A method for producing l-valine

By genetically engineering Escherichia coli and optimizing the L-valine production pathway, the problems of high cost and numerous byproducts in existing technologies have been solved, achieving efficient and low-cost L-valine production.

CN122214224APending Publication Date: 2026-06-16MEIHUA BIOTECH LANGFANG CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
MEIHUA BIOTECH LANGFANG CO LTD
Filing Date
2024-12-16
Publication Date
2026-06-16

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

Provided are modified bacteria that produce L-valine, wherein the bacteria comprise a modification in the genome that inactivates NagA, and the modified bacteria can produce L-valine under anaerobic and aerobic conditions. Also provided are methods of using the modified bacteria to increase L-valine production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This disclosure pertains to the field of bacterial fermentation, and particularly relates to a method for producing L-valine by using bacterial fermentation. Background Technology

[0002] L-valine is a natural essential amino acid widely used in animal feed. Therefore, there is an urgent need to improve L-valine production to reduce its production costs, ensure feed supply, and replace soybean meal, which is of great significance to national food security.

[0003] There are several methods for producing L-valine, including extraction, synthesis, and fermentation. Extraction is costly and unsuitable for modern industrial production; chemical synthesis is not only costly and complex, with numerous steps and many byproducts; fermentation, utilizing microbial fermentation, is a highly economical method due to its low raw material costs, mild reaction conditions, and large-scale production potential. Many strains are used for L-valine production, with Corynebacterium glutamicum and Escherichia coli being the most frequently reported. Anaerobic growth rescue has transformed Escherichia coli from mixed acid fermentation to isoform fermentation of n-butanol, D-lactic acid, succinic acid, ethanol, and L-alanine. The principle is to block the NADH consumption pathway in Escherichia coli, thus depriving it of its anaerobic growth ability, and then introduce the NADH consumption pathway, thereby rescuing it from anaerobic growth. This is a highly efficient breeding method.

[0004] E. coli nagA The gene encodes N-acetylglucosamine-6-phosphate deacetylase. The metabolic pathway involved includes the participation of N-acetylglucosamine-6-phosphate deacetylase in the metabolism of N-acetylglucosamine. N-acetylglucosamine is an important amino sugar involved in various biological processes in organisms, such as cell wall synthesis. In *E. coli*, this enzyme catalyzes the deacetylation of N-acetylglucosamine-6-phosphate to produce glucosamine-6-phosphate, which is one of the key steps in the metabolic pathway of glucosamine entering cells. nagA Genes not only encode enzymes with metabolic functions, but also play a role in the regulation of gene expression. Studies have shown that... nagA Gene mutations can lead to the accumulation of N-acetylglucosamine-6-phosphate, and this accumulation can affect... nagThe expression of the regulator of the operon, and consequently the expression of genes related to N-acetylglucosamine uptake and metabolism, suggests a potential role for N-acetylglucosamine-6-phosphate deacetylase in gene expression regulation. The structural and functional characteristics of N-acetylglucosamine-6-phosphate deacetylase are closely related to its catalytic activity. Its active site contains specific amino acid residues that participate in substrate binding and catalytic reactions. Through specific binding to the substrate N-acetylglucosamine-6-phosphate, the enzyme can efficiently catalyze deacetylation to produce the product glucosamine-6-phosphate. Summary of the Invention

[0005] On the one hand, this disclosure provides a modified bacterium for producing L-valine, wherein the bacterium includes a NagA-inactivating modification compared to unmodified bacteria.

[0006] In one specific embodiment, the modification that inactivates NagA is a termination mutation at any amino acid position of NagA or is derived from... nagA Termination mutations caused by frameshift mutations in genes, preferably, the frameshift mutation is nagA The deletion of base G at position 422 of the gene results in a mutation at position 141 of the amino acid sequence, where glycine is replaced by alanine. After the frameshift mutation, position 169 of the sequence becomes a stop codon.

[0007] In one specific embodiment, the modified bacteria comprises a nucleic acid sequence as shown in SEQ ID NO: 47 or an amino acid sequence as shown in SEQ ID NO: 48.

[0008] In one specific implementation, the modified bacteria are selected from Escherichia coli.

[0009] In one specific embodiment, the modified bacteria further includes a mutation in the leucine dehydrogenase LeuDH-encoded protein that increases L-valine production; preferably, the mutation is selected from LeuDH. V22I .

[0010] In one specific implementation, the modified bacteria, wherein the LeuDH is derived from lysine-containing Bacillus.

[0011] In one specific implementation, the modified bacteria comprises one or more LeuDH cells. V22I Gene copies are preferably two to eleven, such as two, three, four, five, six, seven, eight, nine, ten, or eleven copies, with eight or ten copies being more preferred.

[0012] In one specific embodiment, the modified bacteria further includes an amino acid sequence mutation of the acetylhydroxy acid synthase IlvBN, preferably, the mutation being selected from IlvBN. G20D IlvBN V21D and IlvBN M22F .

[0013] In one specific implementation, the modified bacteria further includes modifications to reduce the production of byproducts.

[0014] In one specific implementation, the modified bacteria, wherein the modification that reduces byproduct production is selected from... avtA, ldhA, mgsA, frd, pflB, adhE, ackA, alaA and / or alaC All knockouts, truncations, and simultaneous repair of frameshift mutations to wild type, or other truncation forms with activity reduction of more than 10%.

[0015] In one specific embodiment, the modified bacteria contain transhydrogenase. pntAB Activity-enhancing modifications, preferably, the modifications are selected from... pntAB The modification increases the gene copy number and the promoter modification, preferably the promoter modification is the insertion of a strong Ptac or PldhA promoter.

[0016] In one specific implementation, the modified bacteria comprise nadK Activity-enhancing modifications, preferably, the modifications are selected from... nadK The modification increases the gene copy number and the promoter modification, preferably the promoter modification is the insertion of a strong Ptac or PldhA promoter.

[0017] In one specific implementation, the modified bacteria further comprises ilvC , ilvD and / or ilvE One or more modifications that enhance activity.

[0018] In one specific implementation, the modified bacteria comprises one or more... ilvC Gene copies are preferably two to ten, such as two, three, four, five, six, seven, eight, nine, or ten copies, with five copies being more preferred.

[0019] In one specific implementation, the modified bacteria comprises one or more... ilvD Gene copies are preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with four copies being more preferred.

[0020] In one specific implementation, the modified bacteria comprises one or more... ilvE Gene copies are preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with three copies being more preferred.

[0021] In one specific implementation, the modified bacteria are grown under anaerobic or aerobic conditions.

[0022] On the other hand, the use of the modified bacteria described in this disclosure in increasing L-valine production is provided.

[0023] On the other hand, a method for producing L-valine is provided, comprising culturing the modified bacteria described in this disclosure in a culture medium.

[0024] In one specific embodiment, the culture medium contains glucose.

[0025] In one specific embodiment, the method further includes separating L-valine.

[0026] On the other hand, a bioreactor includes the modified bacteria described in this disclosure.

