Oenococcus oeni ta-2a and application thereof

Abstract

This invention provides a strain of *C. truncatum* TA-2a and its applications, belonging to the field of microbial technology. The preservation number of *C. truncatum* TA-2a is CGMCC No. 36758. *C. truncatum* TA-2a exhibits acid and ethanol resistance, and can stably grow and metabolize under typical wine conditions. This bacterium possesses the characteristic of producing highly efficient ethyl carbamate-degrading enzymes, which can be applied to the degradation of ethyl carbamate in wine, reducing the ethyl carbamate content and improving wine safety. During malolactic fermentation of wine, *C. truncatum* TA-2a can also promote the synthesis and accumulation of flavor compounds, increase the types and contents of key aroma substances such as esters, alcohols, aldehydes, ketones, and terpenes, enhance the complexity and typicality of wine aromas, and significantly improve the flavor quality of wine.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of *Chlorella vulgaris* TA-2a and its applications. Background Technology

[0002] Ethyl carbamate (EC) is a potential carcinogen widely found in fermented foods. Its residues in fermented alcoholic beverages such as wine and rice wine have attracted significant attention from researchers. Currently, the control of EC in alcoholic beverage production mainly relies on post-processing techniques, which not only increase production costs but also have limited effectiveness. In recent years, researchers have been screening endogenous microorganisms in fermented food systems, identifying several strains capable of degrading EC, such as… Bacillus amyloliquefaciens JP21 can degrade ethyl carbamate and its precursor urea, reducing the ethyl carbamate content by 17% during simulated fermentation in a pit. Yang Guangming et al. discovered... Providencia The acid urease of sp. JNB815 exhibits good ethanol tolerance in rice wine. Previous studies have mostly focused on the screening of yeasts and Bacillus amyloliquefaciens, with few reports on the screening and application of *Acidococcus faecium*. Summary of the Invention

[0003] In view of the deficiencies in the prior art, the purpose of this invention is to provide a strain of *Coccus tumefaciens* TA-2a, which has the advantage of high production of ethyl carbamate esterase activity, and can be used to reduce the content of ethyl carbamate in wine, while also improving the flavor and quality of wine.

[0004] The objective of this invention is achieved through the following technical solution: This invention provides a strain of *Coccus vinifera* (…). Oenococcus oeni The preservation number of the *C. TA-2a* is CGMCC No. 36758.

[0005] This invention provides a microbial inoculant, comprising *Chlorella vulgaris* TA-2a as described in the above technical solution.

[0006] This invention provides a method for preparing the microbial inoculant described in the above-mentioned technical solution, comprising: The *Chlorella vulgaris* TA-2a was cultured in a culture medium to obtain a microbial inoculum.

[0007] Preferably, the culture temperature is 25~30℃; the culture time is 2~7 days; and the initial pH value of the culture is 4~6.

[0008] This invention provides the application of *Coccus tumefaciens* TA-2a, as described in the above technical solution, in the preparation of ethyl carbamate degrading enzyme.

[0009] This invention provides the application of *Coccus tumefaciens* TA-2a, as described in the above technical solution, in the degradation of ethyl carbamate.

[0010] This invention provides the application of the above-described wine cocci TA-2a in improving wine quality.

[0011] Preferably, the improvement of wine quality includes improving wine flavor and / or reducing the content of ethyl carbamate in the wine.

[0012] Preferably, the wine includes fermented wine and distilled wine; the fermented wine includes rice wine and / or fruit wine; the distilled wine includes brandy and / or baijiu (Chinese white liquor).

[0013] This invention provides a method for improving wine quality, comprising: Add the *Acetobacter TA-2a* strain described in the above technical solution during the fermentation process of the wine.

[0014] The beneficial effects of this invention are: This invention provides a strain of *C. tumefaciens* TA-2a, whose preservation number is CGMCC No. 36758. *C. tumefaciens* TA-2a was obtained through screening and exhibits acid and ethanol resistance, allowing for stable growth and metabolism under typical wine-producing conditions. *C. tumefaciens* TA-2a possesses highly efficient ethyl carbamate-degrading enzyme production capabilities, which can be applied to the degradation of ethyl carbamate in wine, reducing its content and improving its safety. During malolactic fermentation, *C. tumefaciens* TA-2a can also promote the synthesis and accumulation of flavor compounds, increasing the variety and content of key aroma compounds such as esters, alcohols, aldehydes, ketones, and terpenes, enhancing the complexity and typicality of the wine's aroma, and significantly improving its flavor quality.

