Use of an inhibitor targeting miR-26a-5p in EVs for the treatment of liver fibrosis by blocking hepatic stellate cell activation

Abstract

This invention discloses the application of an inhibitor targeting miR-26a-5p in endothelial cells (EVs) in the treatment of liver fibrosis by blocking hepatic stellate cell activation, belonging to the field of biomedical technology. This invention targets the core pathological mechanism of liver fibrosis induced by the high-glucose microenvironment of type 2 diabetes. It utilizes sponge molecules targeting miR-26a-5p to specifically adsorb miR-26a-5p within hepatocytes, and prepares miR-26a-5p-deficient hepatocyte-derived EVs. These EVs can regulate the key target site of miR-26a-5p in hepatic stellate cells (HSCs), effectively inhibiting abnormal HSC activation and collagen deposition, thereby delaying or blocking the occurrence and progression of type 2 diabetes-related liver fibrosis. This invention provides a novel and effective technical strategy and solution for the clinical treatment of type 2 diabetes-related liver fibrosis.

Description

Technical Field

[0001] This invention relates to the application of an inhibitor targeting miR-26a-5p in EVs in the treatment of liver fibrosis by blocking the activation of hepatic stellate cells, and belongs to the field of biomedical technology. Background Technology

[0002] Type 2 diabetes mellitus (T2DM) has become one of the most prevalent metabolic diseases worldwide. Liver fibrosis, a core pathological link in the progression of T2DM-related chronic liver disease, leads to a 5-year survival rate of less than 50% once it progresses to cirrhosis, and is highly likely to further develop into liver failure and liver cancer. Currently, liver fibrosis is the second leading cause of death in T2DM patients after cardiovascular complications. Clinically, the incidence of liver fibrosis in T2DM patients with metabolic-related fatty liver disease is as high as 30.6%, becoming a key bottleneck affecting patient prognosis. However, current clinical treatments for T2DM-related liver fibrosis lack specificity. Existing methods mostly focus on basic aspects such as "blood glucose control" and "metabolic improvement," but their targets are not the core pathological links of liver fibrosis and cannot directly target key processes such as hepatic stellate cell activation and collagen deposition. Therefore, in-depth analysis of the core regulatory mechanisms of T2DM-related liver fibrosis and screening of key intervention targets are of significant scientific value and clinical significance for overcoming clinical treatment difficulties and reducing liver disease-related mortality in T2DM patients.

[0003] The essence of liver fibrosis is the excessive deposition of extracellular matrix components and abnormal remodeling of liver tissue structure. The most critical cellular event is the activation and transformation of resting hepatic stellate cells (HSCs) into a myofibroblast-like phenotype. The persistently high glucose environment in patients with type 2 diabetes mellitus (T2DM) is a key initiating factor for liver fibrosis. Hepatocytes, as the core component of liver parenchymal cells, play an irreplaceable dual role as both "initiator" and "regulator" in the HSC activation-mediated liver fibrosis process. Hepatocyte Ninjurin2 can regulate the expression and secretion of PDGF-BB, and PDGF-BB can promote HSC activation and liver fibrosis through paracrine signaling. Hepatocyte E4BP4 can also promote HSC activation and liver fibrosis through OPN-mediated intercellular crosstalk. Therefore, hepatocytes play a crucial role in the HSC activation process. However, traditional cytokines are mostly polypeptides or proteins, easily degraded by proteases in vivo, with half-lives typically ranging from minutes to hours. Moreover, most of them are soluble signaling molecules, which easily diffuse with blood circulation after entering the body and cannot be accurately concentrated in the liver damage area. This "off-target effect" greatly limits the safety of its clinical application.

[0004] The core advantage of extracellular vesicles (EVs) over traditional free cytokines lies in their double-membrane structure, which can encapsulate multiple signaling molecules such as miRNAs, proteins, and lipids in a single pass, forming a "multi-signal packet." This packet is then precisely delivered between hepatocytes and stellate cells via surface homing proteins, resulting in a prolonged blood half-life of several hours to days and resistance to enzymatic degradation. Studies have confirmed that serum EV levels are significantly elevated in patients with type 2 diabetes mellitus (T2DM). Hepatocyte-derived EVs can carry iron ions into hepatocytes and hepatocytes and hepatocytes and hepatocytes and iron overload in hepatocytes in patients with NAFLD or NASH, thereby promoting fibrotic activation of hepatocytes. MASP1-rich EVs derived from hepatocytes can also activate hepatocytes to promote liver fibrosis. These findings suggest that high glucose levels promote EV production, and that hepatocyte-derived EVs play a crucial role in hepatocyte-mediated liver fibrosis. Summary of the Invention

[0005] This invention discovers that in the high-glucose environment of type 2 diabetes mellitus (T2DM), hepatocytes secrete extracellular vesicles (EVs) rich in specific microRNAs (miR-26a-5p). These EVs can be taken up by hepatic stellate cells (LX2), thereby activating stellate cells, promoting their migration and the expression of fibrosis-related proteins (such as COL1A1 and αSMA), ultimately leading to the occurrence and development of liver fibrosis.

[0006] Based on this, the core objective of the present invention is to provide a novel technical solution for treating T2DM-related liver fibrosis, specifically involving a Sponge-inhibitor based on an adeno-associated virus (AAV) vector that targets and adsorbs miR-26a-5p, and miR-26a-5p-deficient hepatocyte-derived EVs obtained by the inhibitor, in order to solve the technical problems of the lack of existing T2DM-related liver fibrosis treatments, poor targeting, and limited efficacy.

