: CACAGATCATGGAATGATGCGGCAGCGCGCGAGAGCAACGGGGAAGTGGTGGCACCCGACGCACCATCCATGAAGCAATACTTCGTGAGACCCCCCCTGACCAGCAAAGGGGGCAGACCGGTCAGGGGTGAGGAATGCCCCCAGAGTGCATTACGGCAGCACGCCAGTGAGAGTGGCGACGGGAAAATGGTCGATCCCGACGTAGGGCACTCTGAAAAATTTTGTGAGACC (SEQ ID NO:3). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:3. In some embodiments, the stabilizing domain contains the sequence encoded by SEQ ID NO:3. The stabilizing domain can be transcribed into an RNA molecule.
[0127] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or related to murine leukemia virus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from murine leukemia virus comprises or is composed of the following sequence: TGGAAAAAATGCGAGTGAGGGCAACTCTGGGATTAGCTCAATGGGTGTGACGACCCTACCCTTCCGCATTTGTAAATAATTGAGCCAGTCATTTCCGTAGGGAAGAGAGTTATTCGCTCCTCTCGAGATTGAGCGGCCTGCTCCTTGGAGCATGAGATGGGAGGCCCGAA (SEQ ID NO 4). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:4. In some embodiments, the stabilizing domain contains the sequence encoded by SEQ ID NO:4. The stabilizing domain can be transcribed into an RNA molecule.
[0128] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number AF346759.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number AF346759.1 comprises or is composed of the following sequence: GAAAGGCAAGGTACGGATTAGCCGTAGGGGCTTGAGAACCCCCCCTCCCCACTCATTTTATTTCCTCTATGAGGAAGG (SEQ ID NO:5). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:5. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:5. The stabilization domain can be transcribed into RNA molecules.
[0129] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or relating to a flavivirus with genomic accession number AF346759.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number AF346759.1 comprises or is composed of the following sequence: TTTGGGCAAGGTGCAGGTTAGCTGCAGGGGCTTGAAAAACCCCCCCCCCCATTCAAGACTTTTAGTGCATTAGTT (SEQ ID NO:6). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:6. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:6. The stabilization domain can be transcribed into RNA molecules.
[0130] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_008604.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_008604.2 comprises or is composed of the following sequence: ACCCCGTAAGGAAGGACAAGGCTGTCCTTGAGTACTAACGACACTCCGGCCCCAGTTCCCAGAGCCAGGGTTTTAGCTCC (SEQ ID NO:7). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:7. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:7. The stabilization domain can be transcribed into RNA molecules.
[0131] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_008604.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_008604.2 comprises or is composed of the following sequence: CGCGCGCAAGGAAGGACATGGCTGTCCTTGGGTACGAACGACACCCCGCCCCCAGTTCTCAAGGTTAGAGTTATAACCTC (SEQ ID NO:8). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:8. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:8. The stabilization domain can be transcribed into RNA molecules.
[0132] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_008604.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_008604.2 comprises or is composed of the following sequence: CCATCGCAAGGGAGGATTTTCCTCGGGTACTGACCATACCCCGACCCCAGTCCGATAGGTCATGGAATGACCCC (SEQ ID NO:9). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:9. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:9. The stabilization domain can be transcribed into RNA molecules.
[0133] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_008604.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_008604.2 comprises or is composed of the following sequence: CTCCCGTAAGGAAAGCGCAAGCTTTGAGCATTGACAACGCTCCGGCCCCAGTCCCCCAGGTTATGGGAGAATAACCC (SEQ ID NO:10). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:10. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:10. The stabilization domain can be transcribed into an RNA molecule.
[0134] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number HE574574.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number HE574574.1 comprises or is composed of the following sequence: CTAGCGCAAGGAAGGAAAGTCGCAGACTACCTTGGGTGTTGACGACACTCCGCCCCCAGTCACCTTGGCCGAAGGTTAAACGGCAT (SEQ ID NO:11). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:11. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:11. The stabilization domain can be transcribed into an RNA molecule.
[0135] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number HE574574.1. This sequence may contain a DNA sequence. The stabilizing domain may contain an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number HE574574.1 comprises or is composed of the following sequence: CCACGCAATGGGAGGCATCATTTCGCCTCCGGGTGCTGACTACTCCCCGTCCCCGTCCCTAGGTCAAGTGAATGACCCCGTGATGTTGTGATGACATCATACCAGGCTTGGCATCCTGGCAACTGCCACCCGCAAGGGGAGGGTTTTCTAACTCTCCGGGTGTTGACGACACCCCGGCCCCAGTCCCCAAGGTCTTGGGAAAAAGACCCCGAAGTGTTGCAAGGACACTAATCACCGAAAGGTGAGGGCGCACAGGATC (SEQ ID NO:12). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:12. The stabilizing domain can be transcribed into an RNA molecule.
[0136] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number HE574574.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number HE574574.1 comprises or is composed of the following sequence: CACCCGCAAGGGGAGGGTTTTCTAACTCTCCGGGTGTTGACGACACCCCGGCCCCAGTCCCCAAGGTCTTGGGAAAAAGACCCC (SEQ ID NO:13). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:13. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:13. The stabilization domain can be transcribed into an RNA molecule.
[0137] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_012671.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_012671.1 comprises or is composed of the following sequence: TCAGCGCAAGGAAGGGAAGCTTGAGGCTACCTTAGGTGGTGACGACACCTCGCCCCCAGTCTCCCGGGTTGGGGATAATACAACCTC (SEQ ID NO: 14). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 14. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:14. The stabilization domain can be transcribed into an RNA molecule.
[0138] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_012671.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_012671.1 comprises or is composed of the following sequence: CCCCCGCAAGGAGGGGTGTGTGTTTCACGCCCCTGGGAGTTAACGATTCTCCGGCCCCAGTTCCTAGGTCCAGGGAGGGCCCC (SEQ ID NO:15). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:15. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:15. The stabilization domain can be transcribed into an RNA molecule.
[0139] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_012671.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_012671.1 comprises or is composed of the following sequence: CCCGCGCAAGGAAGGACACGTAAATCACGTGTTCTTGGGAGTTGACGACTCTCCGCCCCCAGTCCCCAGGTCAGGGTATGACTCC (SEQ ID NO:16). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:16. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:16. The stabilization domain can be transcribed into an RNA molecule.
[0140] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_012671.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_012671.1 comprises or is composed of the following sequence: CCACCGCAAGGGAGAGGGATCCCCTCTCGGGTTTGGACGACACCCCGGCCCCAGTCCCCCAGGTCATGGGAAAAACTGACCCC (SEQ ID NO:17). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:17. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:17. The stabilization domain can be transcribed into an RNA molecule.
[0141] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_021069.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_021069.1 comprises or is composed of the following sequence: TCAGCGCAAGGAAGGAAAGCTGGACGCTACCTTAGGTGGTGACGACACCTCGCCCCCAGTCTCCCAGGTTGGGGATCGTACAACTTC (SEQ ID NO: 18). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 18. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:18. The stabilization domain can be transcribed into an RNA molecule.
[0142] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_021069.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_021069.1 comprises or is composed of the following sequence: CCCCCGCAAGGAGGGACGTGTGCATCACGTTTCTGGGAGTTAACGGCTCTCCGGCCCCAGTTCCTAGGTCCAGGTAGGATCCC (SEQ ID NO:19). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:19. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:19. The stabilization domain can be transcribed into an RNA molecule.
[0143] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_021069.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_021069.1 comprises or is composed of the following sequence: CCCGCGCAAGGAAGGATGCGATGAAAACGCTTGTCCTTGGGAGTTGACGACTCTCCGCCCCCAGTCCCCAGGTCAGGGTATGACCCC (SEQ ID NO:20). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:20. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:20. The stabilization domain can be transcribed into an RNA molecule.
[0144] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_021069.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_021069.1 comprises or is composed of the following sequence: CCACCGCAAGGGAGAGGGATTCCCTCTCGGGTGTGGACGACACCCCGGCCCCAGTCCCCTAGGTCATGGGAAAAACTGACCCC (SEQ ID NO:21). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:21. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:21. The stabilization domain can be transcribed into an RNA molecule.
[0145] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KX652378.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KX652378.1 comprises or is composed of the following sequence: CTAGCGCAAGGAAGGAAAGTCGCAGACTACCTTGGGTGTTGACGACACTCCGCCCCCAGTCACCTTGGCCAAAGGTTAAATGGCAT (SEQ ID NO:22). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:22. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:22. The stabilization domain can be transcribed into an RNA molecule.
[0146] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KX652378.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KX652378.1 comprises or is composed of the following sequence: CCCACGCAAGGGGAGGCATCATATTGCCTCCGGGTGCTGACGACACCCCGTCCCCAGTCCCTAGGTCAAGTGAATGACCCC (SEQ ID NO:23). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:23. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:23. The stabilization domain can be transcribed into an RNA molecule.
[0147] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KX652378.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KX652378.1 comprises or is composed of the following sequence: CACCCGCAAGGGGGGAGTTTTCTAACTCCCCGGGTGTTGACGACACCCCGGCCCCAGTCCCCAAGGTCTTGGGAAAAAGACCCC (SEQ ID NO:24). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:24. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:24. The stabilization domain can be transcribed into an RNA molecule.
[0148] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_001564.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_001564.2 comprises or is composed of the following sequence: ACAGGAGCAGGGCATGAAAATGTCGGGCATGACGAACCCGCTCCCCCGAGTCCCCTGGCAACAGGGTGTGTTCC (SEQ ID NO:25). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:25. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:25. The stabilization domain can be transcribed into an RNA molecule.
[0149] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_001564.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_001564.2 comprises or is composed of the following sequence: TTCGAGCAGGGCACATTAGTGTCGGGCGTGACGCACCCGCTCCCCTCAGTCCCCTGTGCAACAGGGAGGGCACTT (SEQ ID NO:26). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:26. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:26. The stabilization domain can be transcribed into an RNA molecule.
[0150] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_001564.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_001564.2 comprises or is composed of the following sequence: ACGGGGCAACAGGGAGAAATCCCGGGGTAGCGAACCTCCTCCGTTAATGTGAAAAAGTATGGGGAAAGAACTCATCT (SEQ ID NO:27). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:27. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:27. The stabilization domain can be transcribed into an RNA molecule.
[0151] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_012932.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_012932.1 comprises or is composed of the following sequence: TCAGAGCAGGGCACAATAGTGTCGGGCCTGACGACCCCGCTCCCCCGAGTCGCCCAACGGAGTTTGGCTCAACTCTAA (SEQ ID NO:28). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:28. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:28. The stabilization domain can be transcribed into an RNA molecule.
[0152] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_012932.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_012932.1 comprises or is composed of the following sequence: GCAGCGCAGGGCATGAAAATGTCGGGCCTGACGAACCCGCGCACCCGAGTCCCCCAGTTGGGGAAGGGATCCTTGCAT (SEQ ID NO:29). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:29. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:29. The stabilization domain can be transcribed into an RNA molecule.
[0153] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_012932.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_012932.1 comprises or is composed of the following sequence: GCGGAGCAACAGGGAGAAATCCCGGGGAATTGCGAACCCCCTCCGAAATGTGAAAAATTATGGGGAAAAGTACCCATCT (SEQ ID NO:30). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:30. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:30. The stabilization domain can be transcribed into an RNA molecule.
[0154] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KJ741266.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KJ741266.1 comprises or is composed of the following sequence: GAGCAGGGCACAACAGTGTCGGGCCTGACGACCCCGCTCCCCCGAGTCACCAACTGGAGTTTGGCTCAACTCCAA (SEQ ID NO:31). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:31. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:31. The stabilization domain can be transcribed into RNA molecules.
[0155] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_031327.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_031327.1 comprises or is composed of the following sequence: GGAAGGCAACACACCAGTAATCTGGTGGGGTGAGTTGCGACACCCCCTTGTGAGCAACCGACCTAGCCGGTCTATTGACCGGCTTG (SEQ ID NO:32). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:32. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:32. The stabilization domain can be transcribed into an RNA molecule.
[0156] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_024299.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_024299.2 comprises or is composed of the following sequence: ACAGGGCAACAGGGATCGCCAACATCAGATCCCGGGTGAGTGACGACACCCCCCATGTGAATCGTCAACTTAGGAACACATTCAAATAGAGGA (SEQ ID NO:33). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:33. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:33. The stabilization domain can be transcribed into an RNA molecule.
[0157] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_024299.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_024299.2 comprises or is composed of the following sequence: ACAGGGCAACAGGGATCACCAACATCAGATCCCGGGTGAGTGACGACACCCCCCATGTGAATCGTCGATACAAAAACACGATAGG (SEQ ID NO:34). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:34. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:34. The stabilization domain can be transcribed into an RNA molecule.
[0158] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_024299.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_024299.2 comprises or is composed of the following sequence: ACACCGCAAGGAAGAGAAATCTTGGGTGGTAACAACACCCCGGCCCCAGTTCTCGCGTGCCACGAGTCATTGGCACAA (SEQ ID NO:35). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:35. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:35. The stabilization domain can be transcribed into an RNA molecule.
[0159] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_024299.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_024299.2 comprises or is composed of the following sequence: AAACCGCAAGGAAGGAGCAATCCTTGGGTATTAACGACACCCCGGCCCCAGTTCCCGAAGTCAAGGGGACCCTTGACCC (SEQ ID NO:36). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:36. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:36. The stabilization domain can be transcribed into an RNA molecule.
[0160] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_034242.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_034242.1 comprises or is composed of the following sequence: CATTGCAGCAGAGATTTATCTCGGGGGAGTTACGCCCCTCCATTGCCAGTAGAGTTTGCATGTCTCTATAAACATGACGTT (SEQ ID NO:37). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:37. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:37. The stabilization domain can be transcribed into an RNA molecule.
[0161] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_027817.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_027817.1 comprises or is composed of the following sequence: CCATTGCCAGTAGAGTTTGCATGTCTCTATAAACATGACGTTCTGACTGACTA (SEQ ID NO:102). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:102. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:102. The stabilization domain can be transcribed into RNA molecules.
[0162] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_027817.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_027817.1 comprises or is composed of the following sequence: AATATTGGCAGCAGAGCTTGTCTCGGGGATTCACGCTCCCCCCATTGTGAGTGTGTCGAACTGGTTTCGAAGGACGTCTAGAA (SEQ ID NO:38). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:38. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:38. The stabilization domain can be transcribed into an RNA molecule.
[0163] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_027817.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_027817.1 comprises or is composed of the following sequence: ATCCGGCAACAGAGAGTTTATGTCTCGGGGCCTCACGCACCCCCCGTTGTGAGTGAAGTCCTTTCTGGCCATTTAGTGGTCAGGAAGGG (SEQ ID NO:39). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:39. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:39. The stabilization domain can be transcribed into an RNA molecule.
[0164] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_027817.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_027817.1 comprises or is composed of the following sequence: GCAGGGCAACAAAGTTCTAACGAACTAGGGTGAGTAGCGTCACCCCCCGGTTGTGAAAACGATTGCGACTAGAACTAAAGTCGAGAGTCTC (SEQ ID NO:40). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:40. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:40. The stabilization domain can be transcribed into an RNA molecule.
[0165] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_005064.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_005064.1 comprises or is composed of the following sequence: TTAGAGCAGGGCACGAAAGTGTCGGGCATGACGCACCCGCTCCCCCGAGTCCCCTGAAAATAGGGTGGGCAATGCACTCCT (SEQ ID NO:41). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:41. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:41. The stabilization domain can be transcribed into an RNA molecule.
[0166] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_005064.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_005064.1 comprises or is composed of the following sequence: TTTGAGCAGGGCACGAAAGTGTCGGGCCTGACGCACCCGCTCCCCCGAGTCCCCTGGAAACAGGGTGGGCCTCGAAAAATCCACCGT (SEQ ID NO:42). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:42. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:42. The stabilization domain can be transcribed into an RNA molecule.
[0167] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_027819.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_027819.1 comprises or is composed of the following sequence: GCAGGGCAACAGGAAGAAATTCCGGGTGATTAGCCACACCCCCCGAAACGTGATTTATATGATGACAAGAATCAGA (SEQ ID NO:43). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:43. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:43. The stabilization domain can be transcribed into RNA molecules.
[0168] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_034017.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_034017.1 comprises or is composed of the following sequence: TGGGGGCAGCCGGGGGAAACCCTGGGGCTTGGCGACCTCCCCCCACAAGCCATCATGCGAAATTAAGGCAGCCGCGAG (SEQ ID NO:44). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:44. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:44. The stabilization domain can be transcribed into an RNA molecule.