[0015] The results of the examples show that the *Coccus tumefaciens* TA-2a provided by the present invention can not only efficiently produce ethyl carbamate degrading enzymes and be used to prepare ethyl carbamate degrading enzymes, but can also be directly applied to the degradation of ethyl carbamate in wine, significantly reducing the content of ethyl carbamate in wine; when applied to the malolactic fermentation process of wine, *Coccus tumefaciens* TA-2a can significantly increase the types and contents of esters, alcohols, aldehydes, ketones, and terpenes in wine, improve the complexity and typicality of wine aroma, and improve the flavor of wine.

[0016] The *Chlorella vulgaris* TA-2a provided by this invention offers excellent material for elucidating the mechanism by which *Chlorella vulgaris* degrades ethyl carbamate. It can provide theoretical basis and practical support for developing efficient, safe, and green ethyl carbamate control technologies in alcoholic beverages, and has important application value in the field of safe production and quality improvement of wine.

[0017] Biological Preservation Information Description Chlorella vulgaris TA-2a, Latin scientific name Oenococcus oeni It was deposited on December 17, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 36758. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0019] Figure 1 A shows the colony morphology of strain TA-2a; B shows the results of gradient dilution culture; C shows the streak purification of strain TA-2a. Figure 2 Image showing Gram staining results of strain TA-2a; Figure 3 NH4 + Standard curve graph; Figure 4 The effect of different inoculum amounts on the enzyme production capacity of TA-2a is shown in the figure. Figure 5 The graph shows the effect of initial pH on the enzyme production capacity of TA-2a. Figure 6 For TA-2a strain and commercial strain O. oeni Figure 1 shows the results of the assay for the ability of ethyl carbamate-degrading enzyme 1 to produce carbamate. Figure 7 This is a growth curve diagram of strain TA-2a; Figure 8 Figure showing the effect of different temperatures on the activity of ethyl carbamate degrading enzymes; Figure 9 Figure showing the effect of different pH values ​​on the activity of ethyl carbamate degrading enzymes; Figure 10 The graph shows the results of the ethanol tolerance test for ethyl carbamate degrading enzymes. Figure 11 Radar chart for sensory analysis of wine; Figure 12 Figure showing the effect of different strains of MLF on the ethyl carbamate content of Cabernet Sauvignon wine; Figure 13 Phylogenetic tree diagram of Chlorella vulgaris TA-2a. Detailed Implementation

[0020] This invention provides a strain of *Coccus vinifera* (…). Oenococcus oeni The preservation number of the *C. TA-2a* is CGMCC No. 36758.

[0021] In this invention, the *Chlorella vulgaris* TA-2a is isolated and purified from wine samples. *Chlorella vulgaris* TA-2a is a Gram-positive bacterium; its colonies are smooth, milky white, and less than 1 mm in diameter. *Chlorella vulgaris* TA-2a exhibits highly efficient production of ethyl carbamate-degrading enzymes and can grow well and produce ethyl carbamate-degrading enzymes under initial pH conditions of 4-6.

[0022] This invention obtains *Coccus tumefaciens* TA-2a through screening. *Coccus tumefaciens* TA-2a can stably grow and metabolize under typical wine conditions. *Coccus tumefaciens* TA-2a possesses the characteristic of producing highly efficient ethyl carbamate-degrading enzymes, which can be applied to the degradation of ethyl carbamate in wine, reducing the ethyl carbamate content and improving wine safety. During malolactic fermentation of wine, *Coccus tumefaciens* TA-2a can also promote the synthesis and accumulation of flavor compounds, increasing the types and contents of key aroma substances such as esters, alcohols, aldehydes, ketones, and terpenes, enhancing the complexity and typicality of wine aromas, and significantly improving the flavor quality of wine. The results of the examples show that the *Chlorella vulgaris* TA-2a provided by this invention can not only efficiently produce ethyl carbamate-degrading enzymes, which can be used to prepare ethyl carbamate-degrading enzymes, but also can be directly applied to the degradation of ethyl carbamate in wine, significantly reducing the ethyl carbamate content in wine. When applied to wine fermentation, *Chlorella vulgaris* TA-2a can significantly increase the types and contents of esters, alcohols, aldehydes, ketones, and terpenes in wine, enhancing the aroma and flavor of the wine. The *Chlorella vulgaris* TA-2a provided by this invention provides excellent material for elucidating the mechanism of *Chlorella vulgaris* degradation of ethyl carbamate, and can provide theoretical basis and practical support for developing efficient, safe, and green ethyl carbamate control technologies in wine, having significant application value in the field of safe wine production and quality improvement.