[0007] This invention utilizes the aforementioned AAV carrier-mediated Sponge-inhibitor to specifically adsorb miR-26a-5p within hepatocytes, thereby targeting and inhibiting miR-26a-5p activity, and ultimately preparing miR-26a-5p-deficient hepatocyte-derived EVs. These EVs can specifically regulate key targets of miR-26a-5p in hepatic stellate cells, effectively inhibiting abnormal activation and migration of hepatic stellate cells, reducing collagen deposition, and ultimately achieving a therapeutic effect of delaying or blocking the occurrence and progression of T2DM-related liver fibrosis.

[0008] This invention provides a novel and highly targeted treatment pathway for T2DM-related liver fibrosis by precisely targeting miR-26a-5p to regulate the pathological process of liver fibrosis, filling a technological gap in the field.

[0009] To achieve the above objectives, the present invention provides the following solution: The first object of the present invention is to provide the use of miR-26a-5p in the preparation of products for the diagnosis or evaluation of fibrosis-related diseases.

[0010] In one embodiment of the present invention, the fibrosis-related diseases include liver fibrosis, pulmonary fibrosis, renal fibrosis, or myocardial fibrosis.

[0011] In one embodiment of the present invention, the fibrosis-related disease is T2DM-related liver fibrosis.

[0012] In one embodiment of the present invention, the product assesses the risk of T2DM-related liver fibrosis by detecting the expression level of miR-26a-5p in extracellular vesicles in biological samples.

[0013] In one embodiment of the present invention, the extracellular vesicles are extracellular vesicles derived from hepatocytes.

[0014] A second objective of this invention is to provide a miR-26a-5p inhibitor, which is a nucleic acid molecule that inhibits the activation, proliferation, or migration of hepatic stellate cells by reducing the activity or expression level of miR-26a-5p.

[0015] In one embodiment of the present invention, the Gene ID number of miR-26a-5p is 407015.

[0016] In one embodiment of the present invention, the nucleic acid molecule is selected from antisense oligonucleotides, small interfering RNA, short hairpin RNA, and sponge molecules.

[0017] In one embodiment of the invention, the sponge molecule contains a binding site that can competitively bind to miR-26a-5p.

[0018] In one embodiment of the present invention, the nucleotide sequence encoded by the sponge molecule is shown in SEQ ID NO.6.

[0019] A third object of the present invention is to provide the use of miR-26a-5p inhibitors in the preparation of products for the prevention, improvement or treatment of fibrosis-related diseases.

[0020] In one embodiment of the present invention, the fibrosis-related diseases include liver fibrosis, pulmonary fibrosis, renal fibrosis, or myocardial fibrosis.

[0021] In one embodiment of the present invention, the fibrosis-related disease is T2DM-related liver fibrosis.

[0022] A fourth objective of this invention is to provide a recombinant adeno-associated virus vector, wherein the adeno-associated virus contains the miR-26a-5p inhibitor.

[0023] In one embodiment of the present invention, a CV307, Ad5 / Ad2 type or Ad55 type is used as the carrier.

[0024] A fifth object of the present invention is to provide an engineered extracellular vesicle containing a miR-26a-5p inhibitor, or an extracellular vesicle containing a lower amount of endogenous miR-26a-5p than that derived from an unmodified parental cell.

[0025] In one embodiment of the present invention, the extracellular vesicles are derived from host cells expressing a miR-26a-5p inhibitor.

[0026] In one embodiment of the present invention, the extracellular vesicles are derived from hepatocytes lacking miR-26a-5p.

[0027] A sixth object of the present invention is to provide a medicament for the prevention, improvement or treatment of T2DM-related liver fibrosis, the medicament comprising the miR-26a-5p inhibitor or the recombinant adeno-associated virus vector or the engineered extracellular vesicles.

[0028] In one embodiment of the present invention, the drug exists in the form of pills, tablets, lyophilized powders, granules, capsules, aqueous solutions, alcoholic solutions, oil solutions, syrups, emulsions, suspensions, suppositories, solutions for injection or infusion, gel candies, etc.

[0029] In one embodiment of the present invention, the drug is a solid, semi-solid, or liquid substance for oral or injectable use.

[0030] In one embodiment of the invention, the drug further includes pharmaceutically acceptable excipients.

[0031] In one embodiment of the invention, the pharmaceutically acceptable excipient is selected from one or more of excipients, disintegrants, lubricants, sweeteners, and binders.

[0032] A seventh object of the present invention is to provide the use of the miR-26a-5p inhibitor, the recombinant adeno-associated virus vector, or the engineered extracellular vesicles in the preparation of a medicament that inhibits miR-26a-5p expression.

[0033] Preferably, the use of the miR-26a-5p inhibitor, the recombinant adeno-associated virus vector, or the engineered extracellular vesicles in the preparation of medicaments for the prevention, improvement, or treatment of fibrosis-related diseases.

[0034] In one embodiment of the present invention, the fibrosis-related diseases include liver fibrosis, pulmonary fibrosis, renal fibrosis, or myocardial fibrosis.

[0035] In one embodiment of the present invention, the fibrosis-related disease is type 2 diabetes-related liver fibrosis.

[0036] The present invention also provides a method for constructing the sponge molecule, comprising the following steps: amplifying the target tandem sequence by PCR, then ligating the target tandem sequence into an enzyme-digested vector, identifying and sequencing to verify, thereby obtaining an intervention vector containing the sponge molecule.

