Detection system for detecting tetracycline antibiotics based on biological nanopore and detection method thereof
This detection system, which combines bio-nanopores with allosteric transcription factors and specific DNA operon sequences, solves the problems of rapid, sensitive, and specific detection of tetracycline antibiotics, achieving high sensitivity and specificity, and is suitable for food, environmental, and clinical samples.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHONGQING INST OF GREEN & INTELLIGENT TECH CHINESE ACAD OF SCI
- Filing Date
- 2026-03-18
- Publication Date
- 2026-06-16
AI Technical Summary
Existing technologies cannot achieve rapid, sensitive and specific detection of tetracycline antibiotics, especially for low-concentration residues in complex samples. Furthermore, traditional methods suffer from problems such as expensive equipment, complex operation, and cross-reactivity.
A detection system based on bio-nanopores was adopted, which utilizes TetR/OtrR allosteric transcription factors to bind to specific DNA operon sequences, forms allosteric protein-DNA complexes through magnetic bead immobilization, and utilizes α-hemolysin protein to self-assemble nanopores for real-time monitoring of current changes for detection.
It achieves highly sensitive, specific, and easy-to-operate detection of tetracycline antibiotics, with detection limits down to the micromolar level. It is suitable for a variety of complex samples and has high-throughput screening capabilities and stability.
Smart Images

Figure CN122218218A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of nanopore detection technology, and relates to a detection system and method for detecting tetracycline antibiotics based on biological nanopores. Background Technology
[0002] Tetracycline antibiotics, as broad-spectrum antibacterial drugs, are widely used in animal husbandry, clinical treatment, and agricultural production. However, their excessive use and improper discharge can easily cause food residues and environmental water pollution, which can then accumulate in the food chain and harm human health. Therefore, establishing a rapid, sensitive, and highly specific detection method for tetracycline antibiotics is an important requirement for food and drug safety management and ecological environment monitoring.
[0003] Currently, the main detection methods for tetracycline antibiotics include high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay (ELISA), and mass spectrometry (MS). Among these, HPLC and MS have high detection accuracy, but they suffer from problems such as expensive equipment, complex operation procedures, long detection cycles, and the need for professional personnel to operate them. Although ELISA is simple to operate and fast, it has drawbacks such as easy antibody cross-reactivity, limited sensitivity, and poor repeatability of detection results, making it difficult to meet the actual needs of rapid on-site detection and low-concentration residue detection.
[0004] Gene expression refers to the process of synthesizing functional gene products from genetic information derived from genes. It can be regulated through several steps, including transcription, RNA splicing, translation, and post-translational modifications. Transcriptional regulation can be divided into three main pathways: genetic regulation (direct interaction between transcription factors and target genes), interaction between regulatory transcription factors and transcriptional mechanisms, and epigenetic regulation (non-sequence changes in DNA structure that affect transcription). Directly regulating target DNA expression through transcription factors is the simplest and most direct method of altering transcriptional levels. Allosteric regulation is a direct, rapid, and effective way to regulate protein function. It refers to the binding of regulatory molecules to sites other than the protein's active site, inducing conformational changes in the protein and thereby regulating a series of functions at the protein's active site. Proteins that exhibit regulatory characteristics through allosteric effects are called allosteric proteins. Molecules that regulate allosteric proteins are called allosteric regulatory molecules. The binding sites of allosteric regulatory molecules on allosteric proteins are called allosteric sites. Allosteric regulatory molecules that act on allosteric sites to enhance protein function (affinity, catalytic efficiency, etc.) are called allosteric agonists, while allosteric regulatory molecules that act on allosteric sites to reduce protein function are called allosteric inhibitors. Due to the dynamic effects of allosteric proteins in the regulatory process and the controllability of regulatory molecules, and their wide participation in important life processes such as cellular metabolism and signal transduction, exploring allosteric effects has become an important direction in protein structure and function research.
[0005] Nanopore-based detection and analysis technologies have attracted widespread interest across various disciplines due to their incredible potential applications. Nanopore sensing technology is a label-free, single-molecule resolution technique that requires no labeling or pretreatment of biomolecules, no signal amplification, and only a small sample size. Bio-nanopore technology, in particular, involves embedding biological channel proteins into phospholipid membranes, liposome membranes, or polymer membranes to form relatively stable nanochannels for detecting small molecules, offering ease of operation and reproducibility. Currently, bio-nanopore technology has been applied to the detection of nucleic acids, peptides, and small ionic molecules. However, there is still no systematic solution combining this technology with the (TetR / OtrR)-TetO allosteric recognition system for the specific detection of tetracycline antibiotics, nor is a standardized detection procedure based on this system established, thus hindering the rapid and sensitive detection of tetracycline antibiotics. Summary of the Invention
[0006] In view of this, the purpose of the present invention is to provide a detection system and method for detecting tetracycline antibiotics based on biological nanopores.
