Application of soybean nitrate transporter GmNRT1.5c in regulating soybean salt tolerance
By overexpressing the GmNRT1.5c gene in soybean, the gap in soybean salt tolerance regulation was filled, and the salt tolerance of soybean was significantly improved. This fills the gap in existing technology and provides new gene targets and theoretical basis for molecular breeding of salt-tolerant soybean varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NORTHWEST A & F UNIV
- Filing Date
- 2026-05-06
- Publication Date
- 2026-06-16
Smart Images

Figure CN122214408A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the application of a soybean nitrate transporter protein GmNRT1.5c in regulating soybean salt tolerance. Background Technology
[0002] Soybeans are an important food, oilseed, and feed crop in my country, significantly impacting the country's food security. Due to changes in market structure and upgrading consumption patterns, my country's soybean production can no longer meet consumer demand, leading to persistently high import volumes. Simultaneously, soil salinization has become an environmental problem threatening sustainable agricultural development. Salt stress causes osmotic stress and ion toxicity in soybeans, affecting their growth and resulting in reduced plant height, fewer branches, lower 100-seed weight, and decreased number of seeds and pods per plant. Therefore, identifying soybean salt tolerance-related genes is crucial for mitigating salt stress and developing salt-tolerant soybean varieties.
[0003] NRTs (Nitrate Transporters) are nitrate transport proteins that play a crucial role in the absorption and utilization of NO3- in soil by plants. - It plays a crucial role in the process. Currently, four main types of nitrate transporter proteins have been identified, among which the NRT1s / NPFs (Nitrate Transporter Protein 1s / peptide Transporters) family members have been the most studied. The NRT1.5 nitrate transporter protein plays an important role in plant responses to salt stress. In the model plant Arabidopsis thaliana, AtNRT1.5 expression is significantly inhibited by salt stress; this protein negatively regulates Arabidopsis salt tolerance by retaining nitrate nitrogen in the roots. Evolutionary analysis shows that four NRT1.5 homologous genes exist in the soybean genome. Previous studies have reported that GmNRT1.5b (Glyma.05G070600) is an important candidate gene in response to soybean salt stress; although the endophytic bacterium Pseudomonas sp. 77S3 positively regulates soybean salt tolerance through its mediated nitrogen allocation process, the specific function of GmNRT1.5b in this process remains to be elucidated.
[0004] However, the functions of other NRT1.5 homologs in soybean (such as GmNRT1.5c) and their specific mechanisms of salt tolerance regulation have not yet been reported. Current technology lacks understanding of whether and how GmNRT1.5c participates in soybean salt tolerance regulation, and its functional similarities and differences with Arabidopsis thaliana AtNRT1.5 or soybean GmNRT1.5b are unclear. Therefore, it is urgent to discover and identify novel soybean salt tolerance genes, elucidate their regulatory networks, and provide new gene targets and theoretical basis for molecular breeding of salt-tolerant soybean varieties. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide an application of soybean nitrate transporter GmNRT1.5c in regulating soybean salt tolerance.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.
[0007] Application of the GmNRT1.5c gene in regulating soybean salt tolerance, the CDS sequence of the GmNRT1.5c gene is shown in SEQ ID NO: 1.
[0008] Further optimization involves improving the salt tolerance of soybeans by upregulating the expression level of the GmNRT1.5c gene.
[0009] A method for improving the salt tolerance of soybeans involves upregulating the expression of the GmNRT1.5c gene in recipient soybeans through genetic engineering, thereby increasing the expression level and / or activity of the GmNRT1.5c protein and thus enhancing the salt tolerance of soybeans. The CDS sequence of the GmNRT1.5c gene is shown in SEQ ID NO: 1, and the amino acid sequence of the GmNRT1.5c protein is shown in SEQ ID NO: 2.
[0010] The above-mentioned methods for improving the salt tolerance of soybeans are applied in soybean breeding.