[0027] Beneficial effects The genetically engineered bacteria disclosed herein have a high valine conversion rate. Attached Figure Description This disclosure can be more fully understood with reference to the following figures.

[0028] Figure 1 The anaerobic valine metabolic pathway in Escherichia coli is shown.

[0029] Figure 2 The diagram shows the superposition of Synthesized 1.0 and Synthesized 2.0 respectively. nagA Changes in L-valine production due to mutation. Detailed Implementation

[0030] The following description of this disclosure is merely intended to illustrate various embodiments of the disclosure. Therefore, the specific modifications discussed should not be construed as limiting the scope of this disclosure. It will be apparent to those skilled in the art that various equivalents, changes, and modifications can be made without departing from the scope of this disclosure, and it should be understood that these equivalent embodiments are included herein. All references cited herein, including publications, patents, and patent applications, are incorporated herein by reference in their entirety.

[0031] To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.

[0032] Experimental Materials and Methods (1) Strains and culture media Plasmids were constructed using *Escherichia coli* DH5α as the cloning host, and *E. coli* Synthesized 1.0 was used as the starting strain for modification. The cultures were incubated at 37°C on LB broth (liquid or solid). The LB broth formulation consisted of 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride. 1.5-2% agar powder was added to the solid culture. The working concentrations of the antibiotics used were: kanamycin 50 µg / mL, spectinomycin 100 µg / mL, chloramphenicol 25 µg / mL, and bleomycin 50 µg / mL. L-rhamnose and L-arabinose were added at a concentration of 10 mM.

[0033] NBSA and AM1A media supplemented with 2-12% (w / v) glucose were used as acclimatization and fermentation media, respectively, as shown in Table 1. Taking 2% glucose supplementation as an example, the medium is referred to as NBSAG20 or AM1AG20, where G represents glucose and 20 represents the glucose concentration (g / L). In the initial acclimatization for valine production, the strain was grown in antibiotic-free NBSA inorganic salt medium at 37°C, with 100 mM ammonium sulfate, 1 mM betaine, and 2% (w / v) glucose added. The strains involved in this disclosure are shown in Table 3.

[0034] Table 1. Formulations of NBS and AM1 culture media

[0035] Table 2. Micronutrient formulation

[0036] Table 3. Strains used

[0037] (2) Construction methods of strains and plasmids The pTargetF series plasmids were constructed by replacing the N20-1 sequence (catcgccgcagcggtttcag) on ​​pTargetF (Addgene: 62226) using QuickChange. The pTargetF plasmid names and their corresponding N20 sequences used in strain construction are shown in Table 4.

[0038] Table 4. Plasmids used in this disclosure

[0039] Table 5. Primers used in this disclosure

[0040] (3) Anaerobic fermentation in acclimatization bottles Single colonies were streaked to separate the acclimatized bacteria. Individual colonies were inoculated into 4 mL of LB broth and cultured at 37°C and 240 rpm for 24 h. 1% of the culture was transferred to 250 mL sealed Erlenmeyer flasks and cultured on NBS AG50 medium at 37°C and 120 rpm for 18 h. 10% of the culture was inoculated into 500 mL sealed Erlenmeyer flasks on AMI AG100 medium and cultured at 37°C and 500 rpm. The pH was adjusted to 7.0 with 30-50% concentrated ammonia and cultured for 24 h.

[0041] (4) Determination of valine yield by high performance liquid chromatography Using a UV spectrophotometer at 600 nm (OD) 600 E. coli biomass was determined by absorbance at a specific temperature. Glucose concentration was determined using an SBA-40C biosensor (Shandong Academy of Sciences, China) or high-performance liquid chromatography (HPLC). L-valine concentration was determined by HPLC after derivatization with phthalaldehyde. The mobile phase consisted of an acetonitrile / water (50:50, v / v) mixture and 50 mM sodium acetate at a flow rate of 1 mL / min, and the UV detection wavelength was 360 nm.

[0042] Example To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.

[0043] Example 1: Constructing Synthesized 1.0 L-valine exhibits feedback inhibition of acetylhydroxyl synthase, the first-step enzyme derived from pyruvate. Acetylhydroxyl synthase is a heterodimer encoded by IlvB and IlvN. Mutations in IlvN (G20D, V21D, M22F) can relieve the feedback inhibition of L-valine (Park, JH, etc.). [Fed-Batch Culture of Escherichia coli for L-Valine Production Based on In Silico Flux Response Analysis. Biotechnology and Bioengineering 2011, 108, 934-946, doi:10.1002 / bit.22995). The second-step enzyme, acetylhydroxyl isomerase, is... ilvC The encoding, with a cofactor preference of NADPH, is used. The third-step enzyme, dihydroxy acid dehydratase, is... ilvD Encoding. The final enzyme step is... ilvE The encoded branched-chain amino acid aminotransferase, with NADPH as the preferred cofactor for the synthesis of the amino donor L-glutamate. This disclosure, in addition to introducing anti-feedback inhibition in *E. coli* ATCC 8739, also discloses... ilvBN In addition, an extra copy is expressed via the tac promoter. ilvED and Corynebacterium glutamicum sources that prefer NADH ilvC and Lysine-containing Bacillus leuDH To utilize NADH produced in the upstream pathway, the L-valine synthesis pathway was made the sole pathway consuming pyruvate and NADH. Key enzymes in this pathway, such as ethanol, acetic acid, lactate, succinic acid, and formic acid, were knocked out. adhE, ackA, ldhA, mgsA, frd, pflB and avtA Additionally, proteins encoding branched-chain amino acid export proteins will be included. ygaZH and global regulatory factors lrp Enhancement was also achieved using the TAC promoter. To address the generation of L-alanine byproducts, two additional alanine synthesis-related aminotransferases were knocked out. alaA and alaC And further through integration of PldhA- ilvCcg ,PldhA- leuDH ,PldhA- ilvBN (G20D, V21D, M22F), PldhA- ilvD and Ptac- ilvC These five expression boxes enhance the terminal pathway. For added protection, PldhA- is also integrated. nadK and Ptac- pntAB To enhance NADPH supply, a Synthesized 1.0 strain was obtained ( Figure 1The specific construction structure of the Synthesized 1.0 strain is as follows: 1.1 In adhE Site insertion P tac- ilvBN mut (1) Construction of pEcgRNA-adhE plasmid: The synthesized oligosaccharide nucleic acids adhE-F / adhE-R were annealed and self-assembled to form a double-stranded sequence. The reaction system consisted of: 5 μl T4 ligase buffer, 5 μl primer adhE-F (20 μM), 5 μl primer adhE-R (20 μM), and 35 μl ddH2O. The reaction conditions were: incubation at 95℃ for 5 min, decreasing the temperature by 5–10℃ per minute, followed by incubation at 16℃ for 10 min. The self-assembled double-stranded sequence was diluted 200-fold, and 1 μl of the sequence was ligated with the BsaI-digested linearized fragment of pEcgRNA (Addgene: 166581) using T4 ligase. The ligation product was transformed into DH5α chemocompetent cells, and the recovered bacterial culture was plated on LB agar plates containing spectinomycin (final concentration 50 μg / mL) to obtain transformants containing the pEcgRNA-adhE plasmid.