[0007] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a detection system for tetracycline antibiotics based on a bio-nanopore. The detection system includes a tetracycline antibiotic regulatory protein, a hairpin DNA structure, and a bio-nanopore. The tetracycline antibiotic regulatory protein is TetR or OtrR, an allosteric transcription factor. The sequence of the hairpin DNA molecule contains a specific DNA operon sequence corresponding to the allosteric transcription factor. The hairpin DNA structure is any one of the nucleic acid sequences shown in SEQ ID NO:1-6. The bio-nanopore is formed by the self-assembly of α-hemolysin protein in a phospholipid bilayer. Furthermore, the present invention also provides a method for detecting tetracycline antibiotics based on biological nanopores, wherein the detection steps are as follows: S1: Tetracycline antibiotic regulatory proteins and hairpin DNA are incubated in a buffer solution for 30–45 min to prepare an allosteric protein-DNA complex, which removes unbound hairpin DNA. The buffer solution is 20 mM Tris-HCl, pH 8.0. S2: Nanopores were formed by the self-assembly of α-hemolysin in a phospholipid bilayer. A bias voltage of 140mV-180mV was applied, and the changes in ion current were monitored. S3: Add the allosteric protein-DNA complex to the nanopore detection cell and record the background current signal; S4: Add the sample to be tested, monitor the current blocking signal in real time, analyze the signal frequency, amplitude and signal duration parameters, and quantitatively calculate the antibiotic concentration in the sample to be tested by establishing a standard curve of tetracycline antibiotic standard concentration gradient-characteristic signal quantity. Preferably, the molar ratio of the tetracycline antibiotic regulatory protein to the hairpin structure DNA in step S1 is 2:1; Preferably, in step S1, the solid support is a magnetic microsphere with nickel or cobalt ions modified on its surface. The microsphere adsorbs allosteric protein-DNA complexes through tag proteins or primary amine groups to remove unbound hairpin structure DNA. Preferably, the detection buffer in step S2 is 1 M KCl2 0-25 mM HEPES, pH 7.2; Preferably, in step S4, the sample to be tested is any one or more of the following: food sample, environmental water sample, serum and urine clinical biological sample, meat, dairy product, fruit and vegetable food sample, surface water, groundwater, and sewage environmental water sample.
[0008] Furthermore, the application of the tetracycline antibiotic detection system based on bio-nanopores in the preparation of reagent kits for food and drug testing, environmental monitoring, and clinical testing.
[0009] The beneficial effects of this invention are as follows: 1. High sensitivity and single-molecule detection capability By utilizing the sensing properties of bio-nanopores (such as α-hemolysin), the perforation behavior of DNA molecules can be detected at the single-molecule level, achieving ultrasensitive detection of tetracycline antibiotics. Unbound free DNA is removed through magnetic bead immobilization strategies (such as His-Tag beads or NHS beads), significantly reducing background signal interference and lowering the detection limit to the micromolar level, meeting the needs for low-concentration residue detection.
[0010] 2. High specificity and anti-interference ability Based on the highly specific binding between allosteric transcription factors (TetR / OtrR) and their specific DNA operon sequences (TetO), and the allosteric effect between tetracycline antibiotics and regulatory proteins, specific recognition of the target antibiotic is ensured, avoiding the cross-reactivity problems common in traditional immunological methods. Magnetic bead immobilization technology (such as His-Tag magnetic beads) is used to immobilize the regulatory protein-DNA complex on a solid support. Washing removes unbound free DNA and other impurities, further improving the signal-to-noise ratio and anti-interference capability of the detection signal.
[0011] 3. Simple operation and rapid detection This method eliminates the need for fluorescent or radioactive labeling of DNA or antibodies, simplifying sample pretreatment steps and reducing detection costs. The magnetic bead immobilization strategy is simple to operate and quick to bind (5-10 minutes), suitable for standardized and automated operations, and holds promise for high-throughput screening.
[0012] Not only can the presence or absence of characteristic current signals be used to determine whether a sample contains tetracycline antibiotics, but a standard curve can also be established to accurately quantify the concentration of the target substance based on the number of signals.
[0013] By analyzing the differences in the number, growth rate, and duration of signals generated after DNA release induced by different tetracycline antibiotics (such as tetracycline and oxytetracycline), the intensity of action of different antibiotics can be distinguished, providing a new dimension for antibiotic identification.
[0014] 4. The system exhibits strong stability and repeatability. Under optimized buffer system and bias voltage, the α-hemolysin nanopores can stably detect for more than 3 hours without pore blockage, indicating that the method has good reproducibility and reliability. The relative standard deviation of the detection results is ≤5%, and the detection limit of the system for tetracycline antibiotics is as low as the micromolar level.