[0011] A method for breeding highly salt-tolerant transgenic soybeans includes the following steps: overexpressing the GmNRT1.5c gene in recipient soybeans to increase the content and / or activity of GmNRT1.5c protein in the recipient soybeans, thereby obtaining gene-overexpressing lines; determining the salt tolerance of the gene-overexpressing lines by detecting the expression level and / or activity of GmNRT1.5c protein in the gene-overexpressing lines; the determination method includes: if the expression level and / or activity of GmNRT1.5c protein in the gene-overexpressing lines is high, then the soybeans have high salt tolerance; the CDS sequence of the GmNRT1.5c gene is shown in SEQ ID NO: 1, and the amino acid sequence of the GmNRT1.5c protein is shown in SEQ ID NO: 2.
[0012] A primer pair for detecting soybean lines overexpressing the GmNRT1.5c gene, wherein the primer pair is used for detecting the aforementioned GmNRT1.5c gene overexpression lines, characterized in that the nucleotide sequences of the primer pair are as shown in SEQ ID NO: 3 and SEQ ID NO: 4.
[0013] The kit is intended for use in regulating soybean salt tolerance. The kit contains molecular biological elements capable of regulating the expression of a specific gene; the specific gene is a gene associated with regulating soybean salt tolerance; the molecular biological elements may optionally include: a combination of overexpression elements for the specific gene, and / or a combination of elements that inhibit or reduce the expression of the specific gene, and / or a combination of elements that silence the expression of the specific gene, and / or a combination of elements that knock out the expression of the specific gene; the intended use is for regulating soybean salt tolerance.
[0014] More preferably, the molecular biological element is a combination of elements that overexpress the specific gene.
[0015] More preferably, the specific gene is the GmNRT1.5c gene, whose CDS sequence is shown in SEQ ID NO: 1, or an equivalent gene with the same plant physiological function.
[0016] A recombinant expression vector containing the GmNRT1.5c gene or its homologous gene, wherein the recombinant expression vector is an overexpression vector.
[0017] The beneficial effects of adopting the above technical solution are as follows: This invention is the first to discover that overexpression of GmNRT1.5c (Glyma.11G042000) can significantly improve the salt tolerance of soybean. Its function differs from that of Arabidopsis thaliana AtNRT1.5: GmNRT1.5c participates in and positively regulates the salt tolerance process of soybean by transporting nitrate nitrogen to the aboveground parts. This discovery fills the gap in existing technology regarding the salt tolerance function of other NRT1.5 homologous genes in soybean, providing new gene targets and theoretical basis for breeding salt-tolerant soybean varieties. Attached Figure Description
[0018] Figure 1 This is a schematic diagram showing the relative expression levels of GmNRT1.5c in the roots of wild-type and GmNRT1.5c overexpression lines (OE-1 and OE-2).
[0019] Figure 2 This is a schematic diagram showing the phenotypic results of overexpression of GmNRT1.5c and W82 (wild type, WT) at different salt concentrations.
[0020] Figure 3 A schematic diagram showing the effect of overexpression of GmNRT1.5c on the chlorophyll content of soybean under salt stress.
[0021] Figure 4 To investigate the effect of GmNRT1.5c overexpression on Na+ in soybean aboveground parts under salt stress + A schematic diagram illustrating the effect of content.
[0022] Figure 5To investigate the effect of GmNRT1.5c overexpression on Na+ in soybean underground parts under salt stress + A schematic diagram illustrating the effect of content.
[0023] Figure 6 To investigate the effect of GmNRT1.5c overexpression on K+ in the aboveground parts of soybean under salt stress + A schematic diagram illustrating the effect of content.
[0024] Figure 7 To investigate the effect of GmNRT1.5c overexpression on K+ in soybean underground parts under salt stress + A schematic diagram illustrating the effect of content.
[0025] Figure 8 To regulate the Na+ content of soybean whole plant under salt stress by overexpressing GmNRT1.5c + / K + A schematic diagram illustrating the effects of balance.
[0026] Figure 9 A schematic diagram showing the effect of overexpression of GmNRT1.5c on the nitrate nitrogen content in the aboveground parts of soybean under salt stress.