[0169] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_034204.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_034204.1 comprises or is composed of the following sequence: TGGGGGCAGCCGGGAGTCAAACTCCCGGGGCCTGGCGACCCCCCCCTTCCGCCTCCAAAAATTAAGGCAGCCCCGAGGGAGCTCTCCTCGGTGTGA (SEQ ID NO:45). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:45. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:45. The stabilization domain can be transcribed into an RNA molecule.
[0170] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_020902.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_020902.1 comprises or is composed of the following sequence: CAAGGGCAGGTTGAAAGGGGCTTGGCGACCCCCCCCTAACCAGCCACGCGCACTGTGCGTGCGC (SEQ ID NO:46). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:46. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:46. The stabilization domain can be transcribed into RNA molecules.
[0171] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_020902.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_020902.1 comprises or is composed of the following sequence: CCGGGGCAGGTTGAAAGGGGTTTCACGCACCCCCCCCTACCAGTGCCGTCGTTGGTAACGCG (SEQ ID NO:47). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:47. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:47. The stabilization domain can be transcribed into RNA molecules.
[0172] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number MF438044.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number MF438044.1 comprises or is composed of the following sequence: CAAGGGCAGGTTGAAAGGGGCTTGGCGACCCCCCCCTAACTAGCCACGCGCACTGATGTGCGCGG (SEQ ID NO:48). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:48. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:48. The stabilization domain can be transcribed into RNA molecules.
[0173] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number MF438044.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number MF438044.1 comprises or is composed of the following sequence: CCGGGGCAGGTTGAAAGGGGCATCACGCACCCCCCCCTACCAGTGCCGTCGTTGGTAACGCG (SEQ ID NO:49). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:49. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:49. The stabilization domain can be transcribed into RNA molecules.
[0174] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number AF070476.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number AF070476.1 comprises or is composed of the following sequence: ACGGGCAAGGAGCGCAAGCTGGGGCTTTCCGACCCCCCCCCCCAGGACGATTCCCCGCTTGGTAAAAAGGGCCAGGCCA (SEQ ID NO:50). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:50. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:50. The stabilization domain can be transcribed into an RNA molecule.
[0175] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_001837.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_001837.1 comprises or is composed of the following sequence: CTCCAGGCAGCAGCAGACGCAAGTCTGGGGGAAACGATCGCTCCTCCCTCTGCAGATCTCTAGCTCGGATAGAGCGG (SEQ ID NO:51). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:51. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:51. The stabilization domain can be transcribed into an RNA molecule.
[0176] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KF234530.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KF234530.1 comprises or is composed of the following sequence: AGTTGGCAAGGGGCCTGCTAACACAGGCCGGGGCTTCCTGACCCCCCCACCCCAAGGCTGTTCCCCGCTCGGTAAAAAGGGCCGGGCCA (SEQ ID NO:52). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:52. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:52. The stabilization domain can be transcribed into an RNA molecule.
[0177] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KT166442.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KT166442.1 comprises or is composed of the following sequence: ATGAGGCAAGGAGCCTGCTAACACAGGCTGGGGCTTCCTGACCCCCCCTCCCCAAGGCGGTTCCCCGCTCGGTAAAAAGGGCCGGG (SEQ ID NO:53). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:53. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:53. The stabilization domain can be transcribed into an RNA molecule.
[0178] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_024377.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_024377.1 comprises or is composed of the following sequence: GTGAGGGCAAGGAGACATTCCAGGAATGTCTGGGGCTTTCCGACCCCCCCTCCCCAGGACGGTTCCCCGCTGAGTAAAAAGGGCT (SEQ ID NO:54). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:54. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:54. The stabilization domain can be transcribed into an RNA molecule.
[0179] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KF234529.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KF234529.1 comprises or is composed of the following sequence: AATTGTGGCAAGGGGCCTGTCCAAGACAGGCCGGGGCTTTCCGACCCCCCACCCCCAGGACGGTTCCCCGCTCGGTAAAAAGGGCCGGGCTA (SEQ ID NO:55). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:55. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:55. The stabilization domain can be transcribed into an RNA molecule.
[0180] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number AB008335.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number AB008335.1 comprises or is composed of the following sequence: TTGCGGCAAGGTCGGCCGACTGATCATCGGCTGAGGAGGTTCCCGCCCTCCCCGCCCCAGGGGTCTCCCCGCTGGGTAAAAAGGGCCCGGCCT (SEQ ID NO:56). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:56. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:56. The stabilization domain can be transcribed into an RNA molecule.
[0181] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_001710.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_001710.1 comprises or is composed of the following sequence: TTGCGGCAAGGTCTGGTGACTGATCATCACCGGAGGAGGTTCCCGCCCTCCCCGCCCCAGGGGTCTCCCCGCTGGGTAAAAAGGGCCCGGCCT (SEQ ID NO:57). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:57. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:57. The stabilization domain can be transcribed into an RNA molecule.
[0182] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number AB018667.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number AB018667.1 comprises or is composed of the following sequence: TTGCGGCAAGGTCGGGCGACTGATCATCGCCTGAGGAGGTTCCCGCCCTCCCCGCCCCAGGGGTCTCCCCGCTGGGTAAAAAGGGCCCGGCCT (SEQ ID NO:58). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:58. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:58. The stabilization domain can be transcribed into an RNA molecule.
[0183] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_027998.2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_027998.2 comprises or is composed of the following sequence: AGGCAGGAGGTGAAGTCAGCTGTACCCACGGCTGGCTGAAACCGGGGCTTGACGACCCCCCCTATCCGAGTTGGGCAAGGTAACATCACGGGTGTGACGACCCC (SEQ ID NO:59). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:59. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:59. The stabilizing domain can be transcribed into an RNA molecule. In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genome accession number KC796093.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genome accession number KC796093.1 comprises or is composed of the following sequence: TTCCGGCAAGGTGCGCCGGGGGGGCCTTCACGGGCCCTTCTAGCGCAGGGGTTTGAGACACCCCCCGCCCCACTCCTTCCCAGGGTTGGCAACCTGGGTC (SEQ ID NO:60). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:60. The stabilizing domain can be transcribed into an RNA molecule.
[0184] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KC796084.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KC796084.1 comprises or is composed of the following sequence: GTAAGGCAAGGTGTGCACTGGCAGCCTTAACGGGCTGTTGGGGCGCAGGGGCTTGAGCACCCCCCTTCCCCACTCCCAGCGGGGCTTGGCAACCCTG (SEQ ID NO: 61). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 61. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:61. The stabilization domain can be transcribed into an RNA molecule.
[0185] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KC796084.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KC796084.1 comprises or is composed of the following sequence: GTTAGCAAGGCGCTGTCATGGTGCTTCTAACGAGGCATGAGGCAGCGGGGGCGTGAGAACCCCCCTTCCCCACTCCGGCGTGTAGATTGGCAATCTTGCGCT (SEQ ID NO: 62). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 62. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:62. The stabilization domain can be transcribed into an RNA molecule.
[0186] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or relating to a flavivirus with genomic accession number KC796084.1. This sequence may contain a DNA sequence. This sequence may contain an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KC796084.1 comprises or is composed of the following sequence: ACTTGGCAAGGCACCCCCTGGCTAGTGGCTGCACTTAACTGAGTGGCCGGCTAGTCGGTGGGTGGGGGCACGTGACTCCCCCTTCCCCACACCGGCGGCGGCCGTAAAACGCCCC (SEQ ID NO:63). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:63. In some embodiments, the stabilizing domain contains the sequence encoded by SEQ ID NO:63. The stabilizing domain can be transcribed into an RNA molecule.
[0187] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_038435.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_038435.1 comprises or is composed of the following sequence: TCCTGGCAAGGGCTACTCTGAAAGCTGCTAACGTGGTGATCGGCGTAGCGGGGCGTGAGGAACCCCCCACCCCACTCCTGGGTCAGCTTGGTAACTGGCCCA (SEQ ID NO:64). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:64. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:64. The stabilization domain can be transcribed into an RNA molecule.
[0188] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_038434.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_038434.1 comprises or is composed of the following sequence: GCGGGCAGAGACTGGGCCTCGCTGGCGCGTGAGCTCCTGTGGGATCCGGCCTGTTCCATGCCACCTGTTCTCGATCAGGGGGAGGGGATCTTACCCCCTGAACTGT (SEQ ID NO:65). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:65. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:65. The stabilization domain can be transcribed into an RNA molecule.
[0189] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KC796079.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KC796079.1 comprises or is composed of the following sequence: GTAAGGCAAGGTGTGCACTGGCAGCCTTAACGGGCTGTTGGGACACAGGGGCTTGAGCACCCCCCTTCCCCACTCCCAGCGGGGCTTGGCAACCCCCC (SEQ ID NO: 66). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 66. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:66. The stabilization domain can be transcribed into an RNA molecule.
[0190] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_021154.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_021154.1 comprises or is composed of the following sequence: TTGGGGCAGGCACGCTTGCGTGGGGGAGTTGCGCCCCCCCCCAGCCAGCACTCGTCATGATGTGTCGGATGCCAGTGATAGGCAGCCTC (SEQ ID NO: 67). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 67. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:67. The stabilization domain can be transcribed into an RNA molecule.
[0191] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_038433.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_038433.1 comprises or is composed of the following sequence: GCCCGGCAAGGTTAACAGGGGGAGTAGTGCCCCCCCCGCCCCAACTCGGGTAGCGCGTACGCTC (SEQ ID NO:68). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:68. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:68. The stabilization domain can be transcribed into RNA molecules.
[0192] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_038433.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_038433.1 comprises or is composed of the following sequence: TCCAAGGCAACAGGCTTCGGCCGGGGGAGTAGCGCCCCCCCCTTTGTGAGCTCGTAACCCCCTTTTGGGGCT (SEQ ID NO:69). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:69. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:69. The stabilization domain can be transcribed into RNA molecules.
[0193] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_030291.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_030291.1 comprises or is composed of the following sequence: ACATGGCAAGGGTGCTTCGGCATGGGGGAGTAGCGTCCCTCCCACCCCAGCGAGGCTGCAAGCCTAT (SEQ ID NO:70). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:70. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:70. The stabilization domain can be transcribed into RNA molecules.
[0194] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number HM047196.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number HM047196.1 comprises or is composed of the following sequence: ACCTGGCAACAGCCCCGTCGGGGCGGGGGAGTAGCGCCCCCCCCAGTGTGAGCGAGGTGGGAAACCACCTA (SEQ ID NO:71). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:71. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:71. The stabilization domain can be transcribed into RNA molecules.
[0195] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_038437.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_038437.1 comprises or is composed of the following sequence: CAAGGGCAAGGTGTCTTGCGAGACAGGGGCTTAACGCACCCCCCCCCCCAGTGAGGGGGGCTGATCCCCCA (SEQ ID NO:72). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:72. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:72. The stabilization domain can be transcribed into an RNA molecule.
[0196] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_021154.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_021154.1 comprises or is composed of the following sequence: ACCGGGCAAGGGCTCACGCGGAGTGTGACAAGCTCCCCCCCCCAGTCCATGGCCGTGGATCGGCTC (SEQ ID NO:73). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:73. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:73. The stabilization domain can be transcribed into RNA molecules.
[0197] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number NC_025677.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_025677.1 comprises or is composed of the following sequence: GAATAGGCAGGGAGGAGTCCAAGAACCGTCTCGGGGACTCTTTGGGGCTTGACGAACCCCCCTACCCGAGTCTATATTCAGTGGCTGGAACC (SEQ ID NO:74). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:74. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:74. The stabilization domain can be transcribed into an RNA molecule.
[0198] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KY370101.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KY370101.1 comprises or is composed of the following sequence: AAAGGCAGGGAGAGGCTTAAGAACCGTCTCGGGAGCCTCTTGGGGCTTGACGAACCCCCCAACCCGAGTCAAGTCCTTCAACAGTACCGTTTCGAG (SEQ ID NO: 75). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 75. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:75. The stabilization domain can be transcribed into an RNA molecule.
[0199] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_038964.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_038964.1 comprises or is composed of the following sequence: TGAAAGGGGCAAGTGGCCGTATAGGCTGGGGCGATCGCCGTACCCCCCCTTTACCAGGCGCCTCAACCCCATGTACCATGGGGTT (SEQ ID NO:76). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:76. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:76. The stabilization domain can be transcribed into an RNA molecule.
[0200] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KY370100.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KY370100.1 comprises or is composed of the following sequence: ACACGGCAAGGTGCTAGAAGCTGAAACCGACTCGGAGCTCTAGCAGGGGGACTGGCGACCCTCCCGCCCCAGCTGGCCTCTGGCAGAAACGACTCGTGCCATT (SEQ ID NO:77). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:77. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:77. The stabilization domain can be transcribed into an RNA molecule.
[0201] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number MH282908.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number MH282908.1 comprises or is composed of the following sequence: AAGAGGCAAGGGGAGGCAGCTAGCCTCCGGGGCCTGACGACCCCCCTTCCCCAGTCATTGAAGGCAAGGGGCTGC (SEQ ID NO:78). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:78. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:78. The stabilization domain can be transcribed into an RNA molecule.
[0202] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number MH282908.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number MH282908.1 comprises or is composed of the following sequence: AAAGGGCAAGGCACCACACGGCTAGTGTGGTGAGGGATTGACAACCCCTCCTCCCCAGTCGGCATGAACTT (SEQ ID NO:79). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:79. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:79. The stabilization domain can be transcribed into RNA molecules.
[0203] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number MH282908.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number MH282908.1 comprises or is composed of the following sequence: AAAGGGCAAGGCACCACATGGAAATGTGGTGAGGGTTTGACCTCCCCTCCCCCCCAGTCAACCATACATAAAACTTGAAAAACACATATTGGTACT (SEQ ID NO: 80). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 80. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:80. The stabilization domain can be transcribed into an RNA molecule.
[0204] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or relating to a flavivirus with genomic accession number NC_001655.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_001655.1 comprises or is composed of the following sequence: CAGCGGCAACAGGGGAGACCCCGGGCTTAACGACCCCGCCGATGTGAGTTTGGCGACCATGGTGGATCAG (SEQ ID NO:81). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:81. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:81. The stabilization domain can be transcribed into RNA molecules.
[0205] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_031950.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_031950.1 comprises or is composed of the following sequence: CAATGGCAACAGCACTCTCTTAGGTGCGGGGTATGGCGAACCCCCCAATGTGAGCTCCTCCCCGGATGGGGCG (SEQ ID NO:82). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:82. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:82. The stabilization domain can be transcribed into an RNA molecule.
[0206] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_038430.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_038430.1 comprises or is composed of the following sequence: TTCGGGCAAGGCATGCGAGATAAAAAGGGTCTCGTATGAGGGCGTGGCAACCCCTCCCCCCCAGCTGCGGCGGCACAAAAGCGTCTCGCGTGTCGTC (SEQ ID NO: 83). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 83. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:83. The stabilization domain can be transcribed into an RNA molecule.
[0207] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_040815.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_040815.1 comprises or is composed of the following sequence: TAGCGGCAGGGAGCAGGGTAGACCAACCTGCAGGGGCTTGACGACCCCCCCGTCCCGAGTCAGCCAGGAGGCAGAAGCGACTCGC (SEQ ID NO:84). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:84. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:84. The stabilization domain can be transcribed into an RNA molecule.
[0208] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or consisting of a flavivirus with genomic accession number KY370094.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KY370094.1 comprises or is composed of the following sequence: TGAGGGCAGGATAGGCCAAGAATCGTCTCGAGGCTGATTGGGGCTTCACGCACCCCCCCATCCGAGTGCCTCTCATCTTCCAAAACCGTCTCGGGGGAGATGAGAC (SEQ ID NO: 85). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 85. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:85. The stabilization domain can be transcribed into an RNA molecule.
[0209] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KX905133.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KX905133.1 comprises or is composed of the following sequence: AAAGGGCAGCGGTGCCGGACGGCATTGGGGCTTGGCGACCCCCCCCACGCGAGCTACCCACCATTGGTGGGTTC (SEQ ID NO:86). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:86. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:86. The stabilization domain can be transcribed into an RNA molecule.
[0210] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_021153.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_021153.1 comprises or is composed of the following sequence: CAGGGGCAGAGGCCGGTTGATTATCATTGCAGCCGTAGGGGCTTGGCGACCCCCCCCCCTCGAGCCAGCCTTTCAACAAAACCGTCTCGGGTTGGAAGG (SEQ ID NO:87). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:87. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:87. The stabilization domain can be transcribed into an RNA molecule.