[0037] Beneficial effects: This invention conducts multi-level research at the cellular and molecular levels, exploring the regulatory effects and mechanisms of sponge inhibitors and miR-26a-5p-deficient hepatocyte-derived EVs on hepatic stellate cell activation and liver fibrosis. This provides new ideas and theoretical basis for the prevention and treatment of type 2 diabetes-related liver fibrosis. This invention discovers that: (1) Hepatocytes can secrete exosomes (EVs), and the exosome-related marker proteins CD9, CD81, TSG101, and ALIX are positively expressed in the EVs of hepatocytes. These results are consistent with the characteristics of exosomes, confirming that the EVs isolated in this invention are exosomes; (2) Hepatocyte-derived EVs are involved in regulating the activation and migration of HSCs. Among them, glucose-free hepatocyte-derived EVs have no significant effect on the activation and migration of HSCs, but glucose-mediated hepatocyte-derived EVs significantly promote the activation and migration of HSCs. (3) Compared with mice on a normal diet, the expression of miR-26a-5p in the liver of T2DM mice was significantly increased. Compared with hepatocyte-derived EVs in the glucose-free group, the content of miR-26a-5p in hepatocyte-derived EVs in the high-glucose group was increased; (4) The promoting effect of miR-26a-5p-deficient hepatocyte-derived EVs on HSC activation and migration is weakened.

[0038] Based on the above-mentioned mechanism of action, the Sponge-inhibitor, adeno-associated virus, and miR-26a-5p-deficient hepatocyte-derived EVs provided by this invention can successfully silence miR-26a-5p, inhibit abnormal activation of hepatic stellate cells and collagen deposition, providing a new candidate drug for the clinical treatment of T2DM-related liver fibrosis, which is of great significance for improving patient prognosis. Attached Figure Description

[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0040] Figure 1 For the isolation and identification of hepatocyte-derived EVs: A. morphological observation of hepatocyte-derived EVs using transmission electron microscopy (TEM); B. particle size distribution and concentration analysis of EVs using nanoparticle tracing (NTA); C. detection of EV marker proteins using Western blot; D. quantitative analysis of the relative expression of EV marker proteins. p<0.05; p < 0.001; Figure 2 The following data were used to detect miR-26a-5p expression: A. Relative expression level of miR-26a-5p in primary hepatocyte (PHC)-derived EVs; B. Relative expression level of miR-26a-5p in HepG2-derived EVs; C. Relative expression level of miR-26a-5p in THLE-2-derived EVs; D. Relative expression level of miR-26a-5p in mouse liver. p < 0.001; p < 0.0001; Figure 3 The effects of miR-26a-5p mimic on LX2 cell activation and migration; A. Western blot detection of COL1A1 and αSMA protein expression in LX2 cells from different treatment groups; B. Quantitative analysis of the relative expression of the above proteins; C. Representative images of LX2 cell migration assay; D. Quantitative statistical analysis of LX2 cell migration rate. p<0.05; p < 0.001; p < 0.0001; Figure 4 To investigate the effect of conditioned medium on LX2 cell activation; A. Western blot detection of LX2 cell activation marker proteins (COL1A1 and αSMA); B. Quantitative analysis of the relative expression of activation marker proteins; C. Western blot detection of LX2 cell activation marker protein expression after treatment with Glc (-)-CM, HG-CM, and EV-free HG-CM (HG-non-EVs-CM); D. Quantitative analysis of the relative expression of activation marker proteins after EV removal. p<0.05; p < 0.001; p < 0.0001; Figure 5 To illustrate the role of hepatocyte-derived EVs in regulating LX2 cell activation; A. Schematic diagram of the co-culture experiment of hepatocyte-derived EVs and LX2 cells; B. Fluorescence imaging of LX2 cells taking up PKH67-labeled HepG2-derived EVs; C. Western blot detection of COL1A1 and αSMA protein expression in LX2 cells after EV treatment; D. Quantitative relative expression of activation marker proteins in LX2 cells after EV treatment; E. Immunofluorescence staining of αSMA in LX2 cells after EV treatment. p<0.05; p < 0.001; p < 0.0001; Figure 6 Schematic diagram of adeno-associated virus CV307 vector (element sequence: TBGp+chimeric intron-EGFP-mir155 (MCS)-WPRE-BGH polyA); Figure 7 This is a schematic diagram of the pHelper carrier; Figure 8 A schematic diagram of the AAV-RC vector spectrum; Figure 9 To validate the effectiveness of miR-26a-5p sponge-inhibitor transfection; Figure 10 The effect of miR-26a-5p sponge inhibitor on the regulation of LX2 cell activation by hepatocyte CM / EVs; A. Western blot detection of COL1A1 and αSMA protein expression in LX2 cells after treatment with different culture media; B. Quantitative analysis of the relative expression of the above proteins; C. Western blot detection of COL1A1 and αSMA protein expression in LX2 cells after treatment with different EVs; D. Quantitative analysis of the relative expression of the above proteins. p<0.05; Figure 11To investigate the reversal effect of miR-26a-5p sponge inhibitor on mimic-induced activation / migration of LX2 cells; A. Western blot analysis of COL1A1 and αSMA protein expression in LX2 cells from different treatment groups; B. Quantitative analysis of the relative expression of the above proteins; C. Quantitative analysis of the relative expression of COL1A1 mRNA; D. Quantitative analysis of the relative expression of αSMA mRNA; E. Representative images of LX2 cell migration assay; F. Quantitative statistical analysis of LX2 cell migration rate. p<0.05; p < 0.001; , p<0.0001. Detailed Implementation

[0041] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0042] The raw materials involved in the following examples: Table 1 Reagents