[0027] Figure 10 A schematic diagram showing the effect of overexpression of GmNRT1.5c on the nitrate nitrogen content in the underground parts of soybean under salt stress. Detailed Implementation
[0028] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods.
[0029] It should be understood that, when used in this application specification and the appended claims, the term "comprising" indicates the presence of the described features, integrals, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components and / or a collection thereof.
[0030] It should also be understood that the term “and / or” as used in this application specification and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.
[0031] References to "one embodiment" or "some embodiments" as described in this application specification mean that one or more embodiments of this application include the features described in connection with that embodiment.
[0032] Defined features, structure, or characteristics. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different places in this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including, but not limited to," unless otherwise specifically emphasized.
[0033] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance.
[0034] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0035] Example 1: Construction of soybean GmNRT1.5c overexpression vector
[0036] The CDS sequence of GmNRT1.5c (Glyma.11G042000, Gm11:3076163..3082992) is shown in SEQ ID NO: 1, and the protein sequence it encodes is shown in SEQ ID NO: 2.
[0037] 1) Design of GmNRT1.5c overexpression primers
[0038] The genomic sequence of the target gene GmNRT1.5c was submitted to SnapGene software (version 6.0.2) for primer design. Two suitable sequences at the 5' and 3' ends were selected as specific primer sequences. The primer sequences are as follows:
[0039] GmNRT1.5c-pTF101-F (SEQ ID NO: 3):
[0040] AGCGGCCGAATTCCCCGGGATGTCTTGCTTAGAGTCTCATGTC;
[0041] GmNRT1.5c-pTF101-R (SEQ ID NO: 4):
[0042] CGAGATCAGTTATCTAGATCCGGTGGATCCTTATACTTGTGTC;
[0043] 2) Fragment amplification
[0044] RNA was extracted from Williams 82 soybean and reverse transcriptase was used to convert it into cDNA. This cDNA was used as a template and amplified using the primers designed above to obtain the target fragment. The reaction system is as follows:
[0045]
[0046] The reaction procedure is as follows:
[0047]
[0048] The specific annealing temperature of 54-58℃ in the second step is based on the actual annealing temperature calculated by the SnapGene software. The reaction time of 68℃ in the second step is dynamically adjusted according to the length of the amplified gene fragment, with a specific reaction time of 1 kb / min. The extension temperature of the KOD enzyme is 68℃.
[0049] 3) Ligate the amplified fragment to the T vector and identify it.
[0050] The amplified fragments were subjected to agarose gel electrophoresis. The gel containing the target fragment was cut off with a blade and placed into a centrifuge tube. The PCR product was recovered using an agarose gel DNA recovery kit. The recovered fragments were ligated into BlunT3 and then heat-shocked to transform E. coli DH5α. The cells were cultured overnight at 37°C. Positive clones were selected and sent to the company for sequencing to verify the sequence was correct. The plasmid was then extracted.
[0051] 4) Ligation of the target fragment to the pTF101 vector
[0052] The T-vector plasmid with the correct sequence and the empty pTF101 vector plasmid were digested with restriction endonucleases Sma I and BamHI to obtain the target fragment and linearized vector. The digested vector plasmid and target gene band were then gel-cleaved and purified. The recovered DNA fragment was ligated into the target vector pTF101 using T4 ligase. The ligation product was heat-shocked and transformed into *E. coli* DH5α, cultured overnight at 37°C, and positive clones were selected for sequencing. Sequencing results showed that the recombinant plasmid was obtained.
[0053] 5) Recombinant plasmid transformation of Agrobacterium tumefaciens EHA101
[0054] The pTF101 recombinant plasmid containing the target fragment was extracted from Escherichia coli DH5α, transformed into Agrobacterium using liquid nitrogen freeze-thaw method, and after being identified as correct, stored in an ultra-low temperature freezer at -80℃ for later use.
[0055] Example 2: Stable genetic transformation of soybean
[0056] The creation of stable GmNRT1.5c transformation materials was carried out using the soybean cotyledon node stable transformation genetic system (Paz et al. 2006), and the transgenic plants were positively identified.