[0044] (2) Preparation of electroporation fragments: Following the method described in patent document CN112662607A, the plasmid pTargetT-Ptac-stlA(exo) was constructed using the following steps: With Escherichia coli E.coliUsing the Nissle 1917 genome as a template, PCR amplification was performed using primers exo-F1 / exo-R1 and exo-F2 / exo-R2 to obtain exo-UP and exo-DN fragments, each approximately 600 bp. Using p57-tac plasmid as a template and primers tac(exo)-F / tac-R, PCR amplification was performed on the tac(exo) fragment, approximately 2.1 kb. Using pTargetT-Ptac-stlA(rhtC) plasmid as a template and primers stlA(rhtC)-F / stlA(exo)-R, PCR amplification was performed on the stlA(exo) fragment, approximately 1.6 kb. The exo-UP, tac(exo), stlA(exo), and exo-DN fragments were then assembled using DNA assembly. The kit was purchased from TransGen. The pTargetF-exo plasmid (modified from Addgene: 62226, with the N20-1 sequence (catcgccgcagcggtttcag changed to N20: tttattgatatatttacgtc) was cloned into the EcoRI / HindIII site to obtain the pTargetT-Ptac-stlA(exo) plasmid.

[0045] by E . coli Using the ATCC8739 genome as a template, PCR amplification was performed using primers adhE-F1(KO) / adhE-R1(KO), adhE-F2(KO) / adhE-R2(KO), ilvBNm-F1 / ilvBNm-R1, and ilvBNm-F2 / ilvBNm-R2 to obtain adhE-UP, adhE-DN, ilvBNm-1, and ilvBNm-2 fragments, approximately 530 bp, 550 bp, 1.8 kb, and 400 bp, respectively. Using the pTargetT-Ptac-stlA(exo) (CN112662607A) plasmid as a template, PCR amplification was performed using primers Ptac-F(TY) / Ptac-R to obtain the Ptac fragment, approximately 200 kb. Using adhE-UP, adhE-DN, ilvBNm-1, ilvBNm-2, and Ptac fragments as templates, and adhE-F1(KO) / adhE-R2(KO) as primers, overlap PCR was used to amplify the Ptac-ilvBNm(adhE) fragment, approximately 3.4 kb.

[0046] (3) Preparation of competent cells: The pEcCas (MC_0101208) plasmid was transformed into *E. coli* ATCC 8739 chemically competent cells. Transformants were obtained by screening on LB agar plates containing kanamycin (50 μg / mL) (the preparation method for chemically competent cells is described in *Molecular Cloning: A Laboratory Manual*, 3rd edition). Single colonies of ATCC8739 / pEcCas were picked and incubated in 4 mL LB tubes containing kanamycin (50 μg / mL) at 37°C and 220 rpm. 600 When the concentration was 0.4, arabinose was added to a final concentration of 10 mM for induction, and the cells were cultured for another hour to prepare electrocompetent cells (see reference for the method of preparing electrocompetent cells). Li, 2021, Acta Biochim Biophys Sin. ibid. ).

[0047] (4) Electro-rotation: The Ptac-ilvBNm(adhE) fragment and pEcgRNA-adhE plasmid were electroporated into ATCC8739 / pEcCas competent cells (electroporation conditions: 2.5 kV, 200 Ω, 25 μF), plated on LB plates containing spectinomycin (50 μg / ml) and kanamycin (50 μg / ml), and incubated overnight at 37°C. Single colonies were grown and colony PCR was performed using the adhE-VF / ilvBN-VR primers to verify the colony PCR. The positive fragment was approximately 1 kb.

[0048] (5) Loss of pEcgRNA-adhE plasmid: Single colonies that were positive for PCR were picked and inoculated into LB tubes containing kanamycin (final concentration 50 μg / ml), along with 10 mM rhamnose, and incubated overnight at 37°C. The next day, the bacterial culture was streaked directly onto LB agar plates containing kanamycin (final concentration 50 μg / ml) and incubated overnight at 37°C. The following day, single colonies were picked and transferred to LB agar plates containing spectinomycin (final concentration 50 μg / ml). If no growth was observed, it indicated that the pEcgRNA-adhE plasmid had been lost, yielding ATCC8739 (△). adhE :: P tac- ilvBN mut ) / pEcCas strain.

[0049] (6) loss of pEcCas plasmid: Select ATCC 8739 (△) adhE :: P tac- ilvBN mutpEcCas positive clones were directly cultured overnight at 37°C on an antibiotic-free LB broth using a shaker. A small amount of bacterial culture was then streaked onto 10 g / L sucrose LB agar plates for single colony agarization. Single colonies were identified on LB agar plates containing kanamycin (50 μg / mL) to verify pEcCas plasmid elimination. ATCC8739 (△) was obtained. adhE :: P tac- ilvBN mut ).

[0050] 1.2. avtA Site insertion P tac- leuDH (1) Construction of pEcgRNA-avtA plasmid: The synthesized oligosaccharide nucleic acids avtA-F / avtA-R were annealed and self-assembled to form a double-stranded sequence. The reaction system consisted of: 5 μl T4 ligase buffer, 5 μl primer avtA-F (20 μM), 5 μl primer avtA-R (20 μM), and 35 μl ddH2O. The reaction conditions were: 95℃ for 5 min, decreasing the temperature by 5–10℃ per minute, followed by incubation at 16℃ for 10 min. The self-assembled double-stranded sequence was diluted 200-fold, and 1 μl of the sequence was ligated with the BsaI-digested linearized fragment of pEcgRNA using T4 ligase. The ligation product was transformed into DH5α chemocompetent cells, and the recovered bacterial culture was plated on LB agar plates containing spectinomycin (final concentration 50 μg / mL) to obtain transformants containing the pEcgRNA-avtA plasmid.

[0051] (2) Preparation of electroporation fragments: Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers avtA-F1(KO) / avtA-R1(KO) and avtA-F2(KO) / avtA-R2(KO) to obtain avtA-UP and avtA-DN fragments, approximately 500 bp each. Using the pTargetT-Ptac-stlA(exo) plasmid (CN112662607A) as a template, PCR amplification was performed using primers Ptac-F(avtA) / Ptac-R to obtain the Ptac(avtA) fragment, approximately 200 bp. Using the pUC-leuDH plasmid (synthesized by GenScript) as a template, PCR amplification was performed using primers leuDH-F / leuDH-R to obtain the leuDH gene sequence, approximately 1.1 bp. Using avtA-UP, avtA-DN, Ptac(avtA), and leuDH fragments as templates and avtA-F1(KO) / avtA-R2(KO) as primers, overlap PCR was used to amplify the Ptac-leuDH(avtA) fragment, approximately 2.3 kb.