[0043] Table 2 Primers

[0044] The methods involved in the following embodiments: Isolation and culture of primary hepatocytes (PHC): a) Preoperative preparation: Prepare calcium- and magnesium-free Hank's balanced salt solution (HBSS), collagenase IV solution (dissolved in HBSS, final concentration 0.05%), and complete hepatocyte culture medium (DMEM high glucose medium + 10% fetal bovine serum + 100 U / mL penicillin + 100 μg / mL streptomycin) in advance. All solutions are preheated in a 37°C water bath. b) Anesthesia and disinfection of mice: WT mice were anesthetized with an intraperitoneal anesthesia machine. After the corneal reflex disappeared, the mice were fixed supine on the operating table and the abdominal skin was disinfected with 75% ethanol. c) Liver perfusion: The abdominal skin and peritoneum are incised to expose the inferior vena cava and portal vein. An indwelling needle is inserted and secured at the portal vein. Preheated (37°C) calcium- and magnesium-free HBSS is rapidly injected, while the inferior vena cava is incised to release blood at a rate of 5 mL / min. Perfusion is continued for 5 minutes to flush the blood from the liver. The solution is then replaced with collagenase IV and perfusion is continued. During perfusion, the liver is gently massaged until it becomes enlarged, lighter in color, and softer in texture (approximately 10-15 minutes). d) Hepatocyte isolation and purification: The perfused liver was excised and placed in a sterile culture dish. The liver tissue was minced using sterile scissors, and the cell suspension was filtered through a 200-mesh cell sieve to remove tissue fragments. The filtrate was collected in a centrifuge tube and centrifuged at 800 rpm for 5 min. The supernatant was discarded, and the pellet was resuspended in complete hepatocyte culture medium. Density gradient centrifugation buffer (Percoll, density 1.077 g / mL) was added, and the mixture was centrifuged at 1500 rpm for 20 min. The intermediate hepatocyte layer was then aspirated. e) Inoculation and Culture: Wash hepatocytes twice with complete hepatocyte culture medium. Inoculate hepatocytes into pre-coated culture dishes at a density of 1 × 10⁶ cells / mL. 6 Cells were inoculated at a density of 1 / mL and cultured in a 37°C, 5% CO2 incubator. After 24 hours of inoculation, the medium was replaced with fresh medium to remove non-adherent cells. The medium was then replaced every 2 days thereafter.

[0045] Example 1: Construction and validation of an animal model of liver fibrosis associated with type 2 diabetes mellitus (T2DM) This embodiment aims to construct and validate an animal model that can simulate the pathological features of type 2 diabetes mellitus (T2DM) complicated with liver fibrosis, providing an in vivo basis for subsequent research, as detailed below: 1.1 Model Construction Male C57BL / 6J mice were purchased and acclimatized for one week in an SPF-grade environment. Subsequently, the mice were randomly divided into two groups: (1) Wild-type control group (WT group): fed with normal standard feed for 20 consecutive weeks.

[0046] (2) T2DM model group (HFD+STZ group): The mice were fed a high-fat diet (60% fat content) for 20 consecutive weeks. In the 8th week of high-fat feeding, after fasting for 12 hours, streptozotocin (STZ, dissolved in 0.1 mol / L citrate buffer, pH 4.5) was injected intraperitoneally at a dose of 100 mg / kg body weight, once daily for 5 consecutive days. The WT group mice were injected intraperitoneally with the same volume of citrate buffer during the same period.

[0047] 1.2 Model Validation One week after STZ injection, blood was collected from the tail vein of mice to measure their fasting blood glucose (after fasting for 12 hours). If the fasting blood glucose level remained stable above 11.1 mmol / L for three consecutive days, and typical symptoms of diabetes such as polydipsia, polyphagia, polyuria, and slow weight gain were observed, the T2DM model was considered to have been successfully established.

[0048] Mice were sacrificed after 20 weeks of feeding, and liver tissue was collected. The expression levels of fibrosis markers COL1A1 and α-SMA in liver tissue were detected by qRT-PCR and Western blot.

[0049] 1.3 Results The results showed that, compared with the wild-type control group (WT group), the mRNA and protein expression levels of COL1A1 and α-SMA in the liver tissue of mice in the T2DM model group (HFD+STZ group) were significantly increased, indicating that the model successfully simulated the pathological process of liver fibrosis accompanying T2DM.

[0050] Example 2: Isolation and identification of extracellular vesicles (EVs) derived from hepatocytes under high glucose conditions This embodiment aims to isolate EVs from hepatocytes cultured under different blood glucose environments and identify their basic characteristics to ensure the quality of EVs used in subsequent functional experiments, as detailed below: 2.1 Cell Culture and EV Collection The experiment was conducted using the normal human hepatocyte line THLE-2 (or primary hepatocytes, HepG2 cells). The cells were cultured in DMEM medium containing 10% fetal bovine serum and placed in a 37°C, 5% CO2 incubator.

[0051] When the cell confluence reaches 80%-90%, the medium is replaced with one containing 0.5% exosome-depleted fetal bovine serum (FBS), and the cells are divided into two groups: (1) Sugar-free group (Glc(-) group): Sugar-free DMEM medium was used.

[0052] (2) High sugar group (HG group): High sugar DMEM medium was used.

[0053] Continue culturing for 12 h, and collect the culture supernatant from both groups of cells.

[0054] 2.2 Separation of EVs EVs were separated using ultracentrifugation. The steps are as follows: (1) Centrifuge the collected cell culture supernatant at 300g for 10 min at 4℃ to remove cells and dead cells.

[0055] (2) Take the supernatant and centrifuge at 10,000g for 30 min at 4℃ to remove larger cell debris and microvesicles.

[0056] (3) Take the supernatant again and centrifuge at 100,000g for 2 hours at 4°C to precipitate EVs.

[0057] (4) Discard the supernatant and resuspend the precipitate with pre-cooled PBS to obtain the purified EVs sample. After aliquoting, store at -80℃ for later use.

[0058] 2.3 Identification of EVs (1) Morphological observation: 10 μL of EV resuspension was added to a copper grid and left at room temperature for 5 min. Excess liquid was removed. 2% phosphotungstic acid solution (pH 7.0) was added for negative staining for 5 min. After natural drying, the separated EVs were observed by transmission electron microscopy (TEM). The separated EVs appeared as biconcave discs. Figure 1 A).

[0059] (2) Particle size analysis: The EVs resuspension was appropriately diluted with PBS and detected by nanoparticle tracer analysis (NTA) (detection parameters: temperature 25℃, detection time 60s). The particle size of EVs was mainly distributed in the range of 50-200nm. Figure 1 B), which conforms to the typical particle size characteristics of exosomes.