[0057] 1) DNA extraction using the CTAB method
[0058] ① Take about 0.1-0.2 g of soybean leaves and put them into a 2 mL centrifuge tube. Add steel balls, freeze quickly with liquid nitrogen, and then invert the centrifuge tube until the soybean tissue becomes powdery.
[0059] ② Add 650 μL of CTAB extraction solution and place in a 65℃ oven for 30 min, shaking it up and down several times during the process to ensure even heating;
[0060] ③ Add 0.5 times the volume of chloroform, mix vigorously, centrifuge at 12000 rpm for 10 min, take the supernatant into a new 1.5 mL centrifuge tube, add 2 times the volume of anhydrous ethanol, and mix vigorously.
[0061] ④ Place at -20℃ for at least 30 minutes, then centrifuge at 12000 rpm for 10 minutes;
[0062] ⑤ Remove the supernatant, centrifuge at 12000 rpm for 10 min, remove the supernatant with a pipette, dry it in a laminar flow hood, dissolve it in 50 μL of sterile water, and store it at 4℃ for a long time or use it directly in subsequent experiments.
[0063] ⑥ Detect DNA using Bar primers, with the corresponding W82 primer as a negative control. The Bar primer sequences are as follows:
[0064] Bar-F: CTACATCGAGACAAGCACGGTCAA (SEQ ID NO: 5);
[0065] Bar-R: AGAAACCCACGTCATGCCAGTTC (SEQ ID NO: 6).
[0066] 2) RNA extraction
[0067] ① Take a soybean root or leaf sample and place it in a 2 mL centrifuge tube. Quickly freeze and grind it with liquid nitrogen.
[0068] ② Add 1 mL of RNApure, vortex to mix, and let stand at room temperature for 5 min;
[0069] ③ Add 200 μL of chloroform, shake vigorously for 15 s, and let stand at room temperature for 3 min;
[0070] ④ Centrifuge at 12000 rpm for 10-15 min at 4°C. The sample will separate into three layers: an organic phase, an intermediate layer, and an upper colorless aqueous phase. Transfer the aqueous phase into a new centrifuge tube.
[0071] ⑤ Add an equal volume of isopropanol, invert to mix, and let stand at room temperature for 10 min;
[0072] ⑥ Centrifuge at 12000 rpm for 10 min at 4°C, remove the supernatant, add 1 mL of 75% ethanol (prepared with DEPC-treated sterile water), and vortex vigorously;
[0073] ⑦ Centrifuge at 10,000 rpm for 5 minutes at 4°C, then pour out the liquid or aspirate it with a pipette;
[0074] ⑧ Let stand at room temperature for 2-3 minutes to air dry, add 30-100 μL RNase-free ddH2O, mix well by pipetting, and fully dissolve the RNA;
[0075] ⑨ The concentration of extracted RNA was determined and recorded using a spectrophotometer, and the integrity of the RNA and the quality of extraction were detected by gel electrophoresis.
[0076] 3) RT-qPCR detection of gene expression
[0077] The RNA was reverse transcribed to synthesize cDNA, and the gene expression level was detected using RT-qPCR technology.
[0078] Expression level detection results showed that, compared with the control, both lines of GmNRT1.5c were successfully overexpressed. Figure 1 ).
[0079] Example 3: Molecular identification of overexpression lines
[0080] To verify the function of GmNRT1.5c in response to salt stress, stable transgenic soybean lines overexpressing GmNRT1.5c (OE) were obtained through stable genetic transformation at the cotyledonary node. Two independent overexpression lines (OE-1 and OE-2) were then analyzed. Compared with wild-type (WT), the relative expression levels of GmNRT1.5c were significantly increased in both OE-1 and OE-2, with OE-1 showing an increase of approximately 92-fold and OE-2 approximately 113-fold (Table 1 and 2). Figure 1 This indicates that the overexpression line was successfully constructed.
[0081] Table 1. Statistical analysis of GmNRT1.5c expression levels in WT and GmNRT1.5c overexpression lines.
[0082]
[0083] Note: Data are presented as mean ± standard deviation of three biological replicates. An asterisk indicates a significant difference compared to WT (Student's t-test, **P < 0.01, ***P < 0.001).