[0211] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number NC_038428.1. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number NC_038428.1 comprises or is composed of the following sequence: ACACTGCAACAGGGGAAACCCGGGGATTTCCGATCCCCCAGATGTGAGGAGGCTGGTTGCCTAACAACCTG (SEQ ID NO:88). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:88. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:88. The stabilization domain can be transcribed into RNA molecules.
[0212] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number KJ412989. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number KJ412989 comprises or is composed of the following sequence: CTCCCGTAAGGAAAGCGCAAGCTTTGAGCATTGACAACGCTCCGGCCCCAGTCCCCCAGGTTATGGAGGAATAACCC (SEQ ID NO:89). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:89. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:89. The stabilization domain can be transcribed into RNA molecules.
[0213] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or derived from a flavivirus with genomic accession number MN242370. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number MN242370 comprises or is composed of the following sequence: AAGGGGCAGGATATGGACAGAACCGTCTCGGGTCCAGAAGGGGCTTGGCGACCCCCCCCATCCGAGCCACCCCTCTAGGAAGACCGTCTCGGCCTAGAGG (SEQ ID NO: 90). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 90. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO:90. The stabilization domain can be transcribed into an RNA molecule.
[0214] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or related to a flavivirus with genomic accession number MH824541. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence of this flavivirus with genomic accession number MH824541 comprises or is composed of the following sequence: AAGGGGCAGCCATGCCGCAGAACCGTCTCGGGCGGCAAGGGGCTTAGCGACCCCCCCCTGGCGAGCTGTATGAGTGTGATAAGGGCGACATAGC (SEQ ID NO: 91). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 91. In some implementations, the stabilization domain contains a sequence encoded by SEQ ID NO: 91. The stabilization domain can be transcribed into an RNA molecule.
[0215] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 5' to 3' direction comprises or is composed of a sequence from or related to Tamana bat virus (AF346759.1). This sequence may contain a DNA sequence. This sequence may contain an RNA sequence. In some embodiments, the sequence from Tamana bat virus comprises or is composed of the following sequence: AF346759.1, positions: 10305-10380: TTTGGGCAAGGTGCAGGTTAGCTGCAGGGGCTTGAAAAACCCCCCCCCCCATTCAAGACTTTTAGTGCATTAGTT (SEQ ID NO: 6). The stabilizing domain can be transcribed into an RNA molecule.
[0216] In some implementations, the stabilizing domain inhibits or attenuates the activity of exonucleases that act on RNA in the 3' to 5' direction. In some cases, the inhibition or attenuation of exonuclease activity increases the effectiveness of trans-splicing molecules.
[0217] In some embodiments of the compositions disclosed herein, the stabilizing domains form a tertiary structure. In some embodiments of the compositions disclosed herein, the tertiary structure is a triple chain.
[0218] In some implementations, the stabilizing domain forms an RNA triplet that blocks the activity of 3'-5' exonucleases, and is derived from or isolated from vertebrate genes or microbial genomes selected from the group consisting of: MALAT1 [ENSG00000251562], NEAT1 [ENSG00000245532], turnip yellow mosaic virus genome, Kaposi's sarcoma-associated herpesvirus genome, TER telomerase-associated RNA [ENSG00000270141], and SAM-II bacterial riboswitch.
[0219] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence from the MALAT1 gene. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from the MALAT1 gene comprises or is composed of the following sequence: AAGCTGATCTCCAATGCTCTTCAGTAGGGTCATGAAGGTTTTTCTTTTCCTGAGAAAACAACACGTATTGTTTTCTCAGGTTTTGCTTTTTGGCCTTTTTCTAGCTTAAAAAAAAAAAAAAAAGCAAAAGATGCTGGTGGTTGGCACTCCTGGTTTCCAGGACGGGGTTCAAAT (SEQ ID NO:92). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 92. This sequence can be transcribed into an RNA molecule.
[0220] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence from or related to rhesus rhadinovirus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from rhesus rhadinovirus comprises or is composed of the following sequence: CGTTTGTGTTGGTTTTTATGACCAGCTTGGTACAAAACCTGCTGGTGATTTTTTACCCAACAAATATTA (SEQ ID NO: 93). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 93. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 93. The stabilizing domain can be transcribed into an RNA molecule.
[0221] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence from or consisting of equine herpesvirus type 2. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from equine herpesvirus type 2 comprises or is composed of the following sequence: AAGAATATTTTTAAAGACTTTTTTCCCCAACCTCTGGGTTGGGTTTTTTCTCTTTAAAATATTCAATA (SEQ ID NO: 94). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 94. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 94. The stabilizing domain can be transcribed into an RNA molecule.
[0222] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence from or related to Kaposi's sarcoma-associated herpesvirus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from Kaposi's sarcoma-associated herpesvirus comprises or is composed of the following sequence: TGTTTTGTGTTTTGGCTGGGTTTTTCCTTGTTCGCACCGGACACCTCCAGTGACCAGACGGCAAGGTTTTTATCCCAGTGTATATT (SEQ ID NO:95). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:95. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO:95. The stabilization domain can be transcribed into RNA molecules.
[0223] In some implementations, the stabilizing domains protecting trans-splicing molecules from exonucleases acting in the 3' to 5' direction include those derived from the stink bug *P. stink bug*. (Plautia stali) The sequence may be an enterovirus or comprised of such a sequence. The sequence may contain a DNA sequence. The sequence may contain an RNA sequence. In some embodiments, the sequence from *Periplaneta stearensis* enterovirus comprises or comprises the following sequence: ATTGGCAGTAGAGTTTTTCCCCAGGGAGCTTCACTGTCTGGGTTTTCTCTACT (SEQ ID NO: 96). In some embodiments, the stabilizing domain comprises at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO: 96. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO: 96. The stabilizing domain can be transcribed into an RNA molecule.
[0224] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence from or related to Cotesia congregata bracovirus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from Cotesia congregata bracovirus comprises or is composed of the following sequence: TTCATCAAGGAGGTTTTTTCCCAGCCTAGCTGGGTTTTCCTCCTTTGGGGACA (SEQ ID NO:97). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:97. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO:97. The stabilizing domain can be transcribed into an RNA molecule.
[0225] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence from or related to the Cotsia sesamiae bracovirus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from the Cotsia sesamiae bracovirus comprises or is composed of the following sequence: TTTTTTCGAGGAGGTTTTTTCCTAGCACCACTAGGTTTTCCTCCTCTGGGAAC (SEQ ID NO:98). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:98. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO:98. The stabilizing domain can be transcribed into an RNA molecule.
[0226] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence from or relating to Acanthamoeba polyphagamimivirus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from Acanthamoeba polyphagamimivirus comprises or is composed of the following sequence: ATTTACTGTTGGTTTTCTTCTCTGATTTTCATAAGAACTTTTCCCAACA (SEQ ID NO:99). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:99. In some embodiments, the stabilizing domain comprises the sequence encoded by SEQ ID NO:99. The stabilizing domain can be transcribed into an RNA molecule.
[0227] In some embodiments, the stabilizing domains form a tertiary structure. In some embodiments of the compositions disclosed herein, the tertiary structure is a pseudo-junction.
[0228] In some implementations, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a pseudoknot-forming sequence derived from or isolated from a list consisting of: group 1 self-splicing introns from *Vibrio azoosporus*, *Tetrahymena*, or *Twort*, *Drosophila sytl* precursor mRNA, human CPEB3 ribozyme, *Escherichia coli* RydC gene, prokaryotic plasmid I complex or IncL / M or ColIB / P9, *Mycobacterium bovis* leuA mRNA, GlmS ribosomalase, *Agrobacterium tumefaciens* metA gene, L- and c-myc genes, human interferon γ mRNA, ornithine decarboxylase inhibitor, prion mRNA (human, bovine, yeast), human and *Tetrahymena* telomerase, 16S rRNA, 16S rRNA, 18S V4 region, 23S rRNA, and M1 of bacterial RNase P. RNA components, Neurospora VS ribozymes, pyrimidine nucleotide synthase ribozymes, alcohol dehydrogenase ribozymes (1-ribox02), ribozymes, aptamers, foot-and-mouth disease virus genome, Mengovirus genome, paraechovirus 1 genome, Aichivirus genome, hepatoviridae genome, HCV, classical swine fever virus genome, bovine viral diarrhea virus genome, swine jabsin virus, cricket paralysis virus-like virus genome, Giardia lamblia virus genome, tobacco erosion virus genome, retroviridae genome, nesting virus order genome, holoviridae genome, flaviviridae genome, myoviridae genome, Listeria monocytogenes phage genome. Genomes of various viruses and viruses, including murine leukosis virus, hepatitis C virus, influenza A and B virus, turnip yellow mosaic virus, tobacco mosaic virus-like virus, bamboo mosaic virus, strawberry chlorotic spot-associated virus; potato yellow vein virus, tomato dwarf virus, turnip shrunken virus, encephalomyocarditis virus, enterovirus, dengue virus, yellow fever virus, Japanese encephalitis virus, tick-borne encephalitis virus, cauliflower mosaic virus, barley yellow dwarf virus, bacteriophage Qβ, avian leukosis virus, peach latent mosaic virus, large potato spindle tuber viroidae genome, turnip shrunken virus genome (Sat C satellite RNA), hepatitis D virus, and Marek's disease virus genome.
[0229] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence forming a pseudoknot from murine leukemia virus. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from murine leukemia virus comprises or is composed of the following sequence: GGGTCAGGAGCCCCCCCCCTGAACCCAGGATAACCCTCAAAGTCGGGGGGCAACCC (SEQ ID NO:100). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:100. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:100. The stabilizing domain can be transcribed into an RNA molecule.
[0230] In some embodiments, the stabilizing domain protecting the trans-splicing molecule from exonucleases acting in the 3' to 5' direction comprises or is composed of a sequence forming a pseudoknot from the evolved preQ1 riboswitcher aptamer. This sequence may comprise a DNA sequence. This sequence may comprise an RNA sequence. In some embodiments, the sequence from the evolved preQ1 riboswitcher aptamer comprises or is composed of the following sequence: TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA (SEQ ID NO:101). In some embodiments, the stabilizing domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence encoded by SEQ ID NO:101. In some embodiments, the stabilizing domain comprises a sequence encoded by SEQ ID NO:101. The stabilizing domain can be transcribed into an RNA sequence.
[0231] In some implementations, the stabilizing domain that protects the trans-splicing molecule from exonucleases acting in the 3' to 5' direction includes, or consists of, sequences forming G-quadruplexes, sequences isolated from or derived from ribosomal RNA, sequences isolated from or derived from ribozymes, or sequences isolated from or derived from prion mRNA.
[0232] Cutting structural domain In some embodiments, the cleavage domain disclosed herein comprises a sequence or structure of any one or more molecules selected from the group consisting of: hammerhead ribozymes, hammerhead ribozymes, tRNA (gly), tRNA-Gly-CCC-1-1, tRNA-Gly-CCC-1-2, tRNA-Gly-CCC-3-1, tRNA-Gly-CCC-2-2, tRNA-Gly-CCC-2-1, tRNA-Gly-GCC-2-4, tRNA-Gly-GCC-2-5, tRNA-Gly-GCC-2-6, tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2, tRNA-Gly-GCC-1-1, tRNA-G ly-GCC-1-3, tRNA-Gly-GCC-1-4, tRNA-Gly-GCC-1-5, tRNA-Gly-GCC-3-1, tRNA-Gly-GCC-4-1, tRNA-Gly-GCC-5-1, tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-1-1, t RNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2, tRNA-Gly-TCC-2-3, tRNA-Gly-TCC-2-4, tRNA-Gly-TCC-2-5, tRNA-Gly-TCC-2-6, tRNA-Gly-TCC-4-1, rice tRNA, MALAT1 mascRNA, 7QR4_2|Strand B|RNACPEB3 ribozyme|Homo sapiens (9606), 7QR3_2|Strand C,D|Chimpanzee CPEB3 ribozyme|African chimpanzee (9598), 4R4P_1|strand A|VS ribozyme RNA|Neurospora (5140), 4R4P_1|strand A|VS ribozyme RNA|Neurospora (5140) [tandem dimer], 4R4V_1|strand A|VS ribozyme RNA|Neurospora (5140), 4R4V_1|strand A|VS ribozyme RNA|Neurospora (5140) [tandem dimer], Histone 3'UTR with SLBP and HDE H1-4, Histone 3'UTR with SLBP and HDE H2BC21D, Histone 3'UTR with SLBP and HDE H2AC20, Histone 3'UTR with SLBP and HDE Histone 3'UTR of H2BC13, Histone 3'UTR with SLBP and HDEH2AC25, Pri-miR-16-1, Pri-miR-30a, Artificial Microprocessor Substrate, eIF4H Exon 5, Pri-miR-7, Targeted Pseudouridine Cytokinase snoRNA-1, Targeted Pseudouridine Cytokinase snoRNA-2, scaRNA-9, scaRNA-2, 5K7C_1|Strand A|RNA 47-MER|Synthetic Construct (32630), 5T5A_1|Strand A|DNA / RNA (71-MER)|Metagenomics (256318), 4OJI_1|Strand A|RNA (52-MER)|Invalid, 4RGE_1|Strand A, B, C|env22 Torsion Ribozyme|Synthetic (32630), 6JQ5_1|Strand A, B|RNA (82-MER)|synthetic construct (32630), 6JQ5_1|strand A, B|RNA (82-MER)|synthetic construct (32630) dimer, Pri-miR-31(51+51), Pri-miR-31(51+51) / Pre-miR-HBV, Pri-miR-31(38+40) / Pre-miR-HBV, Pri-miR-31(30+31) / Pre-miR-HBV, Pri-miR-31(22+21) / Pre-miR-HBV. In some embodiments, the cleavage domain contains at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97.5%, about 98%, about 99%, or about 100% identity with the sequence in the aforementioned molecules.
[0233] Engineered U1 snRNA The compositions provided herein may comprise a nucleic acid sequence encoding an engineered U1 snRNA (enzyme staplemolecule, or "ESM"). The nucleic acid may comprise RNA, DNA, a DNA / RNA hybrid, and / or at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. The DNA-containing nucleic acid may encode the ESM. The DNA may be transcribed into RNA, such as engineered small nuclear RNA (snRNA). In some embodiments, the ESM comprises an engineered snRNA. The engineered snRNA (e.g., esnRNA) may recruit members of the spliceosome. In some embodiments, the engineered snRNA is configured to promote RNA splicing. In some embodiments, the engineered snRNA is configured to promote RNA splicing of a trans-spliced RNA molecule or a portion thereof to form a full-length trans-spliced RNA molecule. In some embodiments, the engineered snRNA is configured to promote RNA splicing of exon domains to replace a portion of the target RNA. Engineered snRNAs can interact with nucleic acid sequences or transcribed copies of nucleic acid sequences to enhance trans-splicing of nucleic acid sequences. In this way, engineered snRNAs can promote the association of exon domains with target RNA, resulting in trans-splicing of the exon domains with the target RNA. Engineered snRNAs can also promote the association of one part of a trans-spliced RNA molecule with another part of a trans-spliced RNA molecule, thereby producing a full-length trans-spliced RNA molecule.
[0234] In some embodiments, the engineered snRNA may interact with intron domains to increase the trans-splicing efficiency of nucleic acid molecules. In some embodiments, the engineered snRNA domain comprises a sequence derived from or isolated from a human small nuclear RNA gene. In some embodiments, the human small nuclear RNA gene comprises U1, U2, U4, U5, U6, U7, U11, and U12 snRNAs. In some embodiments, there may be an engineered snRNA sequence configured to promote trans-splicing. In some embodiments, the engineered snRNA may be derived from or isolated from a human U1 snRNA gene. In some embodiments, the sequence of the engineered snRNA may be derived from or isolated from a U1 snRNA variant.In some embodiments of the compositions disclosed herein, the U1 snRNA variants are selected from a list consisting of the following (the genomic location according to the UCSC Human Genome Assembly 2006 edition is in square brackets after the name): tU1.1 [chr1:16713367-16712967], tU1.2 [chr1:16866030-16865630], vU1.1 [chr1:142438700-142438300], vU1.2 [chr1:142464813-142464413], vU1.4 [chr1:143022739-143022339], vU1.5 [chr1:143202968-143202568], vU1.7 [chr1:144680790-144680390], vU1.8 [chr1:145022927-145022527], vU1.9 [chr1:145977791-145977391], vU1.10 [chr1:146301289-146300889], vU1.11 [chr1:146327427-146327027], vU1.15 [chr1:146871696-146871296], vU1.16 [chr1:147033726-147033326], vU1.17 [chr1:147460893-147460493], vU1.18 [chr1:147490845-147490445], vU1.19 [chr1:147780880-147780480], tU1.3 [chr1:16939762-16940162], tU1.4 [chr1:17095226-17095626], vU1.3 [chr1:142478876-142479276], vU1.6 [chr1:144094114-144094514], vU1.12 [chr1:146341486-146341886], vU1.13 [chr1:146460770-146461170], vU1.14 [chr1:146608089-146608489], vU1.20 [chr1:147872535-147872935].