[0060] (3) Detection of marker proteins: Western blot analysis showed that hepatocyte-derived EVs expressed exosome marker proteins CD9, CD81, TSG101 and ALIX, while Calnexin protein expression was negative (consistent with typical exosome characteristics, confirming that the EVs isolated in this example were exosomes). It was also clear that high glucose promotes the production and release of exosomes. Figure 1 CD).

[0061] The above results demonstrate that this method successfully separated high-purity EVs.

[0062] Example 3: High glucose environment induces upregulation of miR-26a-5p expression in hepatocytes and their EVs This embodiment aims to verify whether a high-glucose environment alters the levels of specific miRNAs contained in EVs secreted by hepatocytes, as detailed below: 3.1 Extraction and detection of RNA in EVs Total RNA was extracted from the livers of the wild-type control group (WT group) and the T2DM model group (HFD+STZ group) in Example 1, and total RNA was extracted from EVs isolated from the glucose-free group (Glc(-) group) and the high-glucose group (HG group) in Example 2. The RNA was reverse transcribed, and the relative expression level of miR-26a-5p was detected by qRT-PCR, with U6 snRNA as an internal control.

[0063] qRT-PCR results showed that, compared with Glc(-) group hepatocyte EVs (Glc(-)-EVs), the relative expression level of miR-26a-5p in HG group hepatocyte EVs (HG-EVs) was significantly increased. Figure 2 AC). Similar results were observed in animal experiments; compared to the wild-type control group (WT group), the expression of miR-26a-5p in the liver of mice in the T2DM model group (HFD+STZ group) was significantly increased. Figure 2 D) The above results indicate that a high-glucose environment can specifically promote the encapsulation of more miR-26a-5p in the EVs secreted by hepatocytes.

[0064] 3.2 Transfection of miR-26a-5p mimic into LX2 cells Human hepatic stellate cells (LX2) were cultured in DMEM high-glucose medium (10% fetal bovine serum, 1% penicillin and antibiotic) at 37°C in a 5% CO2 saturated humidity incubator. Cells in the logarithmic growth phase were used for transfection. LX2 cells were digested, centrifuged, and resuspended, then seeded at an appropriate density in 6-well plates and cultured until cell confluence reached 60%–70% before transfection.

[0065] miR 26a 5p mimic (100 pmol) served as the overexpression group, and mimic NC (negative control, equal volume) served as the control group. Lipofectamine 2000 transfection reagent was used according to the manufacturer's instructions. The mimic and transfection reagent were diluted separately with serum-free Opti-MEM medium, allowed to stand and mix to form a complex, and then added to cell culture plates. After transfection, cells were cultured for 48 hours in DMEM high-glucose medium (10% fetal bovine serum, 1% penicillin antibody) containing HCl or TGFβ (10 ng / mL). Cells were then collected for subsequent assays such as Western blot and cell function experiments.

[0066] Under control (Hcl) conditions, compared with LX2 cells transfected with negative control (NC), cells transfected with miR... 26a In 5p mimic cells, the relative expression level of the fibrosis activation marker protein COL1A1 was approximately 1.8 times that of the negative control (NC) (P<0.01), and the relative expression level of αSMA was approximately 1.5 times that of the NC group (P<0.05). Under TGFβ (10 ng / mL) induction conditions, the expression levels of COL1A1 and αSMA in the mimic group were approximately 1.5 times (P<0.001) and 1.4 times (P<0.05) respectively compared to the corresponding NC groups. Figure 3 A B).

[0067] Cell migration assays showed that under HCl conditions, the migration rates of LX2 cells in the mimic group at 12 h and 24 h were approximately 2.1 times (P<0.001) and 1.6 times (P<0.01) higher than those in the NC group, respectively; under TGFβ induction conditions, the migration rates of cells in the mimic group at 12 h and 24 h were approximately 1.2 times (P<0.05) and 1.1 times (P<0.01) higher than those in the corresponding NC group, respectively. Figure 3 C D).

[0068] The above results indicate that transfection with miR-26a-5p mimic can significantly promote the expression of fibrosis activation marker proteins and cell migration ability in LX2 cells. It also showed similar pro-fibrotic effects under both control (Hcl) and TGFβ induction conditions, further confirming that miR-26a-5p is a regulatory factor that promotes fibrosis activation in LX2 cells.

[0069] Example 4: High-glucose hepatocyte-derived EVs promote the activation and migration of hepatic stellate cells (LX2). This embodiment aims to demonstrate that EVs secreted by hepatocytes under high glucose conditions are key messengers mediating the hepatic stellate cell fibrosis phenotype, as detailed below: 4.1 Conditioned Culture Medium Experiment Primary hepatocytes (PHC) or HepG2 cells were used in the experiments. Cells were cultured in DMEM medium containing 10% fetal bovine serum and incubated at 37°C in a 5% CO2 incubator.

[0070] When the cell confluence reaches 80%-90%, the medium is replaced with DMEM containing 0.5% exosome-depleted fetal bovine serum (FBS), and the cells are divided into two groups: (1) Sugar-free group (Glc(-) group): Sugar-free DMEM medium was used.

[0071] (2) High sugar group (HG group): High sugar DMEM medium was used.

[0072] After culturing for another 12 hours, the culture supernatant from both groups of cells was collected and used as conditioned medium. Human hepatic stellate cells (LX2) were seeded and cultured for 24 hours, then divided into three groups for treatment: (1) Glc(-)-CM group: Add conditioned medium derived from Glc(-) group.

[0073] (2) HG-CM group: Add conditioned medium derived from HG group.

[0074] (3) HG-non EVs-CM group: Conditioned culture medium from HG group, which was treated by EVs separation and removal.