[0052] (3) Preparation of competent cells: The pEcCas (Addgene: 62225) plasmid was transformed into E. coli ATCC 8739 (△ adhE :: P tac- ilvBN mut ) competent cells were screened on LB agar plates containing kanamycin (50 μg / mL) to obtain ATCC8739 (△ adhE :: P tac- ilvBN mut Competent cells / pEcCas transformants (for the preparation of competent cells through chemical transformation, refer to *Molecular Cloning: A Laboratory Manual* (3rd edition)). Select ATCC 8739 (△) adhE :: P tac- ilvBN mut A single colony of pEcCas was cultured in a 4 mL LB tube containing kanamycin (50 μg / mL) at 37°C and 220 rpm. The bacterial concentration was determined by OD0.05. 600 When the concentration was 0.4, arabinose was added to a final concentration of 10 mM for induction, and the cells were cultured for another hour to prepare electrocompetent cells (see reference for the method of preparing electrocompetent cells). Li, 2021, Acta Biochim Biophys Sin. ibid. ).

[0053] (4) Electro-rotation: The Ptac-leuDH(avtA) fragment and pEcgRNA-avtA plasmid were electroporated into ATCC 8739 (Δ). adhE :: P tac- ilvBN mut Single colonies were grown in leuDH-VF / avtA-VR primers and verified by colony PCR. The positive fragment was about 1.3 kb.

[0054] (5) Loss of pEcgRNA-avtA plasmid: The method is the same as 1.1(5) in Example 1, to obtain ATCC8739 (△ adhE :: P tac- ilvBN mut , △ avtA :: P tac- leuDH ) / pEcCas strain.

[0055] 1.3. ldhA Site insertion P tac- ilvC cg (1) Construction of pEcgRNA-ldhA plasmid: The two synthesized oligosaccharide nucleic acids ldhA-F / ldhA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-ldhA plasmid.

[0056] (2) Preparation of electroporation fragments: Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers ldhA-F1(KO) / ldhA-R1(KO) and ldhA-F2(KO) / ldhA-R2(KO) to obtain ldhA-UP and ldhA-DN fragments, approximately 500 bp each. Using the pTargetT-Ptac-stlA(exo) (CN112662607A) plasmid as a template, PCR amplification was performed using primers Ptac-F(ldhA) / Ptac-R to obtain the Ptac(ldhA) fragment, approximately 200 bp. Using the pUC-ilvCcg plasmid (synthesized by GenScript) as a template, PCR amplification was performed using primers ilvCcg-F / ilvCcg-R to obtain the ilvCcg fragment. The gene sequences are shown in Table 6, approximately 1... Using ldhA-UP, ldhA-DN, Ptac(ldhA), and ilvCcg fragments as templates and ldhA-F1(KO) / ldhA-R2(KO) as primers, overlap PCR was used to amplify the Ptac-ilvCcg(ldhA) fragment, approximately 2.3 kb.

[0057] (3) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. The Ptac-ilvCcg(ldhA) fragment and pEcgRNA-ldhA plasmid were electroporated into ATCC8739 (Δ). adhE :: P tac- ilvBN mut , △ avtA :: P tac- leuDH In competent cells, single colonies were verified by colony PCR using primers ldhA-VF / ilvCcg-VR, and the positive fragment was approximately 1.2 kb.

[0058] (4) Loss of pEcgRNA-ldhA plasmid: The method is the same as in Example 1, 1.1 (5), to obtain ATCC8739 (△ adhE :: P tac- ilvBN mut , △ avtA :: P tac- leuDH , △ ldhA :: P tac- ilvC cg) / pEcCas strain.

[0059] Table 6. Gene Sequence and Amino Acid Sequence

[0060] 1.4. mgsA Site insertion P tac- lrp (1) Construction of pEcgRNA-mgsA plasmid: The synthesized two oligosaccharide nucleic acids mgsA-F / mgsA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-mgsA plasmid.

[0061] (2) Preparation of electroporation fragments: Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers mgsA-F1(KO) / mgsA-R1(KO), mgsA-F2(KO) / mgsA-R2(KO), and lrp-F / lrp-R to obtain mgsA-UP, mgsA-DN, and lrp fragments, approximately 450 bp, 400 bp, and 600 bp, respectively. Using the pTargetT-Ptac-stlA(exo) (CN112662607A) plasmid as a template, PCR amplification was performed using primers Ptac-F(TY) / Ptac-R to obtain the Ptac fragment, approximately 200 bp. Using the mgsA-UP, mgsA-DN, lrp, and Ptac fragments as templates, and primers mgsA-F1(KO) / mgsA-R2(KO), overlap... PCR amplification yielded a Ptac-lrp(mgsA) fragment, approximately 1.7 kb.

[0062] (3) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. The Ptac-lrp(mgsA) fragment and pEcgRNA-mgsA plasmid were electroporated into ATCC8739 (Δ adhE :: P tac- ilvBN mut , △ avtA :: P tac- leuDH , △ ldhA :: P tac- ilvC In cg) / pEcCas competent cells, single colonies were verified by colony PCR using mgsA-VF / lrp-VR primers, and the positive fragment was approximately 1kb.

[0063] (4) Loss of pEcgRNA-mgsA plasmid: The method is the same as in Example 1, 1.1 (5), to obtain ATCC8739 (△ adhE:: P tac- ilvBN mut , △ avtA :: P tac- leuDH , △ ldhA :: P tac- ilvC cg, △ mgsA :: P tac- lrp ) / pEcCas strain.

[0064] 1.5. frd Site insertion P tac- ygaZH (1) Construction of pEcgRNA-frd plasmid: The synthesized two oligosaccharide nucleic acids, frd-F and frd-R, were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-frd plasmid.

[0065] (2) Preparation of electroporation fragments: Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers frd-F1(KO) / frd-R1(KO), frd-F2(KO) / frd-R2(KO), and ygaZH-F / ygaZH-R to obtain frd-UP, frd-DN, and ygaZH fragments, approximately 500 bp, 450 bp, and 1.1 kb, respectively. Using frd-UP, frd-DN, ygaZH, and Ptac fragments as templates, and frd-F1(KO) / frd-R2(KO) as primers, overlap PCR amplification was performed to obtain the Ptac-ygaZH(frd) fragment, approximately 2.3 kb.

[0066] (3) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. The Ptac-ygaZH(frd) fragment and pEcgRNA-frd plasmid were electroporated into ATCC8739 (Δ). ​ :: P tac- ​ mut , △ ​ :: P tac- ​ , △ ​ :: P tac- ​ cg, △ ​ :: P tac- lrpIn ) / pEcCas competent cells, single colonies were verified by colony PCR using frd-VF / ygaZH-VR primers, and the positive fragment was approximately 1.2 kb.

[0067] (4) Loss of pEcgRNA-frd plasmid: The method is the same as in Example 1, 1.1 (5), to obtain ATCC8739 (△ ​ :: P tac- ​ mut , △ ​ :: P tac- ​ , △ ​ :: P tac- ​ cg, △ ​ :: P tac- lrp , △ ​ :: P tac- ​ ) / pEcCas strain.