[0015] 5. Broad application prospects This detection method is applicable to the detection of a variety of complex samples, including food (meat, dairy products, fruits and vegetables), environmental water samples (surface water, groundwater, sewage), and clinical biological samples (serum, urine), and has broad application prospects in the fields of food and drug supervision, environmental monitoring, and clinical diagnosis.
[0016] In summary, this technical solution successfully constructs a new tetracycline antibiotic detection platform that is highly sensitive, highly specific, easy to operate, and stable and reliable by combining the single-molecule sensing advantages of biological nanopores with the specific recognition mechanism of allosteric transcription factors.
[0017] Other advantages, objectives, and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination, or may be learned from practice of the invention. The objectives and other advantages of the invention can be realized and obtained through the following description. Attached Figure Description
[0018] To make the objectives, technical solutions, and advantages of the present invention clearer, the preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings, wherein: Figure 1 This is a schematic diagram illustrating the allosteric effect detection principle based on nanopores. Figure 2 Flowchart of the magnetic bead immobilization strategy; Figure 3 The electrophoresis diagram shows, from left to right, P4-1, DCV, T45, hucR, hosR, Marker, TETO6, TETO5, TETO6 (annealed), and TETO5 (annealed). Figure 4 The current ectopic signals of different DNAs detected by nanopores are shown from top to bottom as follows: TetO1, T45, DCV, and P4-1. Figure 5 The signal distribution diagrams for TetO and control group DNA nanopore detection are shown. ab: T45-50nM-140mv; cd: DCV-50nM-140mv; ef: P4-1-50nM-140mv; gh: TetO1-50nM-140mv; the test buffers were all 1M NaCl 10mM Tris pH7.5. Figure 6 SDS-PAGE electrophoresis image of allosteric protein; Figure 7 Electrophoresis images of TetR-TetO complexes with different molar ratios; Figure 8 TetR-TetO and [TC-Mg] 2+ Characteristic signal diagram of concentration gradient response, where a represents [TC-Mg]. 2+ Final concentration 10 μM; b represents [TC-Mg] 2+ Final concentration 20 μM; c represents [TC-Mg] 2+ Final concentration 40 μM; d represents [TC-Mg] 2+ The final concentration was 80 μM; the final concentration of the TetR-TetO1 (molar ratio 2:1) complex was 50 nM-25 nM, and the buffer solution was 1 M KCl, 25 mM HEPES, and pH 7.2. The bias voltage was 180 mV, and the test time was 10 min. Detailed Implementation
[0019] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic representations of the basic concept of the present invention. Unless otherwise specified, the following embodiments and features can be combined with each other.
[0020] The accompanying drawings are for illustrative purposes only and are schematic diagrams, not actual pictures. They should not be construed as limiting the invention. To better illustrate the embodiments of the invention, some parts in the drawings may be omitted, enlarged, or reduced, and do not represent the actual product dimensions. It is understandable to those skilled in the art that some well-known structures and their descriptions may be omitted in the drawings.
[0021] In the accompanying drawings of the embodiments of the present invention, the same or similar reference numerals correspond to the same or similar components. In the description of the present invention, it should be understood that if terms such as "upper," "lower," "left," "right," "front," and "rear" indicate the orientation or positional relationship based on the orientation or positional relationship shown in the drawings, they are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, the terms used to describe positional relationships in the drawings are only for illustrative purposes and should not be construed as limiting the present invention. For those skilled in the art, the specific meaning of the above terms can be understood according to the specific circumstances.
[0022] Example 1: Preparation of the detection system 1. Preparation of hairpin-structured DNA DNA powder synthesized by BGI Genomics was dissolved in TE buffer to prepare a 50 μM DNA solution. The concentration of the prepared DNA solution was measured using an ultra-micro UV spectrophotometer. Based on the measurement results, hairpin-structured DNA (final concentration 1 μM) was synthesized using a denaturation-annealing method.
[0023] This experiment selected three denaturation-annealing methods to synthesize hairpin-structured DNA: ① Gradient thermal cycler: denature at 95℃ for 5 min, then gradient cooling at -1℃ / min to 20℃; ②Deformation in a constant-temperature metal bath at 95℃ for 5 minutes, followed by natural cooling; ③ After denaturation at 95℃ in a water bath for 5 minutes, allow it to cool naturally.
[0024] Table 1: DNA Sequence Information Table Primer name Sequence (5' to 3') Serial Number TETO1 TCCTCCTCCCCTATCAATGATAGATTCTTCTATCATTGATAGG SEQ ID NO:1 TETO2 TCCTCCTCCCCTATCAATGATAGATTCTTCTATCATTGATAGGA SEQ ID NO:2 TETO3 TCCTCCTCCCCTATCAATGATAGAGTTCTCTCTATCATTGATAGG SEQ ID NO:3 TETO4 TCCTCCTCCCCTATCAATGATAGAGTTCTCTCTATCATTGATAGGC SEQ ID NO:4 TETO5 TCCTCCTCCCTCTATCAATGATAGGGTTCTCCCTATCATTGATAGAG SEQ ID NO:5 TETO6 TCCTCCTCCCTCTATCAATGATAGGGTTCTCCCTATCATTGATAGAGC SEQ ID NO:6 DCV AAAGTATTACCAGAAAGCTGAGGAACCATCACCCTAATCAAGT SEQ ID NO:7 P4-1 TATTGCTCAGCGTGGCAGCAGCCAACTCAGCTTCCTTTCGGGCTTTG SEQ ID NO:8 DNA from standard samples and synthesized hairpin structure DNA were subjected to polyacrylamide gel electrophoresis (15% gel concentration), stained with nucleic acid fluorescent dye, and the synthesis effect was detected by ultraviolet transmission.