[0075] After 48 h of culture, cell migration ability was detected by scratch assay, and the expression of fibrosis marker protein α-SMA was detected by Western blot.

[0076] The results show that... Figure 4As shown, compared with the Glc(-)-CM group, the HG-CM group significantly promoted the migration of LX2 cells and the expression of α-SMA protein. However, the HG-non-EVs-CM group, after removing EVs, showed significantly weakened effects in promoting migration and fibrosis. This preliminarily demonstrates that EVs are the component in conditioned medium that exerts the main biological effects.

[0077] 4.2 EV Co-culture Experiment Following the method described in Example 2, section 2.2, EVs derived from HepG2 cells were collected from the glucose-free and high-glucose groups. These EVs were labeled with PKH67 fluorescent dye and co-cultured with LX2 cells for 24 h. Fluorescence microscopy revealed green fluorescent signals (from PKH67-labeled EVs) in the cytoplasm of LX2 cells, confirming that LX2 cells could effectively take up hepatocyte-derived EVs. Figure 5 (AB). LX2 cells were divided into three groups for treatment: (1) Blank control group: normal culture (DMEM medium containing 10% fetal bovine serum).

[0078] (2) Glc(-)-EVs group: EVs from Glc(-) group, with a final concentration of 50 μg / mL.

[0079] (3) HG-EVs group: EVs from HG group, with a final concentration of 50 μg / mL.

[0080] After 48 hours of cultivation, relevant indicators were measured. Results showed: When co-cultured with EVs derived from HepG2 cells, the relative protein expression level of the fibrosis marker COL1A1 in LX2 cells of the HG-EVs group was approximately 1.5 times that of the Glc (-)-EVs group (P<0.01), and the relative protein expression level of αSMA was approximately 1.3 times that of the Glc (-)-EVs group (P<0.05). When co-cultured with primary hepatocyte-derived EVs, the relative protein expression levels of fibrosis markers COL1A1 and αSMA in LX2 cells treated with HG-EVs were approximately 2-fold (P<0.001) and 1.4-fold (P<0.05) higher than those in the Glc (-)-EVs group. Figure 5 C, 5D).

[0081] Meanwhile, immunofluorescence staining results showed that the fluorescence intensity of αSMA and the proportion of positive cells in LX2 cells treated with HG-EVs were significantly higher than those in the Glc (-)-EVs group, indicating that the activation level of LX2 cells was significantly enhanced. Figure 5 E).

[0082] Example 5: Construction of sponge molecules and adeno-associated virus targeting miR-26a-5p This embodiment aims to construct a sponge molecule and adeno-associated virus (AAV) targeting miR-26a-5p. The AAV system includes the CV307 vector plasmid, the pHelper helper plasmid, and the AAV-RC packaging plasmid. Figures 6-8 ): 5.1 Plasmids Using miR-26a-5p sponge-inhibitor (as shown in SEQ ID NO.6) as a template, BamHI and HindIII restriction sites and protective bases were introduced at both ends of the target sequence using primers has-miR-26a-5p-F and has-miR-26a-5p-R to obtain the target fragment containing miR-26a-5p sponge-inhibitor (as shown in SEQ ID NO.6) (as shown in SEQ ID NO.7). The CV307 vector was double-digested with BamHI and HindIII to obtain the digested vector fragment. The target fragment and the digested vector fragment were recombinantly cloned and transformed, and cultured upside down on LB plates for 12–16 h. Positive clones were identified by PCR using identification primers F / R. The positive clones were then sequenced, and the adeno-associated virus plasmid CV307-miR-26a-5p sponge-inhibitor containing the sequence miR-26a-5p sponge-inhibitor as shown in SEQ ID NO.6 was finally obtained.

[0083] The nucleotide sequence of the target fragment is as follows (the nucleotide sequence is shown in SEQ ID NO.7, and the underlined parts are the restriction enzyme sites): CTCGGCATGGACGAGCTGTACAAG GGATCC TAAAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAA AAGCTT GGTTATCGATAATCAACCTCTGGA The nucleotide sequence of miR-26a-5p sponge-inhibitor is as follows (nucleotide sequence as shown in SEQ ID NO.6): TAAAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAACTTCAGCCTATCCTGACTACTTGAA 5.2 Transfection (1) 24 hours before transfection, AAV-293 cells in logarithmic growth phase were digested with trypsin and the cell density was adjusted to approximately 5 × 10⁶ cells / year in DMEM medium containing 10% fetal bovine serum. 6 Cells were re-seeded at 15 mL per 10 cm cell culture dish and cultured at 37°C in a 5% CO2 incubator. Transfection was initiated after 24 hours when the cell density reached 70%–80%. (2) Replace the medium with one containing 2% serum 2 hours before transfection; (3) Add the prepared DNA solutions (5 μg of CV307-miR-26a-5p plasmid, 5 μg of pHelper vector plasmid, and 5 μg of AAV-RC plasmid) to a sterile centrifuge tube, mix them with the corresponding volume of transfection reagent (Shanghai Jikai Biotechnology Co., Ltd.), adjust the total volume to 1 mL, and incubate at room temperature for 15 min. (4) The mixture was slowly added dropwise to the culture medium of AAV-293 cells, mixed well, and cultured in a 37°C, 5% CO2 cell culture incubator; Note: The addition process must be uniform, and you should try to avoid blowing the cells up.

[0084] (5) After culturing for 6 hours, discard the culture medium containing the transfection mixture, add 10 mL of PBS solution to wash once, gently shake the culture dish to wash away the remaining transfection mixture, and then discard it. (6) Slowly add 10 mL of DMEM cell culture medium containing 5% FBS and continue culturing at 37°C in a 5% CO2 incubator for 48-72 h.