[0068] 1.6. ​ Gene knockout (1) Construction of pEcgRNA-pflB plasmid: The synthesized two oligosaccharide nucleic acids, pflB-F / pflB-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-pflB plasmid.

[0069] (2) Preparation of electroporation fragments: Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using pflB-F1(KO) / pflB-R1(KO) and pflB-F2(KO) / pflB-R2(KO) as primers to obtain pflB-UP and pflB-DN fragments, each approximately 400 bp. Using pflB-UP and pflB-DN fragments as templates, and pflB-F1(KO) / pflB-R2(KO) as primers, overlap PCR amplification was performed to obtain the pflB(KO) fragment, approximately 800 bp.

[0070] (3) Electro-rotation: The method is the same as 1.1 (3) and (4) in Example 1. The pflB(KO) fragment and pEcgRNA-pflB plasmid were electroporated into ATCC8739 (Δ ​ :: P tac- ​ mut , △ ​ ::P tac- ​ , △ ​ :: P tac- ​ cg, △ ​ :: P tac- lrp , △ ​ :: P tac- ​ In ) / pEcCas competent cells, single colonies were verified by colony PCR using pflB-VF / pflB-R2(KO) primers, and the positive fragment was approximately 1 kb.

[0071] (4) Loss of pEcgRNA-pflB plasmid: The method is the same as in Example 1, 1.1 (5), to obtain ATCC8739 (△ ​ :: P tac- ​ mut , △ ​ :: P tac- ​ , △ ​ :: P tac- ​ cg, △ ​ :: P tac- lrp , △ ​ :: P tac- ​ , △ ​ ) / pEcCas strain.

[0072] 1.7. ​ Site insertion P tac- ​ (1) Construction of pEcgRNA-ackA plasmid: The synthesized two oligosaccharide nucleic acids, ackA-F / ackA-R, were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-ackA plasmid.

[0073] (2) Preparation of electroporation fragments: Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers ackA-F1(KO) / ackA-R1(KO), ackA-F2(KO) / ackA-R2(KO), and ilvED-F / ilvED-R to obtain ackA-UP, ackA-DN, and ilvED fragments, approximately 550 bp, 500 bp, and 2.8 kb, respectively. Using ackA-UP, ackA-DN, ilvED, and Ptac fragments as templates, and primers ackA-F1(KO) / ackA-R2(KO), overlap PCR amplification was performed to obtain the Ptac-ilvED(ackA) fragment, approximately 4.2 kb.

[0074] (3) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. The Ptac-ilvED(ackA) fragment and pEcgRNA-ackA plasmid were electroporated into ATCC8739 (Δ). ​ :: P tac- ​ mut , △ ​ :: P tac- ​ , △ ​ :: P tac- ​ cg,△ ​ :: P tac- lrp , △ ​ :: P tac- ​ , △ ​ In ) / pEcCas competent cells, single colonies were verified by colony PCR using ackA-VF / ilvED-VR primers, and the positive fragment was approximately 1.6 kb.

[0075] (4) Loss of pEcgRNA-ackA plasmid: The method is the same as in Example 1, 1.1 (5), to obtain ATCC8739 (△ ​ :: P tac- ​ mut , △ ​ :: P tac- ​ , △ ​ :: P tac- ​ cg, △ ​ :: P tac- lrp , △ ​ ::P tac- ​ , △ ​ ,△ ​ :: P tac- ​ ) / pEcCas strain.

[0076] (5) loss of pEcCas plasmid: The method is the same as in Example 1, 1.1 (5), to obtain ATCC8739 (△ ​ :: P tac- ​ mut , △ ​ :: P tac- ​ , △ ​ :: P tac- ​ cg, △ ​ :: P tac- lrp , △ ​ :: P tac- ​ , △ ​ ,△ ​ :: P tac- ​ It was named TYS8975.

[0077] 1.8. ​ Gene knockout (1) Construction of pEcgRNA-alaA plasmid: The two synthesized oligosaccharide nucleic acids alaA-F / alaA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-alaA plasmid.

[0078] (2) Preparation of electroporation fragments: Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using alaA-F1(KO) / alaA-R1(KO) and alaA-F2(KO) / alaA-R2(KO) as primers to obtain alaA-UP and alaA-DN fragments of approximately 500 bp and 400 bp, respectively. Using alaA-UP and alaA-DN fragments as templates, and alaA-F1(KO) / alaA-R2(KO) as primers, overlap PCR amplification was performed to obtain the alaA(KO) fragment of approximately 900 bp.

[0079] (3) Electro-rotation: The method is the same as in Example 1, 1.1 (3) and (4). The alaA(KO) fragment and pEcgRNA-alaA plasmid were electroporated into TYS8975 / pEcCas competent cells. Single colonies were verified by colony PCR using alaA-VF / alaA-R2(KO) primers. The positive fragment was about 1.1 kb.

[0080] (4) Loss of pEcgRNA-alaA plasmid The method is the same as in Example 1, 1.1 (5), to obtain TYS8975 (△) ​ ) / pEcCas strain.

[0081] (5) loss of pEcCas plasmid: The method is the same as in Example 1, 1.1 (5), to obtain TYS8975 (△) ​ ) strains.

[0082] 1.9. ​ Gene knockout (1) Construction of pISFba1reRNA-alaC plasmid: The two synthesized oligosaccharide nucleic acids alaC-F / alaC-R were used to replace the spacer sequence (CTGATGGTCCATGTCTGTTA) on pISFba1reRNA (Addgene: 226822) using QuickChange to obtain the pISFba1reRNA-alaC plasmid.

[0083] (2) Preparation of electroporation fragments: Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using alaC-F1(KO) / alaC-R1(KO) and alaC-F2(KO) / alaC-R2(KO) as primers to obtain alaC-UP and alaC-DN fragments, approximately 600 bp and 500 bp, respectively. Using alaC-UP and alaC-DN fragments as templates, and alaC-F1(KO) / alaC-R2(KO) as primers, overlap PCR amplification was performed to obtain the alaC(KO) fragment, approximately 1.1 kb.

[0084] (3) Electro-rotation: Transform 300 ng pISFba1 (Addgene: 226820) plasmid into E. coli TYS8975 (△ ​ Electrotransferring competent cells and screening on LB agar plates containing kanamycin (50 μg / mL) yielded TYS8975 (△). ​ Transformer ) / pISFba1. Transformer TYS8975(△ ​pISFba1 was inoculated into LB tubes containing 5 mL of kanamycin and cultured overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculation rate to fresh LB tubes containing kanamycin and a final concentration of 10 mM L-arabinose and cultured at 37°C and 220 rpm until OD500 was reached. 600 The concentration was 0.6-0.8, and competent cells were prepared for electroporation. The alaC(KO) fragment and pISFba1reRNA-alaC plasmid were electroporated into TYS8975 cells (Δ). ​ In ) / pISFba1 competent cells, single colonies were verified by colony PCR using alaC-VF / alaA-R2(KO) primers, and the positive fragment was approximately 1.3 kb.