[0235] In some embodiments, the ESM comprises or consists of the following sequence: CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtCACCTTCGTGATCATGGTATCTCCCCCG (SEQ ID NO: 124). In some embodiments, the ESM comprises or consists of the following sequence: CGAGCTCTCTgcaggggagataccaTGATCAcgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctg (SEQ ID NO: 125).
[0236] Ribozyme Ribozymes are non-coding RNAs that, similar to enzymes, catalyze specific biochemical transformations. Some ribozymes can catalyze or perform RNA splicing. Ribozymes can perform the cutting or joining of RNA and DNA, and can catalyze peptide bond formation. Within ribosomes, ribozymes can function as part of the large subunit ribosomal RNA to link amino acids during protein synthesis.
[0237] In some embodiments, the trans-splicing nucleic acid molecule of this disclosure comprises: (a) an exon domain (e.g., an exon domain encoding a therapeutic sequence); (b) an intron domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) an antisense domain configured to bind a target RNA molecule; and (d) a sequence or structure derived from or isolated from a ribozyme, wherein the ribozyme is selected from the group consisting of: VS ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, mammalian CPEB3 ribozyme, and riboswitch. In some embodiments, the trans-splicing nucleic acid molecule further comprises a G-quadruplex and / or a pseudoknot. In some embodiments, the trans-splicing nucleic acid molecule further comprises poly(A). In some embodiments, the trans-spliced nucleic acid molecule comprises, from 5' to 3': a G-quadruplex and / or a pseudoknot, a sequence or structure derived from or isolated from a ribozyme, and a poly(A). In some embodiments, the trans-spliced nucleic acid molecule comprises, from 5' to 3': a G-quadruplex and / or a pseudoknot, and a poly(A). In some embodiments, the trans-spliced nucleic acid molecule comprises, from 5' to 3': a G-quadruplex and / or a pseudoknot, and a sequence or structure derived from or isolated from a ribozyme, and the trans-spliced nucleic acid molecule does not contain a 3' poly(A) tail. In some embodiments, the trans-spliced nucleic acid molecule comprises, from 5' to 3': a sequence or structure derived from or isolated from a ribozyme, and a G-quadruplex and / or a pseudoknot, and the trans-spliced nucleic acid molecule does not contain a 3' poly(A) tail.
[0238] In some embodiments, the trans-splicing nucleic acid molecule of this disclosure comprises: (a) an exon domain (e.g., an exon domain encoding a therapeutic sequence); (b) an intron domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) an antisense domain configured to bind a target RNA molecule; (d) a sequence or structure derived from or isolated from a ribozyme; and (e) a 3' domain, wherein the 3' domain does not contain poly(A). In some embodiments, the 3' domain contains a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain does not contain a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the ribozyme is selected from the group consisting of: hammerhead ribozyme, HDV ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, mammalian CPEB3 ribozyme, and riboswitches. In some embodiments, the 3' domain includes a cleavage domain. In some embodiments, the cleavage domain includes a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the cleavage domain does not include a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the stabilization domain includes a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the stabilization domain does not include a sequence or structure derived from or isolated from the ribozyme. In some embodiments, the stabilization domain includes a G-quadruplex. In some embodiments, the stabilization domain includes a pseudoknot. In some embodiments, the 3' domain includes a nuclear-reserved domain. In some embodiments, the nuclear-reserved domain includes a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the nuclear-reserved domain does not include a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain from 5' to 3' includes: a G-quadruplex and / or a pseudoknot, and a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain from 5' to 3' includes: a sequence or structure derived from or isolated from a ribozyme, and a G-quadruplex. In some embodiments, the 3' domain from 5' to 3' includes: a sequence or structure derived from or isolated from a ribozyme, and a G-quadruplex. In some embodiments, the 3' domain from 5' to 3' includes: a G-quadruplex, and a sequence or structure derived from or isolated from a ribozyme. In some embodiments, the 3' domain from 5' to 3' includes: a sequence or structure derived from or isolated from a ribozyme, and a pseudoknot. In some implementations, the 3' domain from 5' to 3' includes: a pseudoknot and a sequence or structure derived from or isolated from a ribozyme.
[0239] In some embodiments, the ribozyme is a twist ribozyme. In some embodiments, the ribozyme is a twist ribozyme that comprises the sequence listed in SEQ ID NO:115. In some embodiments, the ribozyme is an env22 twist ribozyme. In some embodiments, the ribozyme is an env22 twist ribozyme that comprises the sequence listed in SEQ ID NO:116. In some embodiments, the ribozyme is a twist sister ribozyme. In some embodiments, the ribozyme is a twist sister ribozyme that comprises the sequence listed in SEQ ID NO:114. Twist sister ribozymes are described, for example, in Zheng et al., Structure-based insights into self-cleavage by a four-way junctional twister-sister ribozyme, Nat Commun (2017) Oct 30;8(1):1180, which is incorporated herein by reference in its entirety. In some embodiments, the ribozyme is a hammerhead ribozyme. In some embodiments, the ribozyme is a hammerhead ribozyme that comprises the sequence listed in SEQ ID NO:123. Hammerhead ribozymes are described, for example, in Scott et al., (2013) Prog Mol Bio Trans Sci. 120:1-23, which are incorporated herein by reference in their entirety. In some embodiments, the ribozyme is an Rzb hammerhead ribozyme. In some embodiments, the ribozyme is a self-cleaving hammerhead ribozyme. In some embodiments, the ribozyme is a class I intron. In some embodiments, the ribozyme is a class II intron. In some embodiments, the ribozyme is RNase P. In some embodiments, the ribozyme is a peptidyl transferase 23S rRNA. In some embodiments, the ribozyme is a GIR1 branched ribozyme. In some embodiments, the ribozyme is a lead enzyme. In some embodiments, the ribozyme is a hairpin ribozyme. In some embodiments, the ribozyme is a hepatitis delta virus (HDV) ribozyme. In some embodiments, the ribozyme is a VS ribozyme. In some embodiments, the ribozyme is a mutant VS ribozyme. In some embodiments, the mutant VS ribozyme contains the G638A mutation. In some embodiments, the mutant VS ribozyme contains the A756G mutation. In some embodiments, the ribozyme is a VS ribozyme containing the G638A mutation. In some embodiments, the ribozyme is a VS ribozyme containing the A756G mutation. In some embodiments, the ribozyme is a pistol ribozyme. In some embodiments, the ribozyme is an axe ribozyme. In some embodiments, the ribozyme is a tandem dimer axe ribozyme. In some embodiments, the ribozyme contains one copy of the axe ribozyme.In some implementations, the ribozyme is derived from the mammalian CPEB3 ribozyme (see Chadalavada DM et al., The human HDV-like CPEB3 ribozyme is intrinsically fast-reacting; Biochemistry 2010, 49, 25, 5321-5330; and Chen C et al., Inhibition of). Cpeb3 Ribozyme elevates CPEB3 protein expression and polyadenylation of its target mRNAs and enhances object location memory (eLife 2024, DOI: 10.7554 / eLife.90116, each of which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a human CPEB3 ribozyme. In some embodiments, the ribozyme comprises the sequence listed in SEQ ID NO:121. In some embodiments, the ribozyme is a chimpanzee CPEB3 ribozyme. In some embodiments, the ribozyme is derived from... African chimpanzeesThe CPEB3 ribozyme. In some embodiments, the ribozyme comprises the sequence listed in SEQ ID NO:122. In some embodiments, the ribozyme is a CoTC ribozyme. In some embodiments, the ribozyme is a glmS ribozyme. In some embodiments, the ribozyme is a ribozyme derived from or encoded by a lncRNA. In some embodiments, the ribozyme is a Hovlinc ribozyme (see, e.g., Chen et al., Hovlink is a recently evolved class of ribozyme found in human lncRNA, Nat Chem Biol 2021, 17:601-607, which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a lantern ribozyme (see, e.g., Zhou et al., Humanlantern ribozymes: smallest known self-cleaving ribozymes, ELife preprint published September 11, 2023, which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a self-alkylating ribozyme (see, for example, Krochmal et al., Structural basis for substrate binding and catalysis by a self-alkylating ribozyme, Nat Chem Biol 2022 18:376-384, which is incorporated herein by reference in its entirety). In some embodiments, the ribozyme is a Walkud satellite ribozyme.
[0240] In some embodiments, the ribozyme is a prokaryotic ribozyme. In some embodiments, the ribozyme is derived from or isolated from prokaryotes. In some embodiments, the ribozyme is derived from or isolated from bacteria or archaea. In some embodiments, the ribozyme is derived from... thermophilic bacteria The ribozyme. In some embodiments, the ribozyme is a eukaryotic ribozyme. In some embodiments, the ribozyme is derived from or isolated from a eukaryotic organism. In some embodiments, the ribozyme is derived from or isolated from a mammalian organism. In some embodiments, the ribozyme is derived from or isolated from a human. In some embodiments, the ribozyme derived from or isolated from a human is the CPEB3 ribozyme. In some embodiments, the ribozyme is derived from or isolated from a chimpanzee (…). African chimpanzees In some implementations, the ribozyme derived from or isolated from chimpanzees is the CPEB3 ribozyme.
[0241] In some embodiments, the ribozyme is a self-cleaving ribozyme. In some embodiments, the self-cleaving ribozyme is a hammerhead ribozyme. In some embodiments, the ribozyme cleaves the target RNA molecule. In some embodiments, the ribozyme does not cleave the target RNA molecule. In some embodiments, the ribozyme acts as a steric blocker of the target RNA molecule. In some embodiments, the ribozyme acting as a steric blocker of the target RNA molecule improves or helps the nuclear retention of the target RNA molecule. In some embodiments, the ribozyme acting as a steric blocker of the target RNA molecule prevents or inhibits spliceosome cleavage of the target RNA molecule. In some embodiments, the ribozyme is a self-alkylating ribozyme.
[0242] In some embodiments, the ribozyme is modulated by the presence or absence of one or more metal ions. In some embodiments, the secondary structure of the ribozyme is modulated or altered by the presence or absence of one or more metal ions. In some embodiments, the tertiary structure of the ribozyme is modulated or altered by the presence or absence of one or more metal ions. In some embodiments, the catalytic function of the ribozyme is modulated or altered by the presence or absence of one or more metal ions. In some embodiments, the one or more metal ions are Mg. 2+ Cations. In some embodiments, the ribozyme is not modulated by the presence or absence of one or more metal ions. In some embodiments, the catalytic function of the ribozyme occurs via acid-base catalysis. The mechanisms of ribozyme catalysis are described, for example, in Lilley, Mechanisms of RNA Catalysis, Philos TransR Soc Lond B Biol Sci. 2011 Oct 27; 366(1580):2910-2917, and Ren et al., Structure-based mechanistic insights into catalysis by small self-cleaving ribozymes, Curr Opin Chem Biol 2017 Dec:41:71-83, each of which is incorporated herein by reference in its entirety. In some embodiments, modulation or alteration means that the ribozyme undergoes a conformational change upon binding with one or more metal ions. In some embodiments, modulation or alteration means that the ribozyme undergoes a conformational change upon binding with one or more metal ion cofactors, thereby enhancing the ribozyme's ability to catalyze biochemical reactions.
[0243] In some embodiments, the ribozyme comprises a pseudoknot. In some embodiments, the ribozyme comprises a first pseudoknot and a second pseudoknot. In some embodiments, the ribozyme comprises one or more pseudoknots. In some embodiments, the ribozyme comprises two or more pseudoknots. In some embodiments, the ribozyme is a torsion ribozyme having or comprising a secondary structure of three stems connected by an inner loop and a terminal loop. In some embodiments, the ribozyme is a torsion ribozyme comprising two pseudoknot structures. In some embodiments, the two pseudoknots of the torsion ribozyme provide tertiary structural contacts that are crucial for catalytic activity (see, e.g., Roth et al., A widespread self-cleaving ribozyme class is revealed by bioinformatics. Nature Chemical Biology 10, 56-60 (2014), which is incorporated herein by reference in its entirety). In some implementations, the ribozyme is a twisted sister ribozyme containing a four-way junctional precatalytic structure (see, for example, Zheng et al., Structure-based insights into self-cleavage by a four-way junctional twister-sister ribozyme, Nat Comm 2017 8(1180), which is incorporated herein by reference in its entirety).
[0244] In some embodiments, the ribozyme increases the trans-splicing efficiency of the trans-splicing molecule. In some embodiments, the ribozyme increases the trans-splicing efficiency of the trans-splicing molecule by at least about 20%, at least about 25%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500%, at least about 550%, at least about 600%, at least about 650%, at least about 700%, at least about 750%, at least about 800%, at least about 850%, at least about 900%, at least about 950%, at least about 1000%, or more.
[0245] In some embodiments, G-quadruplexes and / or pseudojunctions increase the trans-splicing efficiency of trans-splicing molecules. In some embodiments, G-quadruplexes and / or pseudojunctions increase the trans-splicing efficiency by at least about 20%, at least about 25%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500%, at least about 550%, at least about 600%, at least about 650%, at least about 700%, at least about 750%, at least about 800%, at least about 850%, at least about 900%, at least about 950%, at least about 1000%, or more.
[0246] In some embodiments, the ribozyme comprises a nucleic acid sequence selected from SEQ ID NO:114-123. In some embodiments, the ribozyme comprises a nucleic acid sequence having at least about 80%, at least about 85%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or a higher percentage of sequence homology with any of SEQ ID NO:114-123.
[0247] Table 1: Ribozyme Sequences
[0248] Nucleic acid Trans-splicing of nucleic acid molecules In some embodiments, this disclosure provides a trans-splicing nucleic acid molecule comprising one or more exon domains. The nucleic acid may comprise RNA, DNA, a DNA / RNA hybrid, and / or at least one of a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. In some embodiments, the trans-splicing nucleic acid molecule can be provided by reconstructing two or more exon domains. In some embodiments, the trans-splicing nucleic acid molecule comprises a trans-splicing RNA molecule. In some embodiments, the nucleic acid molecules provided herein encode one or more trans-splicing RNA molecules or portions thereof. In some embodiments, the trans-splicing RNA molecule or portions thereof comprises one or more exon domains. In some embodiments, the trans-splicing RNA molecule can be reconstructed from one or more exon domains. In some embodiments, the trans-splicing RNA molecule or portions thereof comprises one or more antisense domains. In some embodiments, the one or more antisense domains facilitate association between the trans-splicing RNA and the target RNA.
[0249] In some embodiments, the trans-spliced RNA molecule comprises one or more exon domains. In some embodiments, the trans-spliced RNA molecule comprises one or more antisense domains. In some embodiments, the trans-spliced RNA molecule comprises: (a) one or more intron domains that promote trans-splicing, (b) one or more antisense domains that are inversely complementary to the target RNA, (c) one or more exon domains, and (d) a 3' domain configured to increase the safety and efficiency of the trans-spliced molecule. In some embodiments, the 3' domain comprises a nuclear retention domain configured to promote the retention of the trans-spliced RNA molecule in the cell nucleus, thereby increasing trans-splicing activity or trans-splicing. In some embodiments, the 3' domain further comprises a stabilizing domain that prevents nuclease degradation of the trans-spliced RNA molecule. In some embodiments, the 3' domain further comprises a cleavage domain that causes cleavage of the trans-spliced RNA at a site within or adjacent to the cleavage domain. The compositions provided herein may further comprise nucleic acids encoding engineered U1 snRNA. In some implementations, the intronic domain of the trans-spliced RNA molecule contains a sequence that binds to the engineered U1 snRNA.