[0025] All DNA samples involved in this embodiment are shown in the diagram. To the left of the marker are standard samples P4-1 (hairpin structure), DCV (hairpin structure), and T45 (single-stranded structure). To the right are the TET hairpin structures we used, numbered 01-06. TETO5 and TETO6 show two bands, indicating that their hairpin structures are not prominent. After annealing, we re-ran the gel, and the results are as follows. Figure 3 As shown, the annealed DNA appears as a single band. By comparing it with the standard hairpin structure sample, we can see that the DNA forms a relatively stable hairpin structure at this time.
[0026] 2. Preparation of allosteric proteins 2.1 Preparation of main reagents: LB liquid medium: Weigh 5g NaCl, 5g yeast, and 10g peptone. Dissolve them in a small amount of ddH2O and bring the volume to 1000mL. Dispense into 200mL Erlenmeyer flasks and seal them with a sealing film. Place the dispensed LB liquid medium in an autoclave (121℃, 30min) for sterilization. When the autoclave temperature drops to 60℃ and the pressure is 0, open the autoclave and remove the LB liquid medium. Store at room temperature.
[0027] LB solid medium: Weigh 1g NaCl, 1g yeast, and 2g peptone. Dissolve them in a small amount of ddH2O and bring the volume to 200mL. Dispense into 100mL Erlenmeyer flasks. Add 1.5g agar to each Erlenmeyer flask and seal with a sealing film. Place the dispensed LB liquid medium in an autoclave (121℃, 30min) for sterilization. When the autoclave temperature drops to 60℃ and the pressure reaches 0, open the autoclave and remove the LB solid medium. Store at room temperature.
[0028] Ampicillin (100mg / mL): Weigh 1g of ampicillin powder, dissolve it with a small amount of ddH2O, and bring the volume to 10mL. Filter the solution through a 0.22μm filter to sterilize it, and dispense it into 1.5mL EP tubes. Store at -20℃.
[0029] IPTG (100 mmol / L): Weigh 0.2383 g of IPTG powder, dissolve it with a small amount of ddH2O, and bring the volume to 10 mL. Filter the solution through a 0.22 μm filter to remove bacteria, and dispense it into 1.5 mL EP tubes. Store at -20°C.
[0030] 10×PBS: 0.1M NaH2PO4, 0.1M Na2HPO4, 8% NaCl, pH adjusted to 7.4 with NaOH and H3PO4, stored at room temperature.
[0031] Binding Buffer: 20mM PBS, 0.5M NaCl, 5mM imidazole, prepared fresh before use.
[0032] EluteBuffer: 20mM PBS, 0.5M NaCl, 1M imidazole, prepare fresh before use.
[0033] Washing Buffer: 20mM PBS, 0.5M NaCl, 60mM imidazole, prepare fresh before use.
[0034] StripBuffer: 20mM PBS, 0.5M NaCl, 0.1M EDTA, prepare fresh before use.
[0035] ChargeBuffer: 100mM NiSiO4, prepared fresh for immediate use.
[0036] NHS magnetic bead washing buffer 1: 1mM ice HCl.
[0037] NHS quenching buffer: 3M ethanolamine (pH=9.0).
[0038] His-Tag magnetic bead binding buffer: 1xPBS, 0.3mM NaCl, store at room temperature.
[0039] KCl buffer 2: 1M KCl, 10mM Tris, pH=8.0.
[0040] 2.2 Construction of Recombinant Plasmids The allosteric factor protein (HucR, OtrR, HosA, TetR) genes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The allosteric factor protein genes were cloned into the pET-23a(+) plasmid vector via NdeI and XhoI restriction enzyme sites. Six histidine residues were introduced at the C-terminus without affecting protein function to synthesize recombinant plasmids pET-23a(+)-hucr, pET-23a(+)-otrr, pET-23a(+)-hosa, and pET-23a(+)-tetr.
[0041] 2.3 Transformation of recombinant plasmids Take 50 μL of E.coli BL21 (DE3) competent cells into a 1.5 mL EP tube, add 2-5 μL of recombinant plasmid, mix well, and place on ice for 30 min.