[0084] Wild-type (WT, W82) soybean plants and two independent GmNRT1.5c overexpression lines (OE-1 and OE-2) were cultured in normal nutrient solution until single leaves were fully expanded. Root samples were collected for RT-qPCR analysis. Data are presented as mean ± standard deviation of three biological replicates. An asterisk indicates a significant difference compared to WT (Student's t-test, **P < 0.01, ***P < 0.001).
[0085] Example 4: Phenotypic Analysis of GmNRT1.5c Overexpression
[0086] Phenotypic analysis was performed using the above-mentioned stable transgenic materials, and the results are as follows: Figure 2 As shown. After 28 days of treatment with 75 mM NaCl salt stress, the GmNRT1.5c overexpressing lines (OE-1 and OE-2) showed significantly enhanced salt tolerance compared to the wild type (WT), specifically manifested in reduced plant growth inhibition and significantly weaker leaf wilting compared to WT. Figure 2 The above results indicate that overexpression of GmNRT1.5c can positively regulate the salt tolerance of soybean.
[0087] WT, OE-1, and OE-2 were cultured under LN or HN conditions, respectively, with controls provided by either 75 mM NaCl treatment or no treatment. Phenotypic analysis and various index measurements were performed on day 28 of salt treatment.
[0088] Table 2. Statistical data on soybean chlorophyll content (SPAD) under salt stress
[0089]
[0090] Note: All data are from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05). Statistical analysis was performed using SPSS 20.0 software.
[0091] Under salt stress, the chlorophyll content (expressed as SPAD value) of the GmNRT1.5c overexpressing lines (OE-1 and OE-2) was significantly higher than that of the WT plants. Specifically, under low nitrogen (LN) conditions, the SPAD values of OE-1 and OE-2 after salt treatment were approximately 16 and 17 times that of the WT plants, respectively (Table 2 and ). Figure 3Under high nitrogen (HN) conditions, the SPAD values of both OE-1 and OE-2 after salt treatment were approximately 6 times that of WT plants (Table 2 and ). Figure 3 The above results indicate that overexpression of GmNRT1.5c can inhibit salt stress-induced chlorophyll degradation.
[0092] Example 5, Na + Content detection
[0093] Table 3 Na content in aboveground soybean plants under salt stress + Content data statistical analysis
[0094]
[0095] Note: All data are from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05). Statistical analysis was performed using SPSS 20.0 software.
[0096] To further investigate the physiological mechanism by which GmNRT1.5c alleviates salt damage, the Na+ content in the aboveground parts of WT and overexpression lines (OE-1, OE-2) was measured. + Content. Under LN conditions, the Na content in the aboveground parts of the overexpressing lines OE-1 and OE-2 after salt treatment... + The content decreased by 17.67% and 17.34% respectively compared with WT (Table 3 and ). Figure 4 Under HN conditions, the reduction was further amplified, with OE-1 and OE-2 decreasing by 42.64% and 24.98%, respectively (Table 3 and ). Figure 4 The above results indicate that overexpression of GmNRT1.5c can effectively reduce Na+ in the aboveground parts of plants under salt stress. + Accumulation, and the effect is more significant under high nitrogen conditions.
[0097] Freshly collected samples were placed in a 105°C oven for 30 min to blanch, and then dried at 65°C to constant weight. The dried samples were then ground and pulverized, digested, and the Na+ content was determined using a flame photometer. + Content. All data were obtained from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05).
[0098] Table 4 Na content in soybean underground parts under salt stress + Content data statistical analysis
[0099]
[0100] Note: All data are from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05). Statistical analysis was performed using SPSS 20.0 software.
[0101] Furthermore, the results of root Na⁺ content determination showed that under salt stress, under LN conditions, OE-1 and OE-2 decreased by 17.80% and 17.12% respectively compared with WT (Table 4 and ). Figure 5 Under HN conditions, there were no significant differences among the treatments (Table 4 and ). Figure 5 In summary, overexpression of GmNRT1.5c can reduce Na+ in the aboveground parts. + The content improves the tolerance of soybeans to salt stress.