[0085] (4) Loss of pISFba1reRNA-alaC and pISFba1 plasmid: Positive clones were inoculated into LB medium containing rhamnose (10 mM) and kanamycin and incubated overnight at 37°C. They were then diluted and plated or streaked onto solid LB agar plates containing kanamycin and incubated overnight at 37°C. Clones were randomly selected and spotted onto LB agar plates containing kanamycin and spectinomycin, respectively, for selection. Clones sensitive to spectinomycin successfully eliminated the plasmid. Next, to eliminate the pISFba1 plasmid, spectinomycin-sensitive strains were inoculated into liquid LB medium and incubated overnight at 37°C. The bacterial culture was streaked onto LB agar plates containing 10 g / L sucrose and incubated overnight at 37°C. Single colonies were then randomly selected and selected on LB agar plates containing and without kanamycin. Colonies sensitive to kanamycin successfully eliminated the plasmid. After complete plasmid elimination, TYS8975 (△) was obtained. ​ , △ ​ The strain was named TYS8976.

[0086] 1.10. In ​ Site insertion P ldhA- ​ cg (1) Construction of pEcgRNA-ilvCcg(lacZ) plasmid: The two synthesized oligosaccharide nucleic acids lacZ-F / lacZ-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-lacZ plasmid.

[0087] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers lacZ-F1(ld) / lacZ-R1(ld), lacZ-F2(ld) / lacZ-R2(ld), lacZ-F3(ld) / lacZ-R3(ld), Pldh-F / Pldh-R, and ilvCcg-F(ld) / ilvCcg-R(ld) to obtain lacZ1(ld), lacZ2(ld), lacZ3(ld), PldhA, and ilvCcg(ld) fragments, approximately 730 bp, 500 bp, 470 bp, 830 bp, and 1 kb, respectively. The lacZ1(ld), lacZ2(ld), lacZ3(ld), PldhA, and ilvCcg(ld) fragments were then cloned into pEcgRNA-lacZ using a DNA assembly method (DNA assembly kit purchased from TransGen). ​ RI / ​ At site III, the pEcgRNA-ilvCcg(lacZ) plasmid was obtained.

[0088] (2) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. pEcCas was electroporated into TYS8976 to obtain TYS8976 / pEcCas / . The pEcgRNA-ilvCcg(lacZ) plasmid was electroporated into TYS8976 / pEcCas competent cells. Single colonies were verified by colony PCR using lacZ-VF / ilvCcg-V-R2 primers. The positive fragment was about 2.1 kb.

[0089] (3) Loss of pEcgRNA-ilvCcg(lacZ) plasmid: The method is the same as in Example 1, 1.1 (5), to obtain TYS8976 (△) ​ :: P ldhA- ​ cg ) / pEcCas strain.

[0090] 1.11. In ​ Site insertion P ldhA- ​ (1) Construction of pEcgRNA-leuDH(lacI) plasmid: The synthesized two oligosaccharide nucleic acids lacI-F / lacI-R were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-lacI plasmid.

[0091] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers lacI-F1(ld) / lacI-R1(ld), lacI-F2(ld) / lacI-R2(ld), lacI-F3(ld) / lacI-R3(ld), and leuDH-F(ld) / leuDH-R(ld) to obtain lacI1(ld), lacI2(ld), lacI3(ld), and leuDH(ld) fragments, approximately 670 bp, 500 bp, 400 bp, and 1.1 kb, respectively. The lacI1(ld), lacI2(ld), lacI3(ld), PldhA, and leuDH(ld) fragments were then cloned into pEcgRNA-lacI using a DNA assembly method (DNA assembly kit purchased from TransGen). ​ RI / ​ pEcgRNA-leuDH(lacI) plasmid was obtained at site III.

[0092] (2) Electro-rotation: The method is the same as 1.1 (3) and (4) in Example 1. The pEcgRNA-leuDH(lacI) plasmid was electroporated into TYS8976 (Δ ​ :: P ldhA- ​ cg In ) / pEcCas competent cells, single colonies were verified by colony PCR using leuDH-VF / lacI-VR primers, and the positive fragment was approximately 2.2 kb.

[0093] (3) Loss of pEcgRNA-leuDH(lacI) plasmid: The method is the same as in Example 1, 1.1 (5), to obtain TYS8976 (△) ​ :: P ldhA- ​ cg , △ ​ :: P ldhA- ​ ) / pEcCas strain.

[0094] 1.12. In ​ Site insertion P ldhA- ​ (1) Construction of pEcgRNA-ilvD(ydjK) plasmid: The synthesized two oligosaccharide nucleic acids, ydjK-F / ydjK-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-ydjK plasmid.

[0095] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers ydjK-F1(ld) / ydjK-R1(ld), ydjK-F2(ld) / ydjK-R2(ld), ydjK-F3(ld) / ydjK-R3(ld), and ilvD-F(ld) / ilvD-R(ld) to obtain fragments ydjK1(ld), ydjK2(ld), ydjK3(ld), and ilvD(ld), approximately 650 bp, 460 bp, 350 bp, and 1.9 kb, respectively. The ydjK1(ld), ydjK2(ld), ydjK3(ld), PldhA, and ilvD(ld) fragments were then cloned into pEcgRNA-ydjK using a DNA assembly method (DNA assembly kit purchased from TransGen). ​ RI / ​ At site III, the pEcgRNA-ilvD(ydjK) plasmid was obtained.

[0096] (2) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. The pEcgRNA-ilvD(ydjK) plasmid was electroporated into TYS8976(Δ ​ :: P ldhA- ​ cg , △ ​ :: P ldhA- ​ In competent cells, single colonies were verified by colony PCR using primers ydjK-VF / ilvD-VR, and the positive fragment was approximately 1.8 kb.

[0097] (3) Loss of pEcgRNA-ilvD(ydjK) plasmid: The method is the same as in Example 1, 1.1 (5), to obtain TYS8976 (△) ​ :: P ldhA- ​ cg , △ ​ :: P ldhA- ​ , △ ​ :: P ldhA- ilvD ) / pEcCas strain.

[0098] 1.13. In yaiT Site insertion P ldhA- nadK (1) Construction of pEcgRNA-nadK(yaiT) plasmid: The two synthesized oligosaccharide nucleic acids yaiT-F / yaiT-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-yaiT plasmid.

[0099] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers yaiT-F1(ld) / yaiT-R1(ld), yaiT-F2(ld) / yaiT-R2(ld), yaiT-F3(ld) / yaiT-R3(ld), and nadK-F(ld) / nadK-R(ld) to obtain yaiT1(ld), yaiT2(ld), yaiT3(ld), and nadK(ld) fragments, approximately 650 bp, 460 bp, 350 bp, and 1.9 kb, respectively. The yaiT1(ld), yaiT2(ld), yaiT3(ld), PldhA, and nadK(ld) fragments were then cloned into pEcgRNA-yaiT using a DNA assembly method (DNA assembly kit purchased from TransGen). Eco RI / Hind At site III, the pEcgRNA-nadK(yaiT) plasmid was obtained.