[0042] The EP tube was transferred to a 42°C metal bath heater and allowed to stand for 1 minute, then quickly transferred to ice and allowed to stand for 2-3 minutes.
[0043] Add 1 mL of LB liquid culture medium to the EP tube in the clean bench.
[0044] Place the bacteria in a 37°C constant temperature shaker and shake at 200 rpm for 1 hour to revive the cells and induce expression of the relevant resistance genes on the plasmid.
[0045] After shaking, centrifuge at 13000 rpm and 4℃ for 1 min, remove 900 μL of supernatant, keep 100 μL, and mix well.
[0046] Inside the clean bench, spread 100 μL of the transformant bacteria onto an LB agar plate containing ampicillin (use a pipette to draw 100 μL of the transformant bacteria and drop it onto the plate, then spread it evenly with a spreader). When the bacterial solution is almost dry, invert the plate and place it in a 37°C incubator for 12 hours.
[0047] Bacterial activation and glycerol tube storage. Select a single colony with good growth and inoculate it into 3.5 mL of LB liquid medium containing ampicillin (100 μg / mL). Incubate overnight at 37°C with shaking at 200 rpm. Take 1 mL of bacterial culture and 350 μL of glycerol solution into a glycerol tube, mix well, and store at -80°C.
[0048] 2.4 Allosteric factor protein-induced expression The recombinant engineered bacteria were activated according to the steps described above.
[0049] Take 2 mL of the activated bacterial culture and add it to 200 mL of liquid LB medium (containing 100 μg / mL ampicillin) for 1% inoculation. Place it in a 37°C constant temperature shaker and shake at 200 rpm until its OD595 is in the range of 0.4~0.8, which takes about 2~3 hours.
[0050] Once the bacterial culture entered the exponential growth phase, an appropriate concentration of IPTG was added (the experiment verified that the final IPTG concentrations were 0.1 mM, 0.2 mM, 0.4 mM, and 0.8 mM).
[0051] Place in a constant temperature shaker (experiments verified 16℃ and 37℃), shake at 200 rpm for 12 hours.
[0052] Take 1 mL of the induced bacterial culture into a 1.5 mL EP tube, centrifuge at 13000 rpm and 4℃ for 1 min, remove the supernatant, add 20 μL of 1×PBS and 4 μL of 5×loadingdye, mix well, incubate at 100℃ in a metal bath for 5 min, centrifuge by jogging, and perform SDS-PAGE electrophoresis on the treated sample to verify the expression effect.
[0053] Transfer the bacterial culture with good induction expression to a 50mL centrifuge tube, centrifuge at 8000rpm and 4℃ for 10min, remove the supernatant, and repeat the operation until all the bacterial culture has been centrifuged.
[0054] Add 3-5 mL of 1×PBS to the centrifuged bacterial culture, mix well, centrifuge at 8000 rpm and 4℃ for 10 min, remove the supernatant, and store at -80℃.
[0055] 2.5 Purification of Allosteric Factor Proteins Thaw the bacterial cells that were stored at -80℃ with good induction expression on ice, add 3-5 mL of 1×PBS to resuspend them, and transfer them to a 15 mL centrifuge tube.
[0056] Place the 15mL centrifuge tubes into a beaker containing an ice-water mixture, and sonicate them. Set the program to 3 seconds of sonication followed by 5 seconds of intermittent sonication at 30% power for 25 minutes.
[0057] After lysis, the solution was aliquoted into 1.5 mL EP tubes, centrifuged at 1300 rpm and 4 °C for 10 min, and the supernatant was collected and placed on ice for later use.
[0058] Prepare the nickel column by washing it with 3 column volumes of ddH2O and equilibrating it with 3 column volumes of Binding Buffer to expose the protein binding sites.
[0059] After the nickel column is equilibrated, the prepared supernatant sample is taken and filtered through a 0.2μm hydrophilic filter before loading.
[0060] After loading the sample, wash away unbound impurities with 2 column volumes of Binding Buffer, and wash away any attached proteins with 3 column volumes of Washing Buffer.
[0061] The target protein was eluted with 3.5 mL of Elute Buffer and collected in a 1.5 mL EP tube (the first 5 drops were discarded, and the remaining 2.5 mL were collected).
[0062] After collection, the protein was eluted with 2 column volumes of Elute Buffer and washed with 3 column volumes of ddH2O to remove residual protein.
[0063] The nickel ions in the nickel column were eluted with 1 column volume of Strip Buffer and then washed with 5 column volumes of ddH2O.
[0064] Add 1 mL of Charge Buffer to regenerate the nickel column, wash with 3 column volumes of ddH2O, and store at 4°C for later use.
[0065] Prepare a PD-10 desalting column, wash with 4 column volumes of ddH2O, and then wash with 4 column volumes of 1×PBS.
[0066] Pass the collected 2.5 mL of protein through a column, add 3.5 mL of 1×PBS for elution, and collect the eluted sample using a 3 kD ultrafiltration tube.