[0023] Furthermore, the *Chlorella vulgaris* strain provided by this invention possesses excellent acid and ethanol resistance. Under acidic culture conditions with a pH of 3.2–3.4, the *Chlorella vulgaris* strain maintains high growth activity and a high cell density even after 10 days of culture at this pH. Simultaneously, the *Chlorella vulgaris* strain also maintains high growth activity under culture conditions with an ethanol volume fraction of 10%–16%, and a relatively high cell density even after 10 days of culture at this ethanol volume fraction, making it suitable for application in malic-lactic acid fermentation processes under appropriate conditions.

[0024] This invention provides a microbial inoculant comprising *Chlorella vulgaris* TA-2a as described in the above-mentioned technical solution. As an optional embodiment of this invention, the viable count of *Chlorella vulgaris* TA-2a in the microbial inoculant can be ≥1×10⁻⁶. 7 CFU / mL, or 1×10 7 CFU / mL ~ 1×10 10 CFU / mL, or 5×10 7 CFU / mL, 1×10 8 CFU / mL, 5×10 8 CFU / mL, 1×10 9 CFU / mL or 5×10 9 CFU / mL, preferably 1×10⁻⁶ 7 CFU / mL or 1×10 9 CFU / mL.

[0025] This invention provides a method for preparing the microbial inoculant described in the above-mentioned technical solution, comprising: culturing *Chlorella vulgaris* TA-2a in a culture medium to obtain the microbial inoculant. This invention does not specifically limit the type of culture medium; any conventional culture medium in the art that allows *Chlorella vulgaris* TA-2a to grow normally can be used. As an optional embodiment of this invention, the culture medium can be MRS medium. As an optional embodiment of this invention, the culture temperature can be 25~30℃, specifically 25, 26, 27, 28, 29, or 30℃, preferably 28℃. As an optional embodiment of this invention, the culture time can be 2~7 days, specifically 2, 3, 4, 5, 6, or 7 days. As an optional embodiment of this invention, the initial pH value of the culture can be 4~6, specifically 4, 5, or 6, preferably 5. As an optional embodiment of this invention, the inoculum amount of *Chlorella vulgaris* TA-2a in the culture medium can be 1%~5%, specifically 1%, 2%, 3%, 4%, or 5%, preferably 2%. As an optional embodiment of the present invention, when *Chlorella vulgaris* TA-2a is cultured in MRS medium, the 0-12h period is the lag phase, the 12-48h period is the logarithmic growth phase, and the 48h period is the stationary phase. After the culture is completed, the present invention obtains *Chlorella vulgaris* TA-2a culture medium. After obtaining the *Chlorella vulgaris* TA-2a culture medium, the present invention can directly use the obtained *Chlorella vulgaris* TA-2a culture medium as a microbial inoculant, or it can separate the bacterial cells and supernatant from the *Chlorella vulgaris* TA-2a culture medium and use them as microbial inoculants respectively. The present invention does not have a specific limitation on the separation method, and any conventional separation method in the art can be used. As an optional embodiment of the present invention, the separation method can be centrifugation. As an optional embodiment of the present invention, after obtaining the bacterial cells, the present invention can directly use the obtained bacterial cells as a microbial inoculant, or it can break the bacterial cells to obtain the cell contents and use the obtained cell contents as a microbial inoculant. In the present invention, the method of breaking the bacterial cells can be ultrasonic disruption; the ultrasonic disruption time can be 20 minutes. As an optional embodiment of the present invention, a crude enzyme solution containing ethyl carbamate degrading enzyme can be obtained by rupturing bacterial cells.

[0026] This invention provides the application of *Chlorella vulgaris* TA-2a, as described in the above-mentioned technical solution, in the preparation of ethyl carbamate degrading enzyme. The *Chlorella vulgaris* TA-2a provided by this invention can efficiently secrete ethyl carbamate degrading enzyme and can be used in the preparation of ethyl carbamate degrading enzyme. The ethyl carbamate degrading enzyme secreted by *Chlorella vulgaris* TA-2a of this invention has high pH tolerance, wide temperature tolerance, and ethanol tolerance. The results of the embodiments of this invention show that the ethyl carbamate degrading enzyme can maintain high enzyme activity within a temperature range of 20-50℃, a pH range of 3-7, and / or under conditions where the ethanol volume fraction is ≤35%.

[0027] This invention provides the application of *Coccus tumefaciens* TA-2a, as described in the above technical solution, in the degradation of ethyl carbamate.