[0100] (2) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. The pEcgRNA-nadK(yaiT) plasmid was electroporated into TYS8976(Δ lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA- leuDH , △ ydjK :: P ldhA- ilvD In ) / pEcCas competent cells, single colonies were verified by colony PCR using yaiT-VF / nadK-VR primers, and the positive fragment was approximately 2.1 kb.

[0101] (3) Loss of pEcgRNA-nadK(yaiT) plasmid: The method is the same as in Example 1, 1.1 (5), to obtain TYS8976 (△) lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA-leuDH , △ ydjK :: P ldhA- ilvD , △ yaiT :: P ldhA- nadK ) / pEcCas strain.

[0102] 1.14. In yihF Site insertion P ldhA- ilvBN mut (1) pEcgRNA-ilvBN mut (yihF) plasmid construction: The two synthesized oligosaccharide nucleic acids yihF-F / yihF-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-yihF plasmid.

[0103] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers yihF-F1(ld) / yihF-R1(ld), yihF-F2(ld) / yihF-R2(ld), and yihF-F3(ld) / yihF-R3(ld) to obtain yihF1(ld), yihF2(ld), and yihF3(ld) fragments, approximately 730 bp, 510 bp, and 490 bp, respectively. Using the Ptac-ilvBNm(adhE) fragment as a template, PCR amplification was performed using primers ilvBN-F(ld) / ilvBN-R(ld) to obtain the ilvBNmut(ld) fragment, approximately 2.1 kb. The yihF1(ld), yihF2(ld), yihF3(ld), PldhA, and ilvBNmut(ld) fragments were then processed using DNA assembly. The kit was purchased from Fullmetal Alpha (and cloned pEcgRNA-yihF). Eco RI / Hind At site III, pEcgRNA-ilvBN is obtained. mut (yihF) plasmid.

[0104] (2) Electro-rotation: The method is the same as 1.1 (3) and (4) in Example 1. pEcgRNA-ilvBN mut (yihF) plasmid electroporated into TYS8976 (△) lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA-leuDH , △ ydjK :: P ldhA- ilvD , △ yaiT :: P ldhA- nadK In ) / pEcCas competent cells, single colonies were verified by colony PCR using yihF-VF / ilvBN-VR primers, and the positive fragment was approximately 1.9 kb.

[0105] (3) pEcgRNA-ilvBN mut (yihF) plasmid loss: The method is the same as in Example 1, 1.1 (5), to obtain TYS8976 (△) lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA- leuDH , △ ydjK :: P ldhA- ilvD , △ yaiT :: P ldhA- nadK , △ yihF :: P ldhA- ilvBN mut ) / pEcCas strain.

[0106] 1.15. In yjcS Site insertion P tac- ilvC (1) Construction of pEcgRNA-yjcS plasmid: The synthesized two oligosaccharide nucleic acids, yjcS-F / yjcS-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-yjcS plasmid.

[0107] (2) Preparation of electroporation fragments: by E . coliUsing the ATCC8739 genome as a template, PCR amplification was performed using primers yjcS-F1 / yjcS-R1, yjcS-F2 / yjcS-R2, yjcS-F3 / yjcS-R3, and ilvC-F(yjcS) / ilvC-R(yjcS) to obtain fragments yjcS-1, yjcS-2, yjcS-3, and ilvC(yjcS), with lengths of approximately 650 bp, 450 bp, 530 bp, and 1.6 kb, respectively. Using fragments yjcS-1, yjcS-2, yjcS-3, Ptac, and ilvC(yjcS) as templates, and primers yjcS-F1 / yjcS-R3, overlap PCR amplification was performed to obtain the Ptac-ilvC(yjcS) fragment, with a length of approximately 3.5 kb.

[0108] (3) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. The Ptac-ilvC(yjcS) fragment and pEcgRNA-yjcS plasmid were electroporated into TYS8976 (Δ lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA- leuDH , △ ydjK :: P ldhA- ilvD , △ yaiT :: P ldhA- nadK , △ yihF :: P ldhA- ilvBN mut In ) / pEcCas competent cells, single colonies were verified by colony PCR using yjcS-VF / ilvC-VR primers, and the positive fragment was approximately 1.4 kb.

[0109] (4) Loss of pEcgRNA-yjcS plasmid: The method is the same as in Example 1, 1.1 (5), to obtain TYS8976 (△) lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA- leuDH , △ ydjK :: P ldhA- ilvD , △ yaiT :: P ldhA- nadK, △ yihF :: P ldhA- ilvBN mut , △ yjcS :: P tac- ilvC ) / pEcCas strain.

[0110] 1.16. In ybaP Site insertion P tac- pntAB (1) Construction of pEcgRNA-ybaP plasmid: The synthesized two oligosaccharide nucleic acids, ybaP-F / ybaP-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1 (1), to obtain the pEcgRNA-ybaP plasmid.

[0111] (2) Preparation of electroporation fragments: Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers ybaP-F1 / ybaP-R1, ybaP-F2 / ybaP-R2, ybaP-F3 / ybaP-R3, and pntAB-F(ybaP) / pntAB-R(ybaP) to obtain ybaP-1, ybaP-2, ybaP-3, and pntAB(ybaP) fragments, approximately 670 bp, 520 bp, 560 bp, and 3.0 kb, respectively. Using ybaP-1, ybaP-2, ybaP-3, Ptac, and pntAB(ybaP) fragments as templates, and primers ybaP-F1 / ybaP-R3, overlap PCR amplification was performed to obtain the Ptac-pntAB(ybaP) fragment, approximately 5.0 kb.

[0112] (3) Electro-rotation: The method is the same as in 1.1 (3) and (4) of Example 1. The Ptac-pntAB(ybaP) fragment and pEcgRNA-ybaP plasmid were electroporated into TYS8976 (Δ lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA- leuDH , △ ydjK :: P ldhA- ilvD , △ yaiT :: P ldhA- nadK , △ yihF :: P ldhA-ilvBN mut , △ yjcS :: P tac- ilvC In ) / pEcCas competent cells, single colonies were verified by colony PCR using ybaP-VF / pntAB-VR primers, and the positive fragment was approximately 1.5 kb.

[0113] (4) Loss of pEcgRNA-ybaP plasmid: The method is the same as in Example 1, 1.1 (5), to obtain TYS8976 (△) lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA- leuDH , △ ydjK :: P ldhA- ilvD , △ yaiT :: P ldhA- nadK , △ yihF :: P ldhA- ilvBN mut , △ yjcS :: P tac- ilvC , △ ybaP :: P tac- pntAB ) / pEcCas strain.