[0067] After collection, the column was washed with 4 column volumes of 1×PBS to remove salt, and then washed with 4 column volumes of ddH2O. It was then stored at 4°C for later use.
[0068] The ultrafiltration tube containing the collected samples was centrifuged at 4000 rpm and 4°C for 1 hour.
[0069] After ultrafiltration concentration is completed, the allosteric factor protein solution in the concentration tube is collected into a 1.5 mL EP tube, and the protein purification is verified by SDS-PAGE gel electrophoresis.
[0070] The successfully purified protein was stored at -20°C for later use.
[0071] Two batches of protein samples with high concentrations were purified, and their band distribution was obtained by SDS-PAGE gel electrophoresis as shown in the figure. Figure 6 As shown.
[0072] 2.6 The strategy of using magnetic beads for immobilization and enhancement includes the following two schemes: 1) His-Tag magnetic bead immobilization method Principle: The surface of His-Tag magnetic beads is modified with nickel ions (Ni). 2+ ) or cobalt ions (Co 2+ It can specifically bind to the 6×His tag introduced at the C-terminus or N-terminus of allosteric recombinant proteins to form a stable chelate structure. Its advantages include rapid binding (5–10 min), high specificity, high efficiency, protein directional fixation, sufficient exposure of active sites, simple operation, and suitability for high-throughput screening.
[0073] Specific steps: Protein expression and purification: The allosteric transcription factor gene was cloned into the pET-23a(+) vector, a 6×His tag was introduced at the C-terminus, and the protein was induced by IPTG and purified by nickel column to obtain high-purity recombinant protein.
[0074] Magnetic bead pretreatment: Take an appropriate amount of His-Tag magnetic beads, place them on a magnetic rack for separation, discard the supernatant, and wash with binding buffer.
[0075] Protein binding: Add the purified protein to the magnetic beads and incubate at room temperature for 5–10 min. Collect the supernatant by magnetic separation and repeat the incubation to increase the binding amount.
[0076] Washing: Wash 3–4 times with binding buffer to remove unbound proteins.
[0077] Protein-DNA complex formation: Add specific double-stranded DNA, incubate for 2 h, and wash to remove unbound DNA.
[0078] Effector molecules induce DNA release: Add different concentrations of effector molecules, incubate for 30 min, collect the supernatant by magnetic separation, and obtain the released DNA.
[0079] 2) NHS magnetic bead immobilization method Principle: The N-hydroxysuccinimide ester groups on the surface of NHS magnetic beads can covalently bind to the primary amine groups on the protein surface to form stable amide bonds. Its advantages include covalent binding, strong stability, and suitability for immobilizing untagged proteins.
[0080] Specific steps: Activation of magnetic beads: Take NHS magnetic beads and wash them with 1 mM HCl to remove the protecting groups.
[0081] Protein binding: Add purified protein, incubate at 37°C for 2 h, and collect the supernatant by magnetic separation.
[0082] Washing and blocking: After washing with PBS buffer, 3 M ethanolamine (pH 9.0) was added to block unreacted NHS groups.
[0083] Protein-DNA complex assembly and effector molecule detection: Subsequent steps are the same as the His-Tag magnetic bead method.
[0084] 3. Analysis of the conditions and degree of binding between allosteric proteins and DNA: TetR protein and hairpin DNA were incubated at 37°C for 1 hour with a TetR-TetO1-20mM Tris pH 8.0 ratio. Different ratios and buffer systems were explored, and the degree of binding was verified by 8% PAGE gel electrophoresis.
[0085] pass Figure 4 It is evident that as the protein concentration increases, the amount of free DNA below gradually decreases, indicating that the binding degree between the two increases during this process. However, subsequent nanopore assays revealed that although the amount of free DNA displayed in the lanes was low, perforation signals were still present during the assay. Furthermore, excessively pursuing high binding levels led to excessively high protein concentrations, making nanopore assays extremely difficult. Therefore, after weighing the pros and cons, a suitable protein-DNA molar ratio of 2:1 was found, and the incubation temperature was adjusted to 4°C to prevent dissociation due to excessively high temperatures after binding. Figure 7 The sample shown has high binding efficiency and minimal impact from free DNA.
[0086] 4. Preparation of bio-nanopores 4.1 Assembly of the detection pool (1) Prepare a square Toflon film with a side length of 3cm. Use an electric spark generator to form a circular hole with a diameter of about 150μm in the center of the film. The shape and size of the hole can be observed using an optical microscope.
[0087] (2) Place the two chambers into the metal frame of the detection chamber, with the chambers separated by a prepared Toflon film.
[0088] (3) Rinse the Toflon membrane, chamber and pores three times with ultrapure water, and then soak for 10 hours.