[0102] Table 5. K in aboveground soybean under salt stress + Content data statistical analysis
[0103]
[0104] Note: All data are from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05). Statistical analysis was performed using SPSS 20.0 software.
[0105] The K⁺ content in the aboveground parts of soybean genotypes was further determined under different nitrogen levels and salt stress conditions (Table 5 and 10). Figure 6 Under salt stress, the K⁺ content in the aboveground parts of OE-1 and OE-2 plants increased by 2.38% and 9.09% respectively under LN treatment compared to WT; and by 0.76% and 7.20% respectively under HN treatment (Table 5 and ). Figure 6 The OE-2 strain showed significantly higher nitrogen levels than the WT strain under both nitrogen conditions.
[0106] Freshly collected samples were blanched in a 105°C oven for 30 min, followed by drying at 65°C to constant weight. The dried samples were then ground and digested, and the K⁺ content was determined using a flame photometer. All data were from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05).
[0107] Table 6. K in soybean underground parts under salt stress + Content data statistical analysis
[0108]
[0109] Note: All data are from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05). Statistical analysis was performed using SPSS 20.0 software.
[0110] Under salt stress, the K⁺ content in the roots of OE-1 and OE-2 plants decreased by 13.70% and 67.23% respectively compared with WT under low nitrogen (LN75) conditions (Table 6 and 10). Figure 7 At high nitrogen (HN75), OE-1 increased by 8.26%, while OE-2 decreased by 30.66% (Table 6 and ). Figure 7 In conclusion, overexpression of GmNRT1.5c under salt stress significantly increases K⁺ content in the aboveground parts while decreasing K⁺ content in the roots (especially under low nitrogen conditions), suggesting that this gene may maintain ion homeostasis by promoting K⁺ translocation to the aboveground parts, thereby enhancing soybean salt tolerance.
[0111] Table 7. Na+ in soybeans under salt stress + / K + Value data statistical analysis
[0112]
[0113] Note: All data are from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05). Statistical analysis was performed using SPSS 20.0 software.
[0114] Na, consisting of above-ground and underground parts + and K + Further analysis of the effect of GmNRT1.5c overexpression on the Na⁺ / K⁺ ratio revealed that, under LN and HN conditions, the Na⁺ / K⁺ ratio of the overexpressing lines after salt stress was significantly lower than that of the wild-type WT plants (Table 7 and 1). Figure 8 This result indicates that overexpression of GmNRT1.5c not only reduces Na⁺ accumulation but also helps maintain ion homeostasis within the plant, thereby enhancing its tolerance to salt stress.
[0115] Table 8 Statistical Analysis of Nitrate Nitrogen Content in Soybean Aboveground Parts under Salt Stress
[0116]
[0117] Note: All data are from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05). Statistical analysis was performed using SPSS 20.0 software.
[0118] To investigate whether GmNRT1.5c participates in the regulation of nitrogen accumulation, the nitrate nitrogen content in the aboveground parts of soybean under different treatments was further measured. Under normal conditions, overexpression of GmNRT1.5c had no significant effect on the nitrate nitrogen content in the aboveground parts (Table 8 and 1). Figure 9 However, under salt stress, the nitrate nitrogen content in the aboveground parts of the overexpressing lines was significantly higher than that of the wild-type WT. Under LN conditions, OE-1 and OE-2 increased by 27.60% and 40.06%, respectively; under HN conditions, the increases were even more significant, reaching 111.24% and 110.77%, respectively (Table 8 and ). Figure 9 ).
[0119] Fresh aboveground soybean samples from each treatment group were collected after 28 days of cultivation. The samples were ground in liquid nitrogen, and the nitrate nitrogen content was determined using the salicylic acid colorimetric method. All data were obtained from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05).
[0120] Table 9 Statistical Analysis of Nitrate Nitrogen Content in Soybean Under Salt Stress
[0121]
[0122] Note: All data are from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test (P < 0.05). Statistical analysis was performed using SPSS 20.0 software.