[0114] (5) loss of pEcCas plasmid: The method is the same as 1.1 (5) in Example 1, to obtain TYS8976△ lacZ :: P ldhA- ilvC cg , △ lacI :: P ldhA- leuDH , △ ydjK :: P ldhA- ilvD , △ yaiT :: P ldhA- nadK , △ yihF :: P ldhA- ilvBN mut , △ yjcS :: P tac- ilvC , △ybaP :: P tac- pntAB It was named Synthesized 1.0.

[0115] Table 7. List of primers used in Example 1

[0116] The Synthesized 1.0 strain exhibited the following fermentation performance under anaerobic conditions: 5.48 g / L valine production after 48 h, and OD... 600 Approximately 0.73, with a production intensity of 0.11 g / L / h.

[0117] Example 2: Mutation on Synthesized 1.0 or Synthesized 2.0 nagA To increase valine production, this invention will... nagA Frameshift mutation was performed ( nagA The deletion of the 422nd base (G) in p.Gly141AlafsTer29 causes a change from glycine to alanine at position 141. The frameshift mutation then introduces a stop codon at position 169 (restarting numbering from 1, with position 29 after the frameshift mutation becoming the stop codon). The open reading frame of NagA decreases from 382 amino acids to 168 amino acids. The mutated sequence... nagA The nucleic acid sequence is shown in SEQ ID NO: 47, and the amino acid sequence is shown in SEQ ID NO: 48.

[0118] First, we constructed pTargetF-nagA and mutants. nagA Homologous repair fragments were obtained. Using nagAUF / nagAfs-R and nagAfs-F / nagADR primer pairs, nagAfs-1 and nagAfs-2 were amplified using Synthesized 1.0 and Synthesized 2.0 templates, respectively. Using nagAUF / nagADR primer pairs, nagAfs-1 and nagAfs-2 were obtained via overlap extension PCR. nagAp. Gly141AlafsTer29 HR. pEcCas-2.0 was transformed into Synthesized 1.0 and Synthesized 2.0 cultures, respectively. Transformants were obtained by screening on LB agar plates containing chloramphenicol, yielding either Synthesized 1.0 / pEcCas-2.0 or Synthesized 2.0 / pEcCas-2.0 transformants. The Synthesized 1.0 / pEcCas-2.0 or Synthesized 2.0 / pEcCas-2.0 transformants were inoculated into 5 mL LB tubes containing chloramphenicol and cultured overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculum to fresh LB tubes containing chloramphenicol and a final concentration of 10 mM L-arabinose, and cultured at 37°C and 220 rpm until OD500 was reached. 600 Electrocompetent cells were prepared with a concentration of 0.6-0.8. 300 ng pTargetF-nagA and 600 ng... nagA p. Gly141AlafsTer29 HR cells were transfected into the above-mentioned electrocompetent cells. The recovery solution was plated onto LB agar plates containing chloramphenicol and spectinomycin, and incubated overnight at 37°C. Verification was performed using PCR sequencing with primers nagAUF / nagADR. nagA The mutation was correctly cloned, and after passage in antibiotic-free LB liquid medium to completely eliminate the plasmid, a Synthesized 1.0 was obtained. nagA And Synthesized 2.0 nagA .

[0119] The results are as follows Figure 2 As shown, Synthesized 1.0 nagA Compared to Synthesized 1.0, L-valine production increased by approximately 8 g / L, and Synthesized 2.0... nagA The yield of L-valine increased by approximately 9 g / L compared to the Synthesized 2.0, demonstrating... nagA Frameshift mutations can increase valine production.

[0120] By incorporating via reference The full contents of every patent and scientific document mentioned in this article are incorporated herein by reference for all purposes.

[0121] Equivalence This disclosure may be embodied in other specific ways without departing from its spirit or essential characteristics. Therefore, the above embodiments should be considered illustrative in all cases and not as limiting of the invention described herein. Consequently, the scope of this disclosure is defined by the appended claims rather than by the foregoing description and is intended to be encompassed therein by all variations within the equivalent meaning and scope of the claims.

Claims

1. A modified bacterium that produces L-valine, wherein the bacterium comprises a NagA-inactivating modification.

2. The modified bacteria of claim 1, wherein the modification that inactivates NagA is a stop mutation that mutates any amino acid of NagA to a stop codon or is derived from... nagA Termination mutations caused by frameshift mutations in genes, preferably, the frameshift mutation is nagA The deletion of base G at position 422 of the gene results in a mutation at position 141 of the amino acid sequence, where glycine is replaced by alanine. After the frameshift mutation, position 169 of the sequence becomes a stop codon.

3. The modified bacteria as described in claim 1 or 2, wherein the modified bacteria comprises a nucleic acid sequence as shown in SEQ ID NO: 47 or an amino acid sequence as shown in SEQ ID NO:

48.

4. The modified bacteria according to any one of claims 1 to 3, further comprising a leucine dehydrogenase LeuDH mutation that increases L-valine production, preferably, said mutation being LeuDH. V22I .

5. The modified bacteria as described in any one of claims 1 to 4, comprising one or more LeuDH cells. V22I Gene copies, preferably two to ten, more preferably ten.

6. The modified bacteria according to any one of claims 1 to 5, further comprising an amino acid sequence mutation of acetylhydroxy acid synthase IlvBN, preferably, said mutation being selected from IlvBN. G20D IlvBN V21D and IlvBN M22F .

7. The modified bacteria according to any one of claims 1 to 6, wherein the bacteria further comprises modifications that reduce the production of byproducts, preferably the modifications for reducing byproduct production selected from... avtA, ldhA, mgsA, frd, pflB, adhE, ackA, alaA and / or alaC All knockouts, truncations, and simultaneous repair of frameshift mutations to wild type, or other truncation forms with activity reduction of more than 10%.

8. The modified bacteria according to any one of claims 1 to 7, wherein the bacteria contain a transhydrogenase. pntAB Activity-enhancing modifications, preferably, the modifications are selected from... pntAB The modification increases the gene copy number and the promoter modification, preferably the promoter modification is the insertion of a strong Ptac or PldhA promoter.

9. The modified bacteria as claimed in any one of claims 1 to 8, wherein the bacteria comprises nadK Activity-enhancing modifications, preferably, the modifications are selected from... nadK The modification increases the gene copy number and the promoter modification, preferably the promoter modification is the insertion of a strong Ptac or PldhA promoter.

10. The modified bacteria as claimed in any one of claims 1 to 9, wherein the bacteria further comprises ilvC , ilvD and / or ilvE One or more modifications that enhance activity.

11. The modified bacteria as described in any one of claims 1 to 10, comprising one or more ilv The C gene copies are preferably two to ten, more preferably five; containing one or more copies. ilvD Gene copies, preferably two to ten copies, more preferably four copies; and / or containing one or more ilvE Gene copies, preferably two to ten, more preferably three.

12. Use of the modified bacteria as described in any one of claims 1 to 11 in increasing L-valine production.

13. A method for producing L-valine, comprising culturing the modified bacteria as described in any one of claims 1-11 in a culture medium.

Citation Information

Patent Citations

  • Engineering probiotic with surface display phenylalanine ammonia lyase

    CN112662607A