[0085] 5.3 Concentration and Purification (1) Collect AAV-293 cell supernatant and cells 72 h after transfection (0 h can be counted from transfection) according to cell state; (2) Centrifuge at 3000 g for 5 min at 4℃ to separate the cells from the supernatant; (3) Add AAV virus concentration kit (Shanghai Jikai Biotechnology Co., Ltd.) to the supernatant to obtain the virus in the supernatant. Resuspend the cell pellet in resuspension solution, freeze and thaw repeatedly in liquid nitrogen / 37℃ 4 times, and centrifuge. Then combine the two virus fractions; (4) Balance the samples separately, and put the ultracentrifuge tubes containing the virus supernatant into the Beckman ultracentrifuge one by one. Set the centrifugation parameters to 63,000 rpm, the centrifugation time to 2 h, and the centrifugation temperature to 18℃. (5) Aspirate the isolated layer containing the virus. Place it in an ultrafiltration column for ultrafiltration until a colorless or pale pink clear liquid is obtained; (6) Sterilize the obtained adeno-associated virus solution by passing it through a 0.22 μm filter membrane and dispense it as required.

[0086] 5.4 Validity Verification (1) Experimental steps 1) HepG2 cells were divided into groups of 5 × 10⁻⁶. 4 Inoculate 1 unit / well into a 6-well plate, and divide into three groups: Control group: Negative control (NC); miR-26a-5p mimic group: Add miR-26a-5p mimic; miR-26a-5p mimic+int group: Adeno-associated virus miR-26a-5p sponge-inhibitor viral fluid infection was performed simultaneously with the addition of miR-26a-5p mimic. When the fusion rate reached 60%-70%, the miR-26a-5p mimic+int group was incubated with adeno-associated virus miR-26a-5p sponge-inhibitor solution (MOI=80) along with miR-26a-5p mimic (100pmol). After incubation for 48 hours, the samples were collected for the next step of the experiment.

[0087] 2) The mRNA level of miR-26a-5p in the test samples was detected by qRT-PCR. Total RNA was extracted using Trizol reagent according to the product instructions. The concentration and purity of RNA were determined using a UV spectrophotometer at 260 and 280 nm. Reverse transcriptase reactions were performed using the PrimeScript® RT kit and the ABI PRISM 7500 sequence detection PCR system. The mRNA level in the samples was relatively quantified using the SYBR amplification kit, with three replicates per sample. The U6 gene was used as an internal control. -△△Ct The results were analyzed using relative quantitative analysis.

[0088] (2) Experimental results qPCR results showed that, compared with the NC group, the expression level of miR-26a-5p in hepatocytes of the miR-26a-5p mimic group was significantly increased (P<0.05); while the expression level of miR-26a-5p in the miR-26a-5p mimic+int group was significantly lower than that in the miR-26a-5p mimic group (P<0.05). Figure 9 This study confirmed that miR-26a-5p sponge-inhibitor can efficiently adsorb miR-26a-5p in hepatocytes.

[0089] Example 6: miR-26a-5p is a key molecule mediating the EV-induced hepatic stellate cell fibrosis effect. This embodiment aims to clarify, through gain-of-function and loss-of-function experiments, that miR-26a-5p is the core functional molecule by which HG-EVs exert their pro-fibrotic effect, as detailed below: 6.1 Inhibition of miR-26a-5p function in LX2 cells HepG2 cells were divided into 5×10 4 Inoculate 1 unit / well into a 6-well plate, and divide into 2 groups: (1) Control group: negative control NC (empty vector); (2) miR-26a-5p sponge-inhibitor group: adeno-associated virus miR-26a-5p sponge-inhibitor viral fluid infection; When the cells reached a confluence of 60%-70%, adeno-associated virus (adeno-associated virus) miR-26a-5p sponge-inhibitor solution (MOI=80) was added. After incubation for 48 hours, the culture supernatant of both groups of cells was collected as conditioned medium. Human hepatic stellate cells (LX2) were seeded and cultured for 24 hours, then divided into two groups for treatment: (1) Control group (NC-CM): Conditioned culture medium from which the control group is derived; (2) miR int-CM group: conditioned medium derived from miR-26a-5p sponge-inhibitor group.

[0090] The cells were cultured for 48 hours before testing. Results showed that, compared to the NC-CM control group, the relative protein expression level of COL1A1 in LX2 cells of the miR int-CM group was significantly reduced to approximately 0.5-fold (P<0.05), and the relative protein expression level of αSMA was significantly reduced to approximately 0.7-fold (P<0.05), indicating that the ability of miR int-CM to upregulate COL1A1 and αSMA expression was significantly inhibited. Figure 10 A B).

[0091] 6.2 Suppressing the function of miR-26a-5p in EVs Following the method described in Example 5, a miR-26a-5p sponge inhibitor was transfected into HepG2 cells. After incubation for 48 hours, EVs expressing low levels of miR-26a-5p (denoted as miR int-EVs) were isolated using the method described in Example 2. LX2 cells were then treated with miR int-EVs. EVs (denoted as NC-EVs) were isolated from HepG2 cells infected with a negative control recombinant adeno-associated virus using the same method. LX2 cells were divided into two groups: (1) Control group (NC-EVs): EVs from the NC-CM group, with a final concentration of 50 μg / mL; (2) miR int-EVs group: EVs from miR int-CM group, with a final concentration of 50 μg / mL.

[0092] The results were detected after 48 hours of culture. The results showed that, compared with the NC-EVs control group, the relative protein expression level of COL1A1 in the miR int-EVs group was significantly reduced to approximately 0.4 times that of the control group (P<0.05), and the relative protein expression level of αSMA was significantly reduced to approximately 0.6 times that of the control group (P<0.05), indicating that the ability of miR-26a-5p to upregulate COL1A1 and αSMA expression was significantly inhibited. Figure 10 C D).

[0093] 6.3 Direct regulation of miR-26a-5p levels in LX2 cells LX2 cells were directly transfected with miR-26a-5p mimics, inhibitors (miR-26a-5p sponge-inhibitors), or negative controls (NC) and cultured for 48 hours.