[0250] In some embodiments, the trans-splicing nucleic acid molecule is at least one of RNA, DNA, a DNA / RNA hybrid, and / or a nucleic acid analog, a chemically modified nucleic acid, or a chimera composed of two or more nucleic acids or nucleic acid analogs. As used herein, the term "nucleic acid analog" refers to a compound that has a structural similarity to classical purine or pyrimidine bases found in DNA or RNA. Compared to naturally occurring purine or pyrimidine bases in DNA or RNA, nucleic acid analogs may contain modified sugars and / or modified nucleobases. In some embodiments, the nucleic acid analog is a 2'-deoxyribonucleoside, 2'-ribonucleoside, 2'-deoxyribonucleotide, or 2'-ribonucleotide, wherein the nucleobases include modified bases (such as, for example, xanthine, uridine, oxopurine (oxazanine), 7-methylguanosine, dihydrouridine, 5-methylcytidine, C3 spacer, 5-methyldC, 5-hydroxybutyn-2'-deoxyuridine, 5-nitroindole, 5-methylisodeoxycytidine, isodeoxyguanosine, deoxyuridine, isodeoxycytidine, other 0-1 purine analogs, N-6-hydroxyaminopurine, muscarinic acid, 7-denitroxanthine, other 7-denitropurines, and 2-methylpurine). In some embodiments, the nucleic acid analogue may be selected from the group consisting of: inosine, 7-dezo-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA-inosine, aminophosphate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In other embodiments, the nucleic acid analogue is a nucleic acid mimic (such as, for example, artificial nucleic acids and xeno nucleic acids (XNA)).
[0251] The nucleic acids disclosed herein can be chemically modified from naturally occurring nucleic acids. In some embodiments, the modification can improve the stability of the nucleic acid. In some embodiments, the modification includes N6-methyladenosine (m6A), N6,2'-O-dimethyladenosine (m6Am), 8-oxo-7,8-dihydroguanosine (8-oxoG), pseudouridine (Ψ), 5-methylcytidine (m5C), or N4-acetylcytidine (ac4C).
[0252] In some embodiments, the trans-spliced RNA molecule further includes a 5' untranslated region. In some embodiments, the 5' untranslated region increases the stability of the trans-spliced nucleic acid molecule. In some embodiments, the 5' untranslated region alters the localization of the trans-spliced nucleic acid molecule. In some embodiments, the 5' untranslated region alters the processing of the trans-spliced nucleic acid molecule.
[0253] In some embodiments, the trans-spliced RNA molecule further includes a 3' untranslated region. In some embodiments, the 3' untranslated region increases the stability of the trans-spliced nucleic acid molecule. In some embodiments, the 3' untranslated region alters the localization of the trans-spliced nucleic acid molecule. In some embodiments, the 3' untranslated region alters the processing of the trans-spliced nucleic acid molecule.
[0254] In some embodiments, this document provides trans-splicing nucleic acid molecules configured to trans-splice with target RNA (e.g., precursor mRNA in a cell). In some embodiments, trans-splicing nucleic acid molecules are configured to trans-splice with target RNA involved in a disease or condition.
[0255] trans-splicing molecular sequences This document also provides nucleic acid sequences encoding the trans-splicing nucleic acid molecules disclosed herein for use in the gene transfer and expression techniques described herein. It should be understood that, although not always explicitly stated, the sequences provided herein can be used to provide substantially the same sequences as those producing expression products and proteins having the same biological characteristics. These “bioequivalent” or “bioactive” or “equivalent” polypeptides are encoded by equivalent polynucleotides as described herein. When compared using sequence identity methods operating under default conditions, they may have a nucleic acid sequence that is at least 60%, or optionally at least 65%, or optionally at least 70%, or optionally at least 75%, or optionally at least 80%, or optionally at least 85%, or optionally at least 90%, or optionally at least 95%, or optionally at least 98% identical to a reference nucleic acid sequence. Specific sequences are provided as examples of specific embodiments. Additionally, an equivalent polynucleotide is a polynucleotide that hybridizes to a reference polynucleotide or its complement under stringent conditions.
[0256] The nucleic acid sequences (e.g., polynucleotide sequences) disclosed herein can be codon-optimized. Codon optimization refers to the fact that different cells differ in their use of specific codons. This codon preference corresponds to the preference for the relative abundance of a particular tRNA in a cell type. By changing codons in the sequence to match the relative abundance of the corresponding tRNA, expression can be increased. Expression can also be decreased by intentionally selecting codons for the corresponding tRNA that are rare in a particular cell type, such as through a codon usage table. Based on the genetic code, nucleic acid sequences encoding various exon domains can be generated. In some embodiments, such sequences are optimized for expression in host or target cells, such as host cells for expressing trans-spliced RNA molecules containing exon domains, wherein the disclosed methods are implemented (e.g., in mammalian cells, such as human cells).
[0257] Species-specific codon preferences and codon usage tables can be used to engineer isolated nucleic acid molecules encoding exon domains (such as nucleic acid molecules encoding proteins having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the corresponding wild-type protein), utilizing the species-specific codon usage preferences. For example, the exon domains disclosed herein can be engineered to have codons preferentially used by a specific target organism. In one instance, exon domain nucleic acid sequences are optimized for expression in human cells, such as exon domain nucleic acid sequences having at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the corresponding wild-type or origin nucleic acid sequences. In some embodiments, the isolated trans-spliced nucleic acid molecule encoding at least one exon domain (which may be part of a vector) includes at least one exon domain codon-optimized for expression in eukaryotic cells, or at least one exon domain codon-optimized for expression in human cells. In one embodiment, such codon-optimized exon domains have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with their corresponding wild-type or origin sequences.
[0258] In some embodiments, the eukaryotic codon-optimized nucleic acid sequence encodes an exon domain with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to its corresponding wild-type or origin protein. In some embodiments, multiple clones containing functionally equivalent nucleic acids can be routinely generated, such as nucleic acids with different sequences but encoding the same exon domain protein sequence. Silent mutations in the exon domain are caused by the degeneracy (i.e., redundancy) of the genetic code, whereby more than one codon can encode the same amino acid residues. Therefore, for example, leucine can be encoded by CTT, CTC, CTA, CTG, TTA, or TTG; serine can be encoded by TCT, TCC, TCA, TCG, AGT, or AGC; asparagine can be encoded by AAT or AAC; aspartic acid can be encoded by GAT or GAC; cysteine can be encoded by TGT or TGC; alanine can be encoded by GCT, GCC, GCA, or GCG; glutamine can be encoded by CAA or CAG; tyrosine can be encoded by TAT or TAC; and isoleucine can be encoded by ATT, ATC, or ATA. Tables showing the standard genetic code can be found in various sources (see, e.g., Streyer, 1988, Biochemistry, 3rd edition, WH5 Freeman and Co., NY).
[0259] carrier The compositions of the present invention provide vectors for delivery of any of the compositions, nucleic acids, or systems described herein, or for use in any of the methods described herein. In some embodiments of the compositions and methods disclosed herein, the vectors are viral vectors. In some embodiments, the viral vector comprises a sequence isolated from or derived from a retrovirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from a lentivirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from an adenovirus. In some embodiments, the viral vector comprises a sequence isolated from or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises a sequence isolated from or derived from herpes simplex virus (HSV). In some embodiments, the viral vector is non-replicating. In some embodiments, the viral vector is isolated or recombinant. In some embodiments, the viral vector is self-complementary.
[0260] In some embodiments, the vector is a viral vector. In some embodiments, the vector is an adenovirus vector, an adeno-associated virus (AAV) vector, or a lentiviral vector. In some embodiments, the vector is a retroviral vector, an adenovirus / retrovirus chimeric vector, a herpes simplex virus I or II vector, a parvovirus vector, a reticuloendothelial growth factor virus vector, a poliovirus vector, a papillomavirus vector, a vaccinia virus vector, or any hybrid or chimeric vector incorporating advantageous aspects of two or more viral vectors. In some embodiments, the vector further comprises one or more expression control elements operatively linked to a polynucleotide. In some embodiments, the vector further comprises one or more optional markers.
[0261] In some embodiments of the compositions and methods disclosed herein, the viral vector comprises a sequence isolated from or derived from adeno-associated virus (AAV). In some embodiments, the viral vector comprises an inverted terminal repeat or capsid sequence of an AAV isolated from or derived from serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12. In some embodiments, the viral vector is non-replicating. In some embodiments, the viral vector is isolated or recombinant (rAAV). In some embodiments, the viral vector is self-complementary (scAAV). In some embodiments, the AAV vector has low toxicity. In some embodiments, the AAV vector does not integrate into the host genome, thereby having a low probability of inducing insertional mutagenesis. In some embodiments, the AAV vector may encode a total polynucleotide range of 0.3 kb to 4.75 kb. In some embodiments, the AAV vectors that can be used in any of the compositions, systems, methods, and kits described herein may include AAV1 vectors, modified AAV1 vectors, AAV2 vectors, modified AAV2 vectors, AAV3 vectors, modified AAV3 vectors, AAV4 vectors, modified AAV4 vectors, AAV5 vectors, modified AAV5 vectors, AAV6 vectors, modified AAV6 vectors, AAV7 vectors, modified AAV7 vectors, AAV8 vectors, AAV9 vectors, AAV.rh10 vectors, modified AAV.rh10 vectors, AAV.rh32 / 33 vectors, modified AAV.rh32 / 33 vectors, AAV.rh43 vectors, modified AAV.rh43 vectors, AAV.rh74 vectors, modified AAV.rh74 vectors, AAV.rh64R1 vectors, and modified AAV.rh64R1 vectors, and any combinations or equivalents thereof.
[0262] In some embodiments, the lentiviral vector is an integrase-competent lentiviral vector (ICLV). In some embodiments, the lentiviral vector can refer to a transgenic plasmid vector and a transgenic plasmid vector bound to an associated plasmid (e.g., a packaging plasmid, a rev expression plasmid, an envelope plasmid), as well as lentivir-based particles capable of introducing exogenous nucleic acids into cells via a virus or virus-like entry mechanism. In some embodiments, the lentiviral vectors that can be used in any of the compositions, systems, methods, and kits described herein may include human immunodeficiency virus (HIV) 1 vector, modified human immunodeficiency virus (HIV) 1 vector, human immunodeficiency virus (HIV) 2 vector, modified human immunodeficiency virus (HIV) 2 vector, sooty mangabey simian immunodeficiency virus (SIVSM) vector, modified sooty mangabey simian immunodeficiency virus (SIVSM) vector, African green monkey simian immunodeficiency virus (SIVAGM) vector, modified African green monkey simian immunodeficiency virus (SIVAGM) vector, equine infectious anemia virus (EIAV) vector, modified equine infectious anemia virus (EIAV) vector, and feline immunodeficiency virus (FIVV). FIV vector, modified feline immunodeficiency virus (FIV) vector, Visna / maedivirus (VNV / VMV) vector, modified Visna / maedivirus (VNV / VMV) vector, caprine arthritis-encephalitis virus (CAEV) vector, modified caprine arthritis-encephalitis virus (CAEV) vector, bovine immunodeficiency virus (BIV) or modified bovine immunodeficiency virus (BIV).
[0263] In some embodiments, the vectors disclosed herein are non-viral vectors. In some embodiments, the vectors comprise or consist of lipid nanoparticles, micelles, liposomes or lipid complexes, polymeric vesicles, polymeric complexes, exosomes or dendritic molecules. In some embodiments, the vector is an expression vector or a recombinant expression system. As used herein, the term "recombinant expression system" refers to a genetic construct formed through recombination for expressing certain genetic material.
[0264] In some embodiments, liposomes, lipid complexes, or lipid nanoparticles may further comprise noncationic lipids, PEG-conjugated lipids, sterols, or any combination thereof.
[0265] In some embodiments, the liposome, lipid complex, or lipid nanoparticle further comprises a non-cationic lipid, wherein the non-ionic lipid is selected from the group consisting of: distearyl-sn-glycerol-phosphoethanolamine, distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), and dioleoylphosphatidylethanolamine (DOPE). Palmitoyl oleoyl phosphatidylcholine (POPC), palmitoyl oleoyl phosphatidyl ethanolamine (POPE), dioleoyl-phosphatidyl ethanolamine 4-(N-maleiminomethyl)-cyclohexane-1-carboxylic acid ester (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoyl phosphatidyl ethanolamine (DMPE), distearate-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidyl ethanolamine (such as 16-O-monomethyl PE), dimethyl-phosphatidyl Ethanolamines (such as 16-O-dimethyl PE), 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylcholine (HSPC), lecithin choline (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearate phosphatidylglycerol (DSPG), disorhoylphosphatidylcholine (DEPC), palmitate Acyloleylphosphatidylglycerol (POPG), ditransoleyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysophosphatidylglycerol, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, lecithin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dicetylphosphatidylphosphate, lysophosphatidylcholine, dilinoleylphosphatidylcholine, and non-cationic lipids as described in, for example, WO2017 / 099823 or US2018 / 0028664.
[0266] In some embodiments, the liposomes, lipid complexes, or lipid nanoparticles further comprise conjugated lipids, wherein the conjugated lipids are selected from the group consisting of: PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), polyethylene glycol-modified phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG)), PEG-dialkoxypropylcarbamate, N-(carbonyl-methoxy-polyethylene glycol 2000)-1,2-distearate-sn-glycerol-3-phosphate ethanolamine sodium salt.
[0267] In some implementations, the liposomes, lipid complexes, or nanoparticles further comprise cholesterol or cholesterol derivatives.
[0268] In some embodiments, the liposomes, lipid complexes, or nanoparticles further comprise ionizable lipids, non-cationic lipids, conjugated lipids that inhibit particle aggregation, and sterols. The amounts of ionizable lipids, non-cationic lipids, conjugated lipids that inhibit particle aggregation, and sterols can vary independently. In some embodiments, the lipid nanoparticles comprise ionizable lipids in an amount of about 20 mol% to about 90 mol% of the total lipids present in the particles; non-cationic lipids in an amount of about 5 mol% to about 30 mol% of the total lipids present in the particles; conjugated lipids that inhibit particle aggregation in an amount of about 0.5 mol% to about 20 mol% of the total lipids present in the particles; and sterols in an amount of about 20 mol% to about 50 mol% of the total lipids present in the particles.
[0269] The ratio of total lipids to DNA carriers can be varied as desired. For example, the ratio of total lipids to DNA carriers (by mass or weight) can be from approximately 10:1 to approximately 30:1.
[0270] In some embodiments of the compositions and methods disclosed herein, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, expression control elements. As used herein, an "expression control element" refers to any sequence that regulates the expression of exon domains (such as genes). Expression control elements include, but are not limited to, promoters, enhancers, microRNAs, post-transcriptional regulatory elements, polyadenylation signal sequences, 5' or 3' untranslated regions, and introns.
[0271] Expression control elements can be, for example, constitutive, inducible, repressive, or tissue-specific. A “promoter” is a control sequence, a multinucleotide sequence region that controls the initiation and rate of transcription. It may contain genetic elements that regulate the binding of proteins and molecules, such as RNA polymerases and other transcription factors. In some embodiments, the expression control of the promoter is tissue-specific. Non-limiting examples of promoters include CMV, CBA, CAG, Cbh, EF-1a, PGK, UBC, GUSB, UCOE, hAAT, TBG, desmin, MCK, C5-12, NSE, synaptic protein, PDGF, MecP2, CaMKII, mGluR2, NFL, NFH, nβ2, PPE, ENK, EAAT2, GFAP, MBP, H1, and U6 promoters. In some embodiments, the promoter is a sequence isolated from or derived from a promoter capable of driving transfer RNA (tRNA) expression. In some implementations, the promoter is isolated from or derived from an alanine tRNA promoter, arginine tRNA promoter, asparagine tRNA promoter, aspartic acid tRNA promoter, cysteine tRNA promoter, glutamine tRNA promoter, glutamate tRNA promoter, glycine tRNA promoter, histidine tRNA promoter, isoleucine tRNA promoter, leucine tRNA promoter, lysine tRNA promoter, methionine tRNA promoter, phenylalanine tRNA promoter, proline tRNA promoter, serine tRNA promoter, threonine tRNA promoter, tryptophan tRNA promoter, tyrosine tRNA promoter, or valine tRNA promoter. In some implementations, the promoter is isolated from or derived from a valine tRNA promoter.
[0272] An enhancer is a DNA region that can be activated by proteins to increase the likelihood or frequency of transcription. Non-restricted examples of enhancers and post-transcriptional regulatory elements include the CMV enhancer and the WPRE.
[0273] In some embodiments of the compositions and methods disclosed herein, the expression vectors, viral vectors, or non-viral vectors provided herein include, but are not limited to, vector elements (such as IRES or 2A peptide sites) for configuring “multicistronic,” “polycistronic,” “biscistronic,” or “tricistronic” constructs, i.e., having dual, triple, or multiple coding regions or exons, and thus having the ability to express two or more proteins from a single construct from mRNA. Multicistronic vectors simultaneously express two or more individual proteins from the same mRNA. The two most widely used strategies for constructing multicistronic configurations are by using IRES or 2A self-cleaving sites. “IRES” refers to an internal ribosome entry site or portion thereof of viral, prokaryotic, or eukaryotic origin used within a multicistronic vector construct. In some embodiments, the IRES is an RNA element that allows translation initiation in a cap-independent manner. The terms “autocleaving peptide” or “sequence encoding autocleaving peptide” or “2A autocleaving site” refer to a linker sequence used in a vector construct to incorporate a site that promotes ribosome jumping and thereby generates two peptides from a single promoter. Such autocleaving peptides include, but are not limited to, T2A and P2A peptides or sequences encoding autocleaving peptides.