[0089] 4.2 Cleaning of the detection tank (1) Prepare a 15 g / L Na3PO4 solution and a 0.1% HCl solution; (2) Disassemble the detection cell, place the CIS and Trans compartments into a special beaker, add Na3PO4 solution, soak and sonicate for 10 minutes, and clean the inside and outside of the compartments with tweezers wrapped with degreased cotton. Repeat the washing three times; (3) After cleaning, add 0.1% HCl solution to the beaker and immerse in sonication for 10 minutes. Clean the inside and outside of the compartment with tweezers wrapped in degreased cotton. Repeat the washing process three times. (4) Clean the two compartments three times with deionized water as described above; (5) Place the two cleaned compartments into a 40℃ oven to dry for later use.
[0090] 4.3 Formation of phospholipid bilayer membranes (1) Prepare H solution: a mixture of 1 mL pentane and 100 μL hexadecane; prepare L solution: a mixture of 25 mg phospholipid and 2.5 mL pentane; prepare the ion buffer required for the experiment: 1 M NaCl, 10 mM Tris (pH=7.5), filtered through a 0.45 µm filter.
[0091] (2) Use a capillary tube to take 10 μL of H solution and drop it on both sides of the Toflon membrane near the micron pores in the detection cell, so that it spreads on the membrane.
[0092] (3) After the H solution evaporates, use a pipette to add a small amount of ion buffer to the cis compartment and the trans compartment respectively (the liquid level is below the micron pore of the Toflon membrane), and insert a pair of Ag / AgCl electrodes connected to the patch clamp system into the ion buffer.
[0093] (4) Use a capillary tube to take 25 μL of L solution and drop it onto the surface of the ion buffer of the CIS detection cell and the Trans detection cell, so that the L solution is evenly spread on the liquid surface and wait for 30-60 seconds.
[0094] (5) Slowly add the remaining ion buffer solution to the CIS compartment and the Trans compartment respectively, and observe whether a phospholipid bilayer membrane forms. If it forms, proceed with the subsequent experiments; if it does not form, use a pipette to slowly and repeatedly blow the ion buffer solution through the well several times until a phospholipid bilayer membrane forms. During the formation of the phospholipid bilayer membrane, the membrane capacitance in the patch clamp system is used to determine the formation quality, and the membrane voltage is used to examine the mechanical strength of the phospholipid bilayer.
[0095] 4.4 Self-assembly of α-HL nanopores After a stable phospholipid bilayer membrane was formed, 1 μL of 6.25 μg / mL α-HL was added to the CIS detection cell near the pore. The instant α-HL self-assembles on the phospholipid bilayer membrane to form a stable nanochannel will generate a sudden change in ion current; therefore, the formation of the nanochannel can be monitored in real time by observing changes in ion current. Under the conditions of +140 mV voltage and 1 M NaCl at room temperature, a stable open-pore ion current of 85 ± 10 pA was observed after the formation of a single α-HL nanopore channel. Other current values were considered to be due to unsuccessful assembly of the α-HL protein or failure to form a proper phospholipid bilayer membrane; the pore formation time was approximately 50-60 minutes.
[0096] Example 2 Test 1. Sample testing After the ion current in the pore stabilizes, the sample to be tested is injected into the CIS (or Trans) detection cell. Driven by the applied voltage and ion current, the sample moves directionally towards the α-HL nanopore, eventually passing through or interacting with the nanopore and generating a blocking current signal. The picoampere (pA) level current signal generated in the experiment is characterized and analyzed using a low-noise current amplifier. The basic data, such as the ion current signal of the sample migration, are observed and acquired in real time using a patch-clamp system and pClamp10.4 software. The obtained data are analyzed and processed using the Clampfit analytical instrument software.
[0097] 2 Experimental conditions Dilute the 100 μM DNA solution with 1 M NaCl 10 mM Tris pH 7.5 buffer to a final concentration of 100 nM.
[0098] Add NaCl buffer 1 to both chambers of the sample cell, connect the Ag / AgCl electrode to the patch clamp, and apply a bias voltage of 140mV to the trans end for blank testing. Acquire signals for 10 minutes. If the baseline is stable and no translocation signal is generated, it can be used for the next step of sample detection.
[0099] Add the diluted DNA from step 1 and perform nanopore assays for 10-20 minutes each.
[0100] The blocking current signals of different concentrations of double-stranded DNA were observed and recorded using Clamfit software.
[0101] Statistical analysis of DNA translocation signals was performed using Clamfit, Excel, and Origin. The differences in signal intensity detected by solid-state nanopores with different concentrations of double-stranded DNA were investigated.
[0102] 2.3 Discussion of Experimental Results like Figure 4 The ectopic current signal maps of different DNAs are shown. The ectopic current signal maps of different DNAs detected by nanopores, from top to bottom, are: TetO1, T45, DCV, and P4-1.