[0094] The results showed that, compared with the negative control (NC) group, transfection with miR... 26a 5p mimic (26a) After treatment with the 5p mimic group, the relative protein expression level of COL1A1 was approximately 2.2 times that of the control group (P<0.01), and the relative protein expression level of αSMA was approximately 2.5 times that of the control group (P<0.01). The mRNA expression level of COL1A1 was approximately 1.5 times that of the control group (P<0.05), and the mRNA expression level of αSMA was approximately 1.8 times that of the control group (P<0.01). Simultaneously, the cell migration rate at 12 h and 24 h was approximately 1.3 times (P<0.01) and 1.8 times (P<0.001) that of the control group, respectively, indicating that miR... 26a 5p mimic can significantly promote the activation and migration of LX2 cells.

[0095] co-transfect miR 26a 5p mimic and miR 26a 5p sponge inhibitor (26a) After treatment with the 5p mi+int group, the relative protein expression level of COL1A1 was significantly reduced to approximately 1.1-fold of the control group (P<0.05), and the relative protein expression level of αSMA was significantly reduced to approximately 1.6-fold of the control group (P<0.05). The mRNA expression levels of COL1A1 and αSMA were also significantly reduced to approximately 0.7-fold (P<0.01) and 1.1-fold (P<0.05) of the control group, respectively. Cell migration rate was also significantly reduced to approximately 1.1-fold (P<0.05) and 1.5-fold (P<0.001) of the control group at 12h and 24h, respectively, indicating that miR... 26a 5p sponge Inhibitors can effectively reverse miR 26a The activation and migration-promoting effects of 5p mimic on LX2 cells ( Figure 11 A F).

[0096] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. The use of miR-26a-5p in the preparation of products for the diagnosis or evaluation of fibrosis-related diseases, characterized in that, The Gene ID number of miR-26a-5p is 407015; Preferably, the fibrosis-related diseases include liver fibrosis, pulmonary fibrosis, renal fibrosis, or myocardial fibrosis; Preferably, the fibrosis-related disease is type 2 diabetes-related liver fibrosis; Preferably, the product is evaluated by detecting the expression level of miR-26a-5p in extracellular vesicles in biological samples.

2. A miR-26a-5p inhibitor, characterized in that, The miR-26a-5p inhibitor is a nucleic acid molecule that inhibits the expression of miR-26a-5p; Preferably, the nucleic acid molecule is selected from antisense oligonucleotides, small interfering RNA, short hairpin RNA, and sponge molecules; more preferably, it is a sponge molecule. Among them, the Gene ID number of miR-26a-5p is 407015.

3. The miR-26a-5p inhibitor according to claim 2, characterized in that, The sponge molecule contains binding sites that can competitively bind to miR-26a-5p.

4. The miR-26a-5p inhibitor according to claim 3, characterized in that, The nucleotide sequence encoded by the miR-26a-5p sponge molecule is shown in SEQ ID NO.

6.

5. Use of the miR-26a-5p inhibitor according to any one of claims 2 to 4 in the preparation of a medicament for the prevention, improvement or treatment of fibrosis-related diseases; Preferably, the fibrosis-related diseases include liver fibrosis, pulmonary fibrosis, renal fibrosis, or myocardial fibrosis; Preferably, the fibrosis-related disease is liver fibrosis caused by type 2 diabetes.

6. The use according to claim 5, characterized in that, The miR-26a-5p inhibitor is delivered via a gene therapy vector; Preferably, the gene therapy vector is a recombinant adeno-associated virus vector or a recombinant adenovirus.

7. A recombinant adeno-associated virus vector, characterized in that, The recombinant adeno-associated virus vector comprises the miR-26a-5p inhibitor as described in any one of claims 2 to 4; Preferably, the recombinant adeno-associated virus vector is CV307, Ad5 / Ad2, or Ad55.

8. An engineered extracellular vesicle, characterized in that, The extracellular vesicles comprise any miR-26a-5p inhibitor as described in any of claims 2 to 4, or the content of their endogenous miR-26a-5p is lower than that of extracellular vesicles from unmodified parental cells; Preferably, the extracellular vesicles are derived from host cells expressing the miR-26a-5p inhibitor of any one of claims 2 to 4; Preferably, the extracellular vesicles are derived from hepatocytes lacking miR-26a-5p.

9. A drug for preventing, improving, or treating liver fibrosis associated with type 2 diabetes, characterized in that, The drug comprises the miR-26a-5p inhibitor of any one of claims 2 to 4, the recombinant adeno-associated virus vector of claim 7, or the engineered extracellular vesicle of claim 8; Preferably, the drug exists in the form of pills, tablets, lyophilized powders, granules, capsules, aqueous solutions, alcoholic solutions, oil solutions, syrups, emulsions, suspensions, suppositories, solutions for injection or infusion, gel candies, etc. Preferably, the drug is a solid, semi-solid, or liquid substance for oral or injectable use; Preferably, the drug further includes pharmaceutically acceptable excipients; Preferably, the pharmaceutically acceptable excipient is selected from one or more of excipients, disintegrants, lubricants, sweeteners, and binders.

10. The use of the miR-26a-5p inhibitor according to any one of claims 2 to 4, the recombinant adeno-associated virus vector according to claim 7, or the engineered extracellular vesicles according to claim 8 in the preparation of a drug for inhibiting miR-26a-5p expression, characterized in that, The application is in the preparation of medicines for the prevention, improvement or treatment of fibrosis-related diseases; Preferably, the fibrosis-related diseases include liver fibrosis, pulmonary fibrosis, renal fibrosis, or myocardial fibrosis; Preferably, the fibrosis-related disease is type 2 diabetes-related liver fibrosis.

Images