[0274] In some embodiments of the compositions and methods disclosed herein, the vector comprises or encodes the trans-spliced nucleic acid molecules disclosed herein. In some embodiments, the vector comprises or encodes at least one trans-spliced nucleic acid molecule disclosed herein. In some embodiments, the vector comprises or encodes one or more trans-spliced nucleic acids disclosed herein. In some embodiments, the vector comprises or encodes two or more trans-spliced nucleic acid molecules disclosed herein.
[0275] Cells and tissues This disclosure provides compositions, systems, nucleic acid molecules, and methods for use in cells or tissues. In some embodiments, the target RNA is in a cell. In some embodiments of the compositions and methods disclosed herein, the cell comprises a eukaryotic cell. In some embodiments, the cell comprises a mammalian cell. In some embodiments, the cell comprises bovine, mouse, cat, horse, pig, dog, ape, or human cells. In some embodiments, the cell comprises a non-human mammalian cell, such as a non-human primate cell.
[0276] In some embodiments, the cells include somatic cells. In some embodiments, the cells comprise germline cells. In some embodiments, the germline cells of this disclosure do not include human cells.
[0277] In some embodiments, the cells include stem cells. In some embodiments, the cells include embryonic stem cells. In some embodiments, embryonic stem cells do not include human cells. In some embodiments, the cells include pluripotent stem cells or multipotent stem cells. In some embodiments, the cells include adult stem cells. In some embodiments, the cells include induced pluripotent stem cells (iPSCs). In some embodiments, the cells disclosed herein include hematopoietic stem cells (HSCs).
[0278] In some embodiments, the cells include immune cells. In some embodiments, the immune cells include lymphocytes. In some embodiments, the immune cells include T lymphocytes (also referred to herein as T cells). Examples of T cells disclosed herein include, but are not limited to, naive T cells, effector T cells, helper T cells, memory T cells, regulatory T cells (Tregs), and γδ T cells. In some embodiments, the immune cells include B lymphocytes. In some embodiments, the immune cells include natural killer cells. In some embodiments, the immune cells include antigen-presenting cells.
[0279] In some embodiments, the cells are muscle cells. In some embodiments, the muscle cells include myoblasts or myocytes. In some embodiments, the muscle cells include cardiomyocytes, skeletal muscle cells, or smooth muscle cells. In some embodiments, the muscle cells include striated cells.
[0280] In some embodiments, the cells are somatic cells. In some embodiments, the somatic cells include epithelial cells. In some embodiments, the epithelial cells include squamous cell epithelium, cuboidal cell epithelium, columnar cell epithelium, stratified cell epithelium, pseudostratified columnar cell epithelium, or transitional cell epithelium. In some embodiments, the epithelial cells form glands, including but not limited to the pineal gland, thymus, pituitary gland, thyroid gland, adrenal gland, apocrine gland, pancreas, serous gland, local serous gland, mucous gland, and sebaceous gland. In some embodiments, the epithelial cells contact the outer surface of an organ, including but not limited to the lungs, spleen, stomach, pancreas, bladder, intestine, kidney, gallbladder, liver, larynx, or pharynx. In some embodiments, the epithelial cells of this disclosure contact the outer surface of a blood vessel or vein.
[0281] In some embodiments, the cells described herein are nerve cells. In some embodiments, nerve cells include neurons. In some embodiments, nerve cells include neuroglial cells or glial cells. In some embodiments, glial cells include glial cells of the central nervous system, including but not limited to oligodendrocytes, astrocytes, ependymal cells, and microglia. In some embodiments, the glial cells of this disclosure are glial cells of the peripheral nervous system, including but not limited to Schwann cells and satellite cells.
[0282] In some embodiments, the cells provided herein include hepatocytes. In some embodiments, the hepatocytes include hepatic parenchymal cells. In some embodiments, the hepatocytes include hepatic stellate cells. In some embodiments, the hepatocytes include Kupffer cells. In some embodiments, the hepatocytes include hepatic sinusoidal endothelial cells.
[0283] In some embodiments, the cells provided herein include retinal cells. In some embodiments, retinal cells include photoreceptor cells. In some embodiments, photoreceptor cells include rods. In some embodiments, retinal cells include cone cells. In some embodiments, retinal cells include bipolar cells. In some embodiments, retinal cells include ganglion cells. In some embodiments, retinal cells include horizontal cells. In some embodiments, retinal cells include cells without long processes.
[0284] In some embodiments, the cells provided herein include cardiac cells. In some embodiments, the cardiac cells include cardiomyocytes. In some embodiments, the cardiac cells include cardiac pacemaker cells.
[0285] In some embodiments, somatic cells include primary cells. In some embodiments, somatic cells include cultured cells. In some embodiments, somatic cells include in vivo, in vitro, ex vivo, or in situ somatic cells.
[0286] In some implementations, somatic cells include autologous or allogeneic cells.
[0287] method In some aspects, this document describes methods for repairing target RNA using trans-splicing molecules (e.g., trans-splicing RNA molecules) with novel trans-splicing systems. In some embodiments, the trans-splicing RNA molecule or a portion thereof comprises two or more exon domains and one or more antisense domains. The antisense domains can facilitate association between the trans-splicing RNA and the target RNA, thereby promoting the trans-splicing response of the target RNA and the RNA repair process. The trans-splicing RNA molecule can then replace one or more exon domains of the target RNA. The nucleic acid sequence can encode one or more 3' domains that inhibit protein production in the absence of trans-splicing events. The 3' domains can alternatively or additionally promote nuclear preservation and / or increase trans-splicing efficiency by localizing the trans-splicing RNA to the cell nucleus. In some embodiments, the trans-splicing system comprises any nucleic acid sequence encoding or containing one or a combination of any of the domains provided herein. Using more regulatory domains can significantly improve trans-splicing efficiency.
[0288] In some embodiments, the method includes providing a trans-splicing RNA molecule comprising: a plurality of exon domains; an intron domain; one or more antisense domains; and a 3' domain. In some embodiments, the method includes providing a trans-splicing RNA molecule further comprising any of the domains provided herein. In some embodiments, the method includes providing a trans-splicing RNA molecule comprising any or more of a nuclear retention domain, a stabilization domain, a cleavage domain, and / or a sequence capable of binding engineered U1 snRNA.
[0289] The methods provided herein can facilitate RNA trans-splicing in a manner sufficient to repair disease-causing RNA sequences in human cells to resolve the disease. In fact, inefficiency has been a major obstacle for many nucleic acid editing methods, including RNA trans-splicing. This disclosure provides compositions and methods for efficiently and specifically repairing RNA sequences within these RNA trans-splicing molecules. Trans-splicing RNA molecules have shown utility in a variety of contexts, including repairing disease-causing sequences or inserting engineered sequences into target RNA. Engineered sequences can alter the translation or stability of target RNA to increase or decrease protein production or target RNA levels.
[0290] In some embodiments, the method includes administering a therapeutically effective amount of a treatment comprising the composition or system described herein to a subject in need. In some embodiments, the subject has, has been diagnosed with, or is suspected of having a genetic disease. In some embodiments, the disease includes myotonic dystrophy, Duchenne muscular dystrophy, Dravet syndrome, LCA10, dystrophic epidermolysis bullosa, retinitis pigmentosa, otopathic syndrome, hemophilia A, and dysferlinopathy.
[0291] definition Whenever the terms "at least," "greater than," or "greater than or equal to" precede the first value in a series of two or more values, the terms "at least," "greater than," or "greater than or equal to" apply to each value in the series. For example, greater than or equal to 1, 2, or 3 is equivalent to greater than or equal to 1, greater than or equal to 2, or greater than or equal to 3.
[0292] Whenever the terms “no more than,” “less than,” or “less than or equal to” precede the first value in a series of two or more values, the terms “no more than,” “less than,” or “less than or equal to” apply to each value in the series. For example, less than or equal to 3, 2, or 1 is equivalent to less than or equal to 3, less than or equal to 2, or less than or equal to 1.
[0293] As used herein, the term "coupling" can refer to a weak or strong interaction between two or more atoms or molecules. The interaction can be mediated directly or indirectly by one or more molecules.
[0294] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized by hydrogen bonds between the bases of the nucleotide residues. Hydrogen bonds can occur through Watson-Crick base pairing, Hoogstein binding, or any other sequence-specific mechanism. The complex can consist of two strands forming a duplex, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. Hybridization reactions can constitute steps in broader processes, such as the initiation of the PC reaction or the enzymatic cleavage of polynucleotides by ribozymes.
[0295] Examples of stringent hybridization conditions include: incubation temperatures of approximately 25°C to approximately 37°C; hybridization buffer concentrations of approximately 6x SSC to approximately 10x SSC; formamide concentrations of approximately 0% to approximately 25%; and wash solutions of approximately 4x SSC to approximately 8x SSC. Examples of moderate hybridization conditions include: incubation temperatures of approximately 40°C to approximately 50°C; buffer concentrations of approximately 9x SSC to approximately 2x SSC; formamide concentrations of approximately 30% to approximately 50%; and wash solutions of approximately 5x SSC to approximately 2x SSC. Examples of highly stringent conditions include: incubation temperatures of approximately 55°C to approximately 68°C; and buffer concentrations of approximately 1x SSC to approximately 0.1x SSC. "Homology," "identity," or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in the sequences that can be aligned for comparison purposes. When the positions in the compared sequences are occupied by the same bases or amino acids, then the molecules are homologous at that position. The degree of homology between sequences varies with the number of common matching or homologous positions. "Unrelated" or "non-homologous" sequences have less than 40%, less than 35%, less than 30%, less than 25%, or less than 20% identity with one of the sequences of this invention.
[0296] “Nucleic acid,” “nucleic acid molecule,” or “nucleic acid sequence” can refer to RNA, DNA, or a DNA / RNA hybrid. Nucleic acids can include at least one of nucleic acid analogs, chemically modified nucleic acids, or chimeras composed of two or more nucleic acids or nucleic acid analogs. Nucleic acids can be artificial, such as synthetic, engineered, or modified. As used herein, the term “nucleic acid analog” refers to a compound that has a structural similarity to classical purine or pyrimidine bases found in DNA or RNA.
[0297] Permuted tRNA, or permutated tRNA, is the gene product of an arranged or permuted RNA gene. As used herein, permuted tRNA can refer to the precursor tRNA gene product (e.g., a circular tRNA intermediate) or the final permuted tRNA. Permuted tRNA can be found in unicellular algae (e.g., red algae, green algae, or chlorophylls) or archaea (e.g., *Cryptospira*).
[0298] While various embodiments of the invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Various modifications, variations, and substitutions can be made by those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be used.
[0299] References: Example The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.
[0300] Example 1: Combination of 3' structural domain and sub-structural domain In this embodiment, the 3' domain of the trans-spliced RNA comprises three subdomains: a stabilization domain, a cleavage domain, and a nuclear retention domain. High-throughput screening can be used to identify combinations of these heterologous sequences that have the desired effect of increasing the safety and efficiency of the trans-spliced RNA. High-throughput screening can test various combinations of the stabilization domain, cleavage domain, and nuclear retention domain in the trans-spliced RNA, as well as factors affecting RNA processing and stability (such as adjacent RNA sequences (although they have known activity in different contexts)), to identify trans-spliced RNAs with various desired effects (such as nuclear retention, stability, and / or the ability to be cleaved to block the translation of truncated mRNA).
[0301] A pool of trans-splicing RNA was generated using Golden Gate DNA assembly, in which each of the 3' domains contained a mixture of different sequences at its respective subdomain location. The subdomains within the 3' domain were positioned relative to each other in the 5' to 3' direction as follows: nuclear retention domain, stabilization domain, and cleavage domain.
[0302] The following are the different sequences present in the stabilization domains selected in this screening (136 sequences): MMLV pseudoknot, KSHV PAN ENE, RRV ENE with A region, 2xRRV ENE A region, EHV2 ENE A region, 2xEHV ENE A region, KSHV PAN ENE (79b), KSHV PAN ENE + A region, 5x KSHV PAN ENE (79b), PSIV ENE, PSIVENE + A region, 2xPSIV ENE, cc bracovirus ENE + A region, 2x cc bracovirus ENE + A region, cs bracocirus ene + A region, 2x cs bracovirus ene + A region, ap mimivirus ene (with 26b spacer region), 2x ap mimivirus ene (with 26b spacer region), KSHV + RRV ENE, MMTV pseudoknot, SRV-1 pseudoknot, human telomerase pseudoknot, phage T2 pseudoknot, ydaO_riboswitch_Bs, ydaO_riboswitch_Tl, ydaO_riboswitch_Tp, ydaO_riboswitch_Tt, ToxI_Pa, SAM-II_riboswitch, SAM-I_riboswitch, SAH_riboswitch, KUNV, CPEB3_rz_Rn, CPEB3_rz_Pt, CPEB3_rz_Oc, CPEB3_rz_Mm, CPEB3_rz_Md, CPEB3_rz_La, CPEB3_rz_Hs, CPEB3_rz_Cf, CPEB3_rz_Bt, IFNG_PK _S_ Wild boar, IFNG_PK_M_ House mouse, IFNG_PK_C_ Common marmoset, IFNG_PK_C_ Domestic dog, IFNG_PK_B_ Bull, IFNG_PK, PDV3, ApMV3, PNRSV3, FCILV3, HJLV3, APLPV3, LiRMV3, EMoV3, AV-2_3, CVV3, CiLRV3, SpLV3, TAMV1, PMoV3, BCRV1, SNSV1, CCR5_PRF, CMMV_psiA, R2_rz_Da, SESV, MIDV, MVEV, drz_Cjap_1, drz_Agam_2_1, Tetrahymena self-splicing intron (PDB) 1U6B), the group I self-splicing intron P4-P6 domain mutant U131A (PDB 6D8L), the self-splicing group I intron with two exons (E. coli, PDB 1U6B, chain AB), the Tetrahymena ribozyme conformation 5, and the Cryo-EM structure in the second self-splicing process (PDB7yG8), a lasso-like structure of an intron chimeric derivative of Group II Oceanobacillus iheyensis in the presence of NH4+ and MG2+. (PDB 5J01), relaxed pre-Tet-S1 state of the G264A mutant Tetrahymena I group intron with 6nt 3' / 5'-exons and 2-aminopurine nucleoside (PDB 8HD6), 3DEG_1|chain A|A / L-tRNA|Escherichia coli (562), 3DEG_2|chain B|P-tRNA|Escherichia coli (562), 3DEG_5|chain E [certified G]|50S RNA helix 42-44|Escherichia coli (562), 1ZZN_1|chain A [certified B]|197-MER|invalid, 7QR4_2|chain B|RNA CPEB3 ribozyme|Homo sapiens (9606), 7QR3_2|chain C, D|chimpanzee CPEB3 ribozyme|African chimpanzee (9598), repA of pMU720 mRNA leader region, plasmid ColIb-P9 REPZ RNA, Mycobacterium bovis leuA mRNA pseudoknot, 4MEG_1|strand A|glmS triple mutant ribozyme|invalid, 3B4A_2|strand B|glmS ribozyme RNA|Tengchong thermophilic anaerobes (119072), 3L3C_3|strand C [certified P], F [certified Q], I [certified R], L [certified S]|GLMS ribozyme|invalid, 1YMO_1|strand A|telomerase RNA P2b-P3 pseudoknot | invalid, 5KMZ_1 | chain A | telomerase RNA pseudoknot | Tetrahymena thermophila (5911), 486D_3 | chain C | 70S ribosome A-site TRNA | Saccharomyces cerevisiae (4932), 486D_5 | chain E | 70S ribosome E-site TRNA | Thermophila thermophila (274), 486D_6 | chain F | the penultimate stem of 16S rRNA in 70S ribosome | Thermophila thermophila (274), 486D_1 | chain A | 70S ribosome P-site TRNA | Escherichia coli (562), 4P8Z_1 | chain A | Partial IGS sequence of Calospira flavus, 18S rRNA gene, I-DirI gene and partial ITS1 | Calospira flavus (5793), 2NOQ_1 | chain A | CrPV IRES|Invalid, Triple Hairpin 1, Triple Hairpin 2, Triple Hairpin 3, Triple Hairpin 4, 5ML7_1|Strand A, B|23S Ribosomal RNA|Dead Sea Salt Box Bacteria (2238), 5NPM_2|Strand B|23S Ribosomal RNA|Thermophilic Bacteria (274), 1FG0_1|Strand A|23S Ribosomal RNA|Dead Sea Salt Box Bacteria (2238), 4V6U_21|Strand U [Certified A2]|16SrRNA|Firefly (186497), 4V6U_67|Strand SB[Certified B1]|23S rRNA| *Pyrococcus fibrillans* (186497), U64877.1:1-316 *Acholepsis reesei* ribonuclease P RNA (rnpB) gene, partial sequence, M19021.1:1-417 *Bacillus stearothermophilus* ribonuclease P RNA gene, CP000023.1:237422-237789 *Streptococcus thermophilus* LMG18311, complete genome, AGFN01000347.1:c13926-13555 *Streptococcus thermophilus* CNCM I-1630 contig 0409, whole genome shotgun sequence, *Pyrobaculum aerophilum* RNase P RNA, *Caidivirga maquillingensis* RNase P RNA, 4R4P_1|strand A|VS ribozyme RNA|Neurospora (5140), 4R4P_1|strand A|VS ribozyme RNA|Neurospora (5140) [tandem dimer], 4R4V_1|strand A|VS ribozyme RNA|Neurospora (5140), 4R4V_1|strand A|VS ribozyme RNA|Neurospora (5140) [tandem dimer], RNA ligase, class I ribozyme, B6.61 polymerase ribozyme, RNA ligase ribozyme construct b1-248, RNA ligase ribozyme, construct b1-207, 6H1K_1|strand A|DNA (28-MER)|Human Immunodeficiency Virus 1 (11676) [4X], 6H1K_1|strand A|DNA (28-MER)|Human Immunodeficiency Virus 1 (11676) [2X]、2M27_1|strand A|DNA_(5'-D(*CP*GP*GP*GP*GP*CP*GP*GP*CP*CP*TP*TP*GP*GP*GP*CP*GP*GP*GP*T)-3')_|Homo sapiens (9606) [4X]、2M27_1|strand A|DNA_(5'-D(*CP*GP*GP*GP*GP*CP*GP*GP*CP*CP*TP*TP*GP*GP*GP*CP*GP*GP*T)-3')_|Homo sapiens (9606) [2X]、GGGGCC hexanucleotide repeat sequence (4x), GGGGCC hexanucleotide repeat sequence (8x), TERRA(UUAGGG)4 RNA containing telomere repeat sequence, TERRA (UUAGGG)4 RNA containing telomere repeat sequence [2x]、TERRA (UUAGGG)4 contains telomere repeat sequences [6x], Nkx2-5 5' UTR G-quadruplex, immunoglobulin switching (S) region G-quadruplex, Ribox02 ribozyme, 6PRV_1|strand A, B, C, D|23SrRNA|Escherichia coli (562), 2Z74_2|strand B|glmS ribozyme RNA|, 2Z74_2|strand B|glmS ribozyme RNA|+target.