[0028] This invention provides the application of *C. tumefaciens* TA-2a described in the above-mentioned technical solution in improving wine quality. As an optional embodiment of this invention, improving wine quality includes improving wine flavor and / or reducing the content of ethyl carbamate in the wine. As an optional embodiment of this invention, improving wine flavor includes enhancing the aroma of the wine; improving wine flavor includes increasing the type and content of any one or more of esters, alcohols, aldehydes, ketones, and terpenes in the wine. As an optional embodiment of this invention, the wine includes fermented wine and distilled wine; the fermented wine includes rice wine and / or fruit wine; the rice wine includes yellow rice wine and / or unfermented rice wine; the fruit wine includes any one or more of grape wine, cherry wine, and apple wine; the distilled wine includes brandy and / or baijiu (Chinese white liquor); the brandy includes any one or more of grape brandy, cherry brandy, and apple brandy.

[0029] This invention provides a method for improving wine quality, comprising: adding *Coccus tumefaciens* TA-2a as described in the above-mentioned technical solution during the wine fermentation process. As an optional embodiment of this invention, the *Coccus tumefaciens* TA-2a can be added during the malolactic fermentation stage. This invention does not impose any particular limitation on the amount of *Coccus tumefaciens* TA-2a added; any amount conventionally used in the art can be employed. As an optional embodiment of this invention, the amount of *Coccus tumefaciens* TA-2a added can be ≥10... 7 CFU / mL, or 1×10 7 CFU / mL ~ 1×10 10 CFU / mL, or 5×10 7 CFU / mL, 1×10 8 CFU / mL, 5×10 8 CFU / mL, 1×10 9 CFU / mL or 5×10 9 CFU / mL, preferably 1×10⁻⁶ 7 CFU / mL or 1×10 9 CFU / mL.

[0030] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0031] Control strain: Commercial strain O. oeni Purchased from Lamothe Abiet, a French company.

[0032] The composition of the culture medium or reagents involved in the following technical solutions: MRS isolation medium (liquid): MRS liquid medium was supplemented with 50 mg / L actinomycete ketone and 50 mg / L vancomycin, and sterilized at 115℃ for 20 min.

[0033] MRS solid medium: Add 2% agar to MRS liquid medium and sterilize at 115℃ for 20 min.

[0034] NH 4+ Standard solution: 0.535 g ammonium chloride was dissolved in phosphate buffer and the solution was brought to a final volume of 100 mL to obtain 0.1 mol / L NH4+. 4+ The solution was used as the stock solution to prepare NH4+ with a concentration of 0.1 mmol / L to 0.5 mmol / L using phosphate buffer. 4+ Standard solution.

[0035] Colorimetric reagent I: 15g phenol, 0.625g sodium nitrosoferricyanide, diluted to 250mL with ultrapure water.

[0036] Colorimetric reagent II: 7.5 mL sodium hypochlorite and 13.125 g sodium hydroxide, diluted to 250 mL with ultrapure water.

[0037] Phosphate buffer (pH = 7.0): Take 0.68 g of potassium dihydrogen phosphate and 29.1 mL of 0.1 mol / L NaOH, and dilute with water to 100 mL.

[0038] Example 1 1. Isolation and purification of strains After alcoholic fermentation was completed, the wine samples were placed in MRS isolation medium (liquid) for enrichment culture at 25°C for 36 hours. The enriched bacterial culture was then divided into 10... -1 ~10 -7 Serial dilutions were performed, and the cultures were plated and incubated at 25°C for 36–48 h. Smooth, milky-white single colonies less than 1 mm in diameter were picked using an inoculation tool and inoculated into liquid culture medium. After incubation at 25°C for 36–48 h, 3–4 streak purification cycles were performed. The culture status during the isolation and purification process is shown in the following figures. Figure 1 As shown. Figure 1 In the diagram, A represents the results of gradient dilution culture; B represents the streak purification diagram of the TA-2a strain.

[0039] After isolation and purification, smooth, milky-white single colonies of TA-2a strain with a diameter of less than 1 mm were obtained.

[0040] 2. Morphological identification of TA-2a strain The strain obtained in step 1 was cultured in MRS solid medium. The TA-2a colonies were observed to be smooth, milky white, and less than 1 mm in diameter. After Gram staining, the strain was examined under a microscope. The Gram staining results of the TA-2a strain are shown below. Figure 2 As shown. Gram staining results indicate that TA-2a strain is a Gram-positive strain.