[0123] A similar trend was observed in the roots under salt stress. Under salt stress, the nitrate nitrogen content in the underground parts of the overexpressing lines was significantly higher than that of the wild-type WT. Under LN conditions, the nitrate nitrogen content of OE-1 and OE-2 increased by 11.90% and 23.81%, respectively, while under HN conditions, it increased by 88.11% and 18.60%, respectively (Table 9 and 10). Figure 10 ).
[0124] Fresh soybean underground samples were collected from each treatment after 28 days of cultivation. The samples were ground in liquid nitrogen, and the nitrate nitrogen content was determined using the salicylic acid colorimetric method. All data were from three independent replicate experiments and are expressed as mean ± standard deviation. Different lowercase letters indicate significant differences between treatment groups after Student-Newman-Keuls test. P <0.05).
[0125] In summary, overexpression of GmNRT1.5c effectively alleviates the damage caused by salt stress to soybeans by promoting nitrate nitrogen accumulation and maintaining ion homeostasis. This dual regulatory mechanism differs from the previously reported mechanism of action of AtNRT1.5, highlighting the important role of GmNRT1.5c in coordinating nitrogen uptake and salt stress response.
[0126] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
[0127] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.
[0128] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.
Claims
1. GmNRT1.5c The application of genes in regulating soybean salt tolerance is characterized by, The GmNRT1.5c The CDS sequence of the gene is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, By increasing the content of soybeans GmNRT1.5c Increasing gene expression levels improves soybean salt tolerance.
3. A method for improving the salt tolerance of soybeans, characterized in that, Upregulating receptors in soybeans through genetic engineering GmNRT1.5c Increased gene expression, enhancing the expression level and / or activity of GmNRT1.5c protein, thereby improving soybean salt tolerance; GmNRT1.5c The CDS sequence of the gene is shown in SEQ ID NO: 1, and the amino acid sequence of the GmNRT1.5c protein is shown in SEQ ID NO:
2.
4. The application of the method for improving the salt tolerance of soybeans as described in claim 3 in soybean breeding.
5. A method for cultivating highly salt-tolerant transgenic soybeans, characterized in that, The steps include: overexpression in recipient soybeans GmNRT1.5c The gene was used to increase the content and / or activity of GmNRT1.5c protein in recipient soybeans to obtain gene overexpression lines. The salt tolerance of the gene overexpression lines was determined by detecting the expression level and / or activity of GmNRT1.5c protein in the overexpression lines. The determination method included: if the expression level and / or activity of GmNRT1.5c protein in the gene overexpression lines was high, then the soybeans had high salt tolerance. The CDS sequence of the GmNRT1.5c gene is shown in SEQ ID NO: 1, and the amino acid sequence of the GmNRT1.5c protein is shown in SEQ ID NO:
2.
6. A method for detecting GmNRT1.5c Primer pairs for overexpressing the GmNRT1.5c gene in soybean lines, wherein the primer pairs are used for detecting the GmNRT1.5c gene overexpression lines as described in claim 5, characterized in that... The nucleotide sequences of the primer pairs are shown in SEQ ID NO: 3 and SEQ ID NO:
4.
7. The purpose of the reagent kit, characterized in that, The kit contains molecular biological elements capable of regulating the expression level of a specific gene; the specific gene is a gene related to regulating soybean salt tolerance; the molecular biological elements may optionally include: a combination of overexpression elements of the specific gene, and / or a combination of elements that inhibit or reduce the expression level of the specific gene, and / or a combination of elements that silence the expression of the specific gene, and / or a combination of elements that knock out the expression of the specific gene; the purpose is to regulate soybean salt tolerance.
8. The use of the reagent kit according to claim 7, characterized in that, The molecular biological element is a combination of elements that overexpress the specific gene.
9. The use of the reagent kit according to claim 7, characterized in that, The specific gene is GmNRT1.5c The gene, whose CDS sequence is shown in SEQ ID NO: 1, or an equivalent gene that has the same plant physiological function.
10. Includes GmNRT1.5c A recombinant expression vector of a gene or its homologous gene, wherein the recombinant expression vector is an overexpression vector.