[0103] like Figure 5 As shown, the distribution and signal characteristics of TetO1 and P4-1 are extremely similar, while P4-1 shows a very standard hairpin structure during the simulation. This indicates that the TetO1 we prepared is DNA with a high content of hairpin structure. Furthermore, through the comparison of the characteristics of the through-hole signal, we found that the TetO1 signal is a very special step signal.
[0104] Example 3: Nanopore detection of TetR-TetO1 and TC-Mg 2+ Gradient reaction The nanopore assembly operation was the same as described in Example 1, with the specific difference being the change in experimental conditions, as follows: Add 1M KCl and 25mM HEPES pH7.2 buffer solution to both chambers of the sample cell. Connect the sample cell to the patch clamp using an Ag / AgCl electrode and apply a bias voltage of 140mV at the trans end for blank testing. Acquire signals for 10 minutes. If the baseline is stable and no translocation signal is generated, it can be used for the next step of sample detection.
[0105] The sample TetR-TetO1 was added separately for nanopore testing for twenty minutes, and then TC-Mg was added. 2+ The sample was added to the sample cell and reacted for ten minutes. Nanopore testing was then performed on the reacted system for 10-20 minutes. The blocking current signal at different concentrations of hairpin-structured DNA was observed and recorded using Clamfit software.
[0106] Statistical analysis of DNA translocation signals was performed using Clamfit, Excel, and Origin. The study investigated the differences in signal intensity detected by bio-nanopores for different concentrations of hairpin-structured DNA.
[0107] Results analysis, such as Figure 8 As shown, in the nanopore assay using 1M KCl, 25mM HEPES, and pH 7.2, the pores exhibited excellent stability during the assay, allowing for continuous detection for approximately three hours. A single gradient remained stable for over 20 minutes without clogging, demonstrating excellent performance. This not only increased the amount of DNA passing through the pore per unit time but also significantly shortened the average residence time, thereby improving the detection and resolution capabilities of the experiment. Furthermore, data analysis revealed that with the increase of TC-Mg... 2+ With increasing final concentration, the total signal quantities generated were 125, 111, 144, 162, and 199 / 10min, respectively. Among them, the through-hole signal quantities of TetO1 were 4, 12, 16, 23, and 22 / 10min, respectively. Overall, a certain linear relationship was observed, but there is still considerable room for improvement in the amount of data. In the future, the signal quantity can be improved by extending the sampling time, increasing the complex concentration, and mixing the components as much as possible during the operation.
[0108] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A detection system for tetracycline antibiotics based on bio-nanopores, characterized in that: The detection system includes a tetracycline antibiotic regulatory protein, a hairpin DNA structure, and a bio-nanopore. The tetracycline antibiotic regulatory protein is TetR or OtrR, an allosteric transcription factor. The sequence of the hairpin DNA molecule contains a specific DNA operon sequence corresponding to the allosteric transcription factor. The hairpin DNA structure is any one of the nucleic acid sequences shown in SEQ ID NO:1-6. The bio-nanopore is formed by the self-assembly of α-hemolysin protein in a phospholipid bilayer.
2. A method for detecting tetracycline antibiotics based on bio-nanopores, characterized in that, The detection steps are as follows: S1: Tetracycline antibiotic regulatory proteins and hairpin DNA are incubated in a buffer solution for 30–45 min to prepare an allosteric protein-DNA complex, which removes unbound hairpin DNA. The buffer solution is 20 mM Tris-HCl, pH 8.
0. S2: Nanopores were formed by the self-assembly of α-hemolysin in a phospholipid bilayer, and a bias voltage of 140mV-180mV was applied to monitor the changes in ion current. S3: Add the allosteric protein-DNA complex to the nanopore detection cell and record the background current signal; S4: Add the sample to be tested, monitor the current blocking signal in real time, analyze the signal frequency, amplitude, and signal duration parameters, and quantitatively calculate the antibiotic concentration in the sample by establishing a standard curve of tetracycline antibiotic standard concentration gradient-characteristic signal quantity.
3. The detection method according to claim 2, characterized in that: The molar ratio of tetracycline antibiotic regulatory protein to hairpin structure DNA in step S1 is 2:
1.
4. The detection method according to claim 2, characterized in that: In step S1, the solid support is a magnetic microsphere with nickel or cobalt ions on its surface. The microsphere adsorbs allosteric protein-DNA complexes through tag proteins or primary amine groups to remove unbound hairpin structure DNA.
5. The detection method according to claim 2, characterized in that: The detection buffer in step S2 is 1 M KCl2 0-25 mM HEPES, pH 7.
2.
6. The detection method according to claim 2, characterized in that: In step S4, the sample to be tested is any one or more of the following: food sample, environmental water sample, serum and urine clinical biological sample, meat, dairy product, fruit and vegetable food sample, and surface water, groundwater, and sewage environmental water sample.
7. The application of the tetracycline antibiotic detection system based on bio-nanopores according to claim 1 in the preparation of reagent kits for food and drug testing, environmental monitoring, or clinical testing.