[0303] The following are 63 different sequences present in the cleavage subdomains selected in this screening: hammerhead ribozyme, hammerhead ribozyme, tRNA (gly), tRNA-Gly-CCC-1-1, tRNA-Gly-CCC-1-2, tRNA-Gly-CCC-3-1, tRNA-Gly-CCC-2-2, tRNA-Gly-CCC-2-1, tRNA-Gly-GCC-2-4, tRNA-Gly-GCC-2-5, tRNA-Gly-GCC-2-6, tRNA-Gly-GCC-2-1, tRNA-Gly-GCC-2-2, tRNA-Gly-GCC-1-1, tRNA-Gly-GCC-1-3 , tRNA-Gly-GCC-1-4, tRNA-Gly-GCC-1-5, tRNA-Gly-GCC-3-1, tRNA-Gly-GCC-4-1, tRNA-Gly-GCC-5-1, tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-1-1, tRNA-G ly-TCC-2-1, tRNA-Gly-TCC-2-2, tRNA-Gly-TCC-2-3, tRNA-Gly-TCC-2-4, tRNA-Gly-TCC-2-5, tRNA-Gly-TCC-2-6, tRNA-Gly-TCC-4-1, rice tRNA, MALAT1 mascRNA, 7QR4_2|Strand B|RNA CPEB3 ribozyme|Homo sapiens (9606), 7QR3_2|Strand C,D|Chimpanzee CPEB3 ribozyme|African chimpanzee (9598), 4R4P_1|Strand A|VS ribozyme RNA|Neurospora (5140), 4R4P_1|Strand A|VS ribozyme RNA|Neurospora (5140) [tandem dimer], 4R4V_1|Strand A|VS ribozyme RNA|Neurospora (5140), 4R4V_1|Strand A|VS ribozyme RNA|Neurospora (5140) [tandem dimer], Histone 3'UTR with SLBP and HDE H1-4, Histone 3'UTR with SLBP and HDE H2BC21D, Histone 3'UTR with SLBP and HDE H2AC20, Histone 3'UTR with SLBP and HDE H2BC13, Histone 3'UTR with SLBP and HDE Histone 3'UTR of H2AC25, Pri-miR-16-1, Pri-miR-30a, artificial microprocessor substrate, eIF4H exon 5, Pri-miR-7, snoRNA-1 targeting pseudouridine acidification, snoRNA-2 targeting pseudouridine acidification, scaRNA-9, scaRNA-2, 5K7C_1|strand A|RNA 47-MER|synthetic construct (32630), 5T5A_1|strand A|DNA / RNA (71-MER)|metagenomic (256318), 4OJI_1|strand A|RNA (52-MER)|nullable, 4RGE_1|strand A, B, C|env22 torsion ribozyme|synthetic (32630), 6JQ5_1|strand A, B|RNA (82-MER)|synthetic construct (32630), 6JQ5_1|strand A, B|RNA (82-MER)|Synthetic constructs (32630) dimer, Pri-miR-31(51+51), Pri-miR-31(51+51) / Pre-miR-HBV, Pri-miR-31(38+40) / Pre-miR-HBV, Pri-miR-31(30+31) / Pre-miR-HBV, Pri-miR-31(22+21) / Pre-miR-HBV,
[0304] The following are the different sequences present in the nuclear-preserved subdomains screened (13 sequences): MALATI-NucRet (5471-5951) Shukla et al. 2018, MALATI-NucRet (5971-6401) Shukla et al. 2018, MALATI-NucRet (6851-7241) Shukla et al. 2018, MalatI-NucRet (SpeckleF2) Wilusz et al. 2012, MALATI-NucRet (MALAT-E) Miyagawa et al. 2012, MALATI-NucRet (MALAT-M) Miyagawa et al. 2012, Jpx #9 lncRNA nuclear localization (Lubelsky 2018), Pvt1 lncRNA nuclear localization (Lubelsky 2018), Nr2f1-as1 lncRNA nuclear localization (Lubelsky 2018), Emx2os Nuclear localization of lncRNA (Lubelsky 2018), nuclear localization of Alusx lncRNA (Lubelsky 2018), nuclear localization of SIRLOIN lncRNA (Lubelsky 2018).
[0305] The resulting DNA library contained 13 * 63 * 136 = 111,384 distinct 3' domains. This trans-splicing RNA library was applied to cells, and long-read sequencing was used to identify the 3' domains that promoted the highest trans-splicing efficiency. In subsequent experiments, combinations of these subdomains were used to identify high-quality 3' domain designs that increased trans-splicing efficiency.
[0306] Example 2: In vitro evaluation of the RNA repair efficiency of the CEP290 gene To further investigate the activity of trans-splicing RNA molecules designed with an efficient 3' domain, trans-splicing RNA was transfected into cells expressing CEP290. RNA was extracted from these cells, and both CEP290 and the repaired form of CEP290 that underwent trans-splicing were reverse transcribed. The resulting RNA was subjected to qPCR and digital PCR to assess the efficiency of the trans-splicing reaction. The trans-splicing molecule editing efficiency was calculated as the amount of trans-spliced CEP290 divided by the sum of trans-spliced CEP290 and non-trans-spliced CEP290.
[0307] Example 3: Evaluation of the relative repair efficiency of various 3' domains A trans-splicing RNA library targeting intron 26 of CEP290 was created, containing various 3' domains. Each 3' domain has a set of associated unique barcodes. These barcodes were used to measure the relative RNA editing efficiency of each trans-splicing RNA 3' domain design. HEK293 cells were transfected with the library, and barcodes were amplified from the edited CEP290 gene. Long-read sequencing using an Oxford Nanopore system revealed the relative RNA editing activity of different 3' domains. Figure 3 ). 'C15 v1' refers to sequence SEQ ID NO:111, 'C15 v2' refers to sequence SEQ ID NO:109, 'C15 v3' refers to sequence SEQ ID NO:107, 'wild-type triplex v1' refers to sequence SEQ ID NO:113, 'wild-type triplex v2' refers to sequence SEQ ID NO:104, 'C14 v1' refers to sequence SEQ ID NO:108, 'C14 v2' refers to sequence SEQ ID NO:106, 'C15 v4' refers to sequence SEQ ID NO:103, and 'C14v3' refers to sequence SEQ ID NO:112.
[0308] Example 4: Evaluation of the relative repair efficiency of various 3' domains In this experiment, we compared the activity of thousands of different trans-splicing systems through pooled activity screening. First, we assembled double-stranded DNA sequences encoding various trans-splicing molecular components, including intronic and 3' domains. Random barcodes were also incorporated into these Golden Gate assembly reactions. The results of these reactions were random combinations of portions at predetermined positions for each part type. Each individual plasmid also carried a unique 33-nucleotide barcode.
[0309] Next, these libraries were sequenced using a Oxford Nanopore sequencer to map barcodes to specific combinations. The same libraries were then applied to HEK293 cells expressing the CEP290 gene. The trans-splicing CEP290 gene product was sequenced using a long-read sequencer, and barcode counting was used to evaluate the editing efficiency of each design as reported in the figure.
[0310] Figure 5The specific combinations of representative portions in the trans-splicing molecule, where the intron domains remain unchanged and only the 3' domain changes, are employed. The 3' domain consists of two parts (as shown in Table 2), and the trans-splicing molecule contains the sequences listed in SEQ ID NO:126-130 as shown below. In summary, the combination of specific structured sequences with twist ribozymes is superior to twist ribozymes alone. For example, the presence of the TERRA G-quadruplex upstream of the twist ribozyme increases editing efficiency compared to a single ribozyme. Editing efficiency is also enhanced when other structured sequences (such as the CPEB3 ribozyme) are combined with the twist ribozyme. Furthermore, the use of specific ribozymes promotes efficient trans-splicing.
[0311] Table 2.
[0312] The trans-splicing molecule in this embodiment contains the following sequence: Example 5: Splicing efficiency of a reverse splicing system targeting CEP290 A trans-splicing system library targeting intron 26 of CEP290 was constructed using the Golden Gate assembly technique. This library includes unique 33-base barcodes identifying each trans-splicing system, as well as intron domains, antisense domains, and 3' primer-terminal domains (including ribozymes and triple helices). Constant exon domains containing the first 26 exons of the CEP290 gene were incorporated. The assembly process yielded a library containing 3,825 different trans-splicing systems, which was then amplified in bacterial cultures and characterized using long-read sequencing to provide detailed information about the genetic constructs.
[0313] Using Oxford nanopore sequencing of the library, each unique barcode was mapped to a specific combination of assembled domains, ensuring that each combination of intron, antisense, and 3' primer-terminal domains could be explicitly linked to at least one unique barcode. This mapping was used to evaluate the performance of each trans-splicing system within the library. A mixture of barcoded trans-splicing systems encoded in DNA was introduced into HEK293 cells engineered to overexpress the CEP290 gene via promoter knock-in. Forty-eight hours post-transfection, RNA was extracted from these cells, and both the trans-splicing RNA product and its corresponding barcode were amplified using polymerase chain reaction (PCR).
[0314] like Figure 6A As shown, amplified barcodes were quantified and correlated back to their specific domain combinations. The abundance of each barcode acts as a proxy for RNA repair activity, allowing determination of the relative trans-splicing activity of each system within the library. For each 3' end domain, separate plots were generated to visualize the distribution of trans-splicing system activity. Dark gray distributions represent the activity levels of systems containing specific 3' primer end domains, while light gray distributions reflect the activity levels of the entire trans-splicing system library. The quality of the trans-splicing system was assessed based on two key metrics: the distribution shift and the area under the curve (AUC). A further rightward shift in the distribution indicates higher trans-splicing activity, and a larger AUC indicates a larger overall representation of systems with the listed 3' domains. Other types of ribozymes and structured sequences tested (data not shown) included: MALAT1 triple helix, lantern Rz2, chimpanzee CPEB3 ribozyme, pistol ribozyme, human CPEB3 ribozyme, env22 twist ribozyme, and axe ribozyme. Figures 6A-6B As shown, ribozymes (such as torsion enzyme-SNV, torsion sister enzyme, torsion enzyme WT (wild type), and lantern enzyme) are superior to other types of ribozymes. TSM contains the sequences listed in Table 4 below.
[0315] Example 6: Splicing efficiency of a reverse splicing system targeting SCN1A Libraries targeting the trans-splicing systems of introns 8, 11, and 17 of SCN1A were constructed using the Golden Gate assembly technique. The libraries included unique 33-base barcodes identifying each trans-splicing system, as well as intronic domains, antisense domains, and 3' primer-terminal domains (including ribozymes and triple helices). Depending on the targeted intron, constant exon domains containing exons 1-8, 1-11, or 1-17 of SCN1A were incorporated. The assembly process yielded libraries containing approximately 200,000 different trans-splicing systems, which were then amplified in bacterial cultures and characterized using long-read sequencing to provide detailed information about the genetic constructs.
[0316] Using Oxford nanopore sequencing of the library, each unique barcode was mapped to a specific combination of assembled domains, ensuring that each combination of intron, antisense, and 3' primer-terminal domains could be explicitly linked to at least one unique barcode. This mapping was used to evaluate the performance of each trans-splicing system within the library. A mixture of barcoded trans-splicing systems encoded in DNA was introduced into HEK293 cells engineered to overexpress the SCN1A gene via promoter knock-in. Forty-eight hours post-transfection, RNA was extracted from these cells, and both the trans-splicing RNA product and its corresponding barcode were amplified using polymerase chain reaction (PCR).
[0317] The amplified barcodes were quantified and correlated back to their specific domain combinations. The abundance of each barcode served as a proxy for RNA repair activity, allowing determination of the relative trans-splicing activity of each system within the library. For each of the three 3' end domains, a separate curve of relative trans-splicing activity was generated, showing the relative trans-splicing activity of each intron across trans-splicing systems containing annotated 3' end domains. Figure 7 ).
[0318] Based on the relative editing efficiency of each intron, select Figure 7 The optimal designs were selected and constructed into single plasmids. These selected designs were then subjected to digital PCR to measure the fraction of edited target SCN1A RNA. The results are presented in the accompanying bar chart at the bottom. The components of constructs P2594, P2585, P2566, and P2572 are shown in Table 3. TSM contains the sequences listed in Table 4 below.
[0319] Table 3.
[0320] Table 4.
[0321] The scope of this disclosure is not limited to the specific embodiments disclosed herein, which are provided to illustrate various aspects of this disclosure. Various modifications to the described compositions and methods will become apparent from the description and teachings herein. These changes may be practiced without departing from the true scope and spirit of this disclosure, and are intended to fall within the scope of this disclosure.
Claims
1. A trans-splicing nucleic acid molecule, said trans-splicing nucleic acid molecule comprising: (a) Exon domains; (b) an intronic domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) An antisense domain configured to bind to a target RNA molecule; and (d) A sequence or structure derived from or isolated from a ribozyme, wherein the ribozyme is selected from the group consisting of: VS ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, CPEB3 ribozyme, and riboswitches.
2. The trans-splicing nucleic acid molecule of claim 1, wherein the trans-splicing nucleic acid molecule further comprises a G-quadruplex and / or a pseudoknot, and optionally a poly(A).
3. The trans-splicing nucleic acid molecule of claim 2, wherein the trans-splicing nucleic acid molecule comprises: From 5' to 3': the G-quadruplex and / or the pseudoknot, and the sequence or structure derived from or isolated from the ribozyme, and optionally the poly(A) at the 3' end.
4. The trans-splicing nucleic acid molecule of claim 2, wherein the trans-splicing nucleic acid molecule comprises: From 5' to 3': the sequence or structure derived from or isolated from the ribozyme, the G-quadruplex and / or the pseudoknot, and optionally the poly(A) at the 3' end.
5. The trans-splicing nucleic acid molecule according to any one of claims 1 to 4, wherein the trans-splicing nucleic acid molecule does not contain hammerhead ribozyme or HDV ribozyme.
6. A trans-splicing nucleic acid molecule, said trans-splicing nucleic acid molecule comprising: (a) Exon domains; (b) an intronic domain configured to facilitate trans-splicing of ribonucleic acid (RNA); (c) An antisense domain configured to bind to a target RNA molecule; and d) Sequences or structures derived from or isolated from ribozymes, The trans-splicing nucleic acid molecule described therein does not contain 3' poly(A).
7. The trans-splicing nucleic acid molecule of claim 6, wherein the sequence or structure derived from or isolated from the ribozyme is located in the 3' domain of the trans-splicing nucleic acid molecule.
8. The trans-splicing nucleic acid molecule of claim 6, wherein the sequence or structure derived from or isolated from the ribozyme is located in the 5' domain of the trans-splicing nucleic acid molecule.
9. The trans-splicing nucleic acid molecule according to any one of claims 6 to 8, wherein the ribozyme is selected from the group consisting of: hammerhead ribozyme, HDV ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, VS ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, CPEB3 ribozyme, and riboswitch.
10. The trans-splicing nucleic acid molecule according to any one of claims 1 to 9, wherein the trans-splicing nucleic acid molecule comprises a sequence or structure derived from or isolated from a twisted ribozyme or a twisted sister ribozyme.
11. The trans-splicing nucleic acid molecule according to any one of claims 1 to 10, wherein the trans-splicing nucleic acid molecule comprises a sequence or structure derived from or isolated from a lantern ribozyme.
12. The trans-splicing nucleic acid molecule according to any one of claims 1 to 11, wherein the trans-splicing nucleic acid molecule comprises a sequence or structure derived from or isolated from a CPEB3 ribozyme, optionally wherein the CPEB3 ribozyme is a mammalian CPEB3 ribozyme, and optionally a human CPEB3 ribozyme or African chimpanzees CPEB3 ribozyme.
13. The trans-splicing nucleic acid molecule according to any one of claims 1 to 12, wherein the trans-splicing nucleic acid molecule comprises a sequence or structure derived from or isolated from a VS ribozyme.
14. The trans-splicing nucleic acid molecule according to any one of claims 1 to 13, wherein the trans-splicing nucleic acid molecule comprises a sequence or structure derived from or isolated from axe ribozyme.
15. The trans-splicing nucleic acid molecule according to any one of claims 1 to 14, wherein the ribozyme is a ribozyme derived from or isolated from a eukaryote, optionally wherein the eukaryote is a mammal, and optionally wherein the mammal is a human or African chimpanzees .
16. The trans-splicing nucleic acid molecule according to any one of claims 1 to 14, wherein the ribozyme is a ribozyme derived from or isolated from a virus.
17. The trans-splicing nucleic acid molecule according to any one of claims 1 to 14, wherein the ribozyme is a ribozyme derived from or isolated from a prokaryote, optionally wherein the prokaryote is a bacterium.
18. The trans-splicing nucleic acid molecule according to any one of claims 1 to 17, wherein the ribozyme is a mutant ribozyme.
19. The trans-splicing nucleic acid molecule according to any one of claims 1 to 17, wherein the ribozyme is an engineered ribozyme.
20. The trans-splicing nucleic acid molecule of any one of claims 1 to 19, wherein the ribozyme is derived from or encoded by the lncRNA.
21. The trans-splicing nucleic acid molecule according to any one of claims 1 to 20, wherein the ribozyme is a self-cleaving ribozyme.
22. The trans-splicing nucleic acid molecule according to any one of claims 1 to 20, wherein the ribozyme is an autoalkylating ribozyme.
23. The trans-splicing nucleic acid molecule of any one of claims 1 to 22, wherein the ribozyme comprises one or more pseudoknots.
24. The trans-splicing nucleic acid molecule of any one of claims 1 to 23, wherein the ribozyme is regulated by or requires one or more metal ion cofactors.
25. The trans-splicing nucleic acid molecule of claim 24, wherein the one or more metal ion cofactors comprise divalent cations.
26. The trans-splicing nucleic acid molecule of claim 25, wherein the one or more metal ion cofactors include Mg. 2+ .
27. The trans-splicing nucleic acid molecule of any one of claims 1 to 23, wherein the trans-splicing nucleic acid molecule comprises a 3' domain, the 3' domain comprising a cleavage domain, wherein the sequence or structure derived from or isolated from the ribozyme is a first ribozyme sequence or structure, and optionally wherein the cleavage domain comprises: a second ribozyme sequence or structure that is the same as or different from the first ribozyme sequence or structure; a microprocessor substrate; an RNase P / Z substrate; or any combination thereof.
28. The trans-splicing nucleic acid molecule of claim 27, wherein the cleavage domain comprises the sequence or structure derived from or isolated from the ribozyme.
29. The trans-splicing nucleic acid molecule of claim 27, wherein the cleavage domain does not contain the sequence or structure derived from or isolated from the ribozyme.
30. The trans-splicing nucleic acid molecule according to any one of claims 1 to 29, wherein the trans-splicing nucleic acid molecule comprises a 3' domain, the 3' domain comprising a stabilizing domain.
31. The trans-splicing nucleic acid molecule of claim 30, wherein the stabilizing domain comprises the sequence or structure derived from or isolated from the ribozyme.
32. The trans-splicing nucleic acid molecule of claim 30, wherein the stabilizing domain does not contain the sequence or structure derived from or isolated from the ribozyme.
33. The trans-splicing nucleic acid molecule of claim 32, wherein the stabilizing domain comprises a G-quadruplex and / or a pseudoknot.
34. The trans-splicing nucleic acid molecule of claim 33, wherein the stabilizing domain comprises a G-quadruplex.
35. The trans-splicing nucleic acid molecule of claim 33, wherein the stabilizing domain comprises a pseudoknot.
36. The trans-splicing nucleic acid molecule according to any one of claims 1 to 35, wherein the trans-splicing nucleic acid molecule comprises a 3' domain, the 3' domain comprising a nuclear-retaining domain, optionally wherein the nuclear-retaining domain comprises a triple helix (optionally viral or human triple helix), a pseudoknot, a riboswitch, a G-quadruplex (optionally telomerase G-quadruplex), RNase pRNA, a stem-loop structure, snoRNA, or any combination thereof.
37. The trans-splicing nucleic acid molecule of claim 36, wherein the nuclear-retaining domain comprises the sequence or structure derived from or isolated from the ribozyme.
38. The trans-splicing nucleic acid molecule of claim 36, wherein the nuclear-retained domain does not contain the sequence or structure derived from or isolated from the ribozyme.
39. The trans-splicing nucleic acid molecule according to any one of claims 1 to 38, wherein the trans-splicing nucleic acid molecule comprises a 3' domain, the 3' domain comprising from 5' to 3': the G-quadruplex and / or the pseudoknot and the sequence or structure derived from or isolated from the ribozyme.
40. The trans-splicing nucleic acid molecule of any one of claims 1 to 38, wherein the trans-splicing nucleic acid molecule comprises a 3' domain, the 3' domain comprising, from 5' to 3': the sequence or structure derived from or isolated from the ribozyme, and the G-quadruplex and / or the pseudoknot.
41. A trans-splicing nucleic acid molecule, said trans-splicing nucleic acid molecule comprising, from 5' to 3', the following operably linked domains: (a) Exon domains; (b) An intronic domain comprising a 5' splice site, a branching site, and a polypyrimidine region; (c) An antisense domain configured to bind to a target RNA molecule; and (d) A 3' domain, wherein the 3' domain contains a sequence or structure derived from or isolated from a ribozyme. The trans-splicing nucleic acid molecule is configured to trans-splice the exon domain to the exon of the target RNA molecule.
42. The trans-splicing nucleic acid molecule of claim 41, wherein the antisense domain is configured to hybridize with an intron of the target RNA molecule, the intron being located at the 5' of the exon of the target RNA molecule.
43. A trans-splicing nucleic acid molecule, said trans-splicing nucleic acid molecule comprising, from 5' to 3', the following operably linked domains: (a) An antisense domain configured to bind to a target RNA molecule; (b) An intronic domain comprising a branching site, a polypyrimidine region, and a 3' splice site; (c) Exon domains; and (d) A 3' domain, wherein the 3' domain contains a sequence or structure derived from or isolated from a ribozyme. The trans-splicing nucleic acid molecule is configured to trans-splice the exon domain to the exon of the target RNA molecule.
44. The trans-splicing nucleic acid molecule of claim 43, wherein the antisense domain is configured to hybridize with an intron of the target RNA molecule, the intron being located at the 3' of the exon of the target RNA molecule.
45. The trans-spliced nucleic acid molecule of any one of claims 41 to 44, wherein the intron domain comprises an intron splicing enhancer sequence.
46. The trans-splicing nucleic acid molecule of claim 41 or claim 42, wherein the intron domain comprises the 5' splicing site, the intron splicing enhancer sequence, the branching site, and the polypyrimidine region.
47. The trans-splicing nucleic acid molecule of claim 43 or claim 44, wherein the intron domain comprises an intron splicing enhancer sequence, the branching site, the polypyrimidine region, and the 3' splicing site.
48. The trans-spliced nucleic acid molecule of any one of claims 41 to 47, wherein the exon domain comprises an exon splicing enhancer sequence.
49. The trans-splicing nucleic acid molecule of any one of claims 41 to 48, wherein the 3' domain further comprises a structured sequence located at the 5' of the sequence or structure derived from or isolated from the ribozyme.
50. The trans-splicing nucleic acid molecule of claim 49, wherein the structured sequence comprises a G-quadruplex, a pseudoknot, and / or a triple helix.
51. The trans-splicing nucleic acid molecule according to any one of claims 41 to 50, wherein the trans-splicing nucleic acid molecule further comprises a nuclear-retaining domain.
52. The trans-splicing nucleic acid molecule of claim 51, wherein the 3' domain comprises the nuclear-retaining domain, the nuclear-retaining domain being located at the 5' of the sequence or structure derived from or isolated from the ribozyme.
53. The trans-splicing nucleic acid molecule of claim 52, wherein the 3' domain from 5' to 3' comprises: the nuclear-retaining domain, the structured sequence, and the sequence or structure derived from or isolated from the ribozyme.
54. The trans-splicing nucleic acid molecule according to any one of claims 41 to 53, wherein the 3' domain does not include any one or more of a triple helix, an RNase P cleavage site, an tRNA-like domain, and a poly(A) tail.
55. The trans-splicing nucleic acid molecule according to any one of claims 41 to 54, wherein the trans-splicing nucleic acid molecule does not contain any one or more of a triple helix, an RNase P cleavage site, an tRNA-like domain, and a poly(A) tail.
56. The trans-splicing nucleic acid molecule according to any one of claims 41 to 55, wherein the ribozyme is selected from the group consisting of: VS ribozyme, torsion ribozyme, torsion sister ribozyme, lantern ribozyme, pistol ribozyme, hairpin ribozyme, lead ribozyme, axe ribozyme, GIR1 branched ribozyme, glmS ribozyme, class I intron, class II intron, RNase P, CoTC ribozyme, Holick ribozyme, Walkud satellite ribozyme, CPEB3 ribozyme, and riboswitch.
57. The trans-splicing nucleic acid molecule of any one of claims 41 to 56, wherein the sequence or structure derived from or isolated from the ribozyme has cleavage activity.
58. The trans-splicing nucleic acid molecule of any one of claims 41 to 56, wherein the sequence or structure derived from or isolated from the ribozyme does not have cleavage activity.
59. A trans-splicing nucleic acid molecule, said trans-splicing nucleic acid molecule comprising, from 5' to 3', the following operably linked domains: (a) Exon domains; (b) An intronic domain comprising a 5' splice site, a branching site, and a polypyrimidine region; (c) An antisense domain configured to bind to a target RNA molecule; and (d) A 3' domain, the 3' domain comprising from 5' to 3': (i) a G-quadruplex or pseudoknot, and (ii) a sequence or structure derived from or isolated from a twisted ribozyme or a twisted sister ribozyme. The trans-splicing nucleic acid molecule is configured to trans-splice the exon domain to the exon of the target RNA molecule.
60. The trans-splicing nucleic acid molecule of claim 59, wherein the trans-splicing nucleic acid molecule does not contain any one or more of a triple helix, an RNase P cleavage site, an tRNA-like domain, and a poly(A) tail.
61. The trans-splicing nucleic acid molecule according to any one of claims 1 to 60, wherein the sequence or structure derived from or isolated from the ribozyme improves the trans-splicing efficiency of the trans-splicing nucleic acid molecule.
62. The trans-spliced nucleic acid molecule of claim 61, wherein the trans-splicing efficiency is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or 1000% compared to a reference trans-spliced nucleic acid molecule that does not have the sequence or structure derived from or isolated from the ribozyme.
63. The trans-splicing nucleic acid molecule of claim 61 or claim 62, wherein the trans-splicing nucleic acid molecule further comprises a G-quadruplex and / or a pseudoknot to improve the trans-splicing efficiency of the trans-splicing nucleic acid molecule.
64. The trans-spliced nucleic acid molecule of claim 63, wherein the trans-splicing efficiency is increased by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or 1000% compared to a reference trans-spliced nucleic acid molecule that does not have the sequence or structure derived from or isolated from the ribozyme and the G-quadruplex and / or the pseudoknot.
65. The trans-splicing nucleic acid molecule of any one of claims 1 to 64, wherein the target RNA molecule is in a cell.
66. The trans-splicing nucleic acid molecule according to any one of claims 1 to 64, wherein the target RNA molecule is messenger RNA (mRNA) or precursor mRNA.
67. The trans-splicing nucleic acid molecule of any one of claims 1 to 64, wherein the target RNA molecule contains a mutation.
68. The trans-splicing nucleic acid molecule of claim 67, wherein the mutation is selected from the group consisting of: missense mutations, nonsense mutations, frameshift mutations, insertions, duplications, inversions, deletions, splice site mutations, and truncation mutations.
69. The trans-splicing nucleic acid molecule of claim 67, wherein the mutation is a disease-causing mutation.
70. The trans-splicing nucleic acid molecule of any one of claims 1 to 69, wherein the trans-splicing nucleic acid molecule is packaged in or encoded by the viral vector for delivery to a subject in need.
71. The trans-splicing nucleic acid molecule of claim 70, wherein the viral vector is a herpes simplex virus (HSV) vector.
72. The trans-splicing nucleic acid molecule of claim 70, wherein the viral vector is an adeno-associated virus (AAV) vector.
73. The trans-splicing nucleic acid molecule of any one of claims 1 to 72, wherein the exon domain comprises one or more functional exons of a gene associated with a disease or condition.
74. A composition comprising a viral vector as described in any one of claims 70 to 72 and a pharmaceutically acceptable carrier or excipient.
75. The trans-splicing nucleic acid molecule of any one of claims 1 to 69, wherein the trans-splicing nucleic acid molecule is packaged in or encoded by nucleic acids in the lipid nanoparticles for delivery to a subject in need.
76. A composition comprising the lipid nanoparticles as described in claim 75 and a pharmaceutically acceptable carrier or excipient.
77. The trans-splicing nucleic acid molecule of any one of claims 1 to 69, wherein the engineered nucleic acid is packaged in a vesicle or encoded by a nucleic acid in the vesicle for delivery to a subject in need.
78. A composition comprising the vesicles as described in claim 77 and a pharmaceutically acceptable carrier or excipient.
79. A cell comprising a trans-spliced nucleic acid molecule or composition as described in any one of claims 1 to 78.
80. The trans-spliced nucleic acid molecule, composition, or cell as described in any one of claims 1 to 79, wherein the trans-spliced nucleic acid molecule, composition, or cell is used to treat diseases and / or correct genetic defects in subjects in need.
81. The use of any of the trans-spliced nucleic acid molecules, compositions or cells as described in any one of claims 1 to 79 for the treatment of diseases and / or correction of genetic defects in subjects in need.
82. Use of any of the trans-spliced nucleic acid molecules, compositions or cells as described in any one of claims 1 to 79 in the manufacture of a medicament for treating a disease and / or correcting a genetic defect in a subject in need.
83. A method for treating a disease and / or correcting a genetic defect in a subject in need, the method comprising administering to the subject a therapeutically effective amount of a trans-spliced nucleic acid molecule, composition, or cell as described in any one of claims 1 to 79.
84. A method for treating cells, the method comprising contacting the cells with a trans-spliced nucleic acid molecule or composition as described in any one of claims 1 to 78.
85. The method of claim 84, wherein the method is performed in vitro, and optionally, the cells are primary cells, cultured cells, or transformed cells isolated from the subject.