[0041] 3. Determination of the degradative enzyme activity of the TA-2a strain obtained in step 1 3.1 NH4 + Plotting the standard curve Take 1 mL of NH4 at different concentration gradients + The standard solution, 1 mL of 3% urethane solution, was incubated at 37℃ for 30 min, and 1 mL of stop agent was added and mixed. Then, 1 mL of colorimetric reagent I and 1 mL of colorimetric reagent II were added sequentially, and the mixture was allowed to react for 20 min. The volume was then adjusted to 10 mL with ultrapure water, and the absorbance was measured at 625 nm using a spectrophotometer. A linear regression equation was fitted with ammonia ion concentration on the x-axis and the corresponding absorbance OD value on the y-axis to obtain the standard curve equation.

[0042] NH4 + Standard curve such as Figure 3 As shown. The plotted curve y = 0.8853x + 0.0087 has R... 2 =0.9996, which basically meets the requirements. This value will be used as a reference for subsequent enzyme activity assays.

[0043] 3.2 Determination of EC-degrading enzyme activity in TA-2a strain The specific procedure for enzyme activity determination is as follows: The bacterial strain was inoculated into MRS liquid medium and cultured for 48 hours. The bacterial solution was then placed in a refrigerated centrifuge at 4°C and centrifuged at 6000 rpm. -1 Centrifuge at 15 min. Wash the bacterial cells twice with phosphate buffer, centrifuge and discard the supernatant. Dilute the bacterial cells with the buffer, adjusting the volume to 1 / 5 of the original volume before centrifugation. Sonicate the cells at 4℃ for 20 min to obtain crude enzyme. Mix the appropriately diluted enzyme solution with 3% EC at a 1:1 ratio, react at 37℃ for 30 min, add 1 mL of stop agent and mix well. Add 1 mL of chromogenic reagent I and 1 mL of chromogenic reagent II, mix and incubate for 20 min. Dilute with ultrapure water to 10 mL, and measure the absorbance at 625 nm to calculate enzyme activity. The results show that strain TA-2a can produce EC-degrading enzyme and exhibits detectable enzyme activity under the experimental conditions.

[0044] 3.3 Identification of TA-2a strain Molecular biological identification (1) Extraction of strain DNA DNA was extracted according to the operating instructions of the bacterial genomic DNA extraction kit.

[0045] (3) PCR amplification and gene sequence analysis of 16S rRNA The extracted DNA was used as a template for 16S rRNA sequence amplification. Primer sequences synthesized by Shanghai Sangon Biotech Co., Ltd. were: On1 (41–60 bp): GCGGCGTGCCTAATACATGC (SEQ ID NO.1) and On2 (686–705 bp): ATCTACGCATTTCACCGCTA (SEQ ID NO.2). The PCR reaction system consisted of 2.0 μL genomic DNA as template, 25 μL 2×EsTaq MasterMIX (Dye), 2.0 μL each of forward and reverse primers, and 19 μL of sterile ddH2O added. PCR amplification conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; and 72℃ final extension for 2 min. 6 μL of the PCR product was detected by 1% agarose gel electrophoresis at 100V for 60 min.

[0046] The PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Blast analysis of the sequences was performed using the known 16S rRNA sequence of *C. truncatum* from the GenBank database. The results showed that strain TA-2a shared over 99% homology with *C. truncatum* in the GenBank database. A phylogenetic tree was constructed using MEGA 11.0 software (see details). Figure 13 Based on comprehensive analysis, strain TA-2a was identified as *Chlorella vulgaris*, with the Latin scientific name... Oenococcus oeni This strain was deposited on December 17, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 36758.

[0047] The PCR detection results of 16S rRNA of strain TA-2a are shown in SEQ ID NO.3, specifically: .

[0048] Example 2 Optimization of enzyme production conditions for TA-2a strain 1. Effect of inoculum size on enzyme production activity of TA-2a strain The TA-2a strain was inoculated into MRS liquid medium at inoculum concentrations of 1%, 2%, 3%, 4%, and 5% (v / v), respectively, and incubated statically at 28°C for 3–5 days. Strains with absorbance between approximately 1.9 and 2.1 (indicating approximately 10⁻⁶ viable cells) were selected. 9 The fermentation enzyme production was determined using the same method as described above in "Determination of EC Degradative Enzyme Activity in Strains". Results are as follows: Figure 4 As shown.

[0049] Depend on Figure 4It can be seen that the enzyme production capacity of TA-2a varies with different inoculum amounts. As the inoculum amount increases, the enzyme production activity of the strain first increases and then decreases, with the highest enzyme production capacity at an inoculum amount of 2%.

[0050] 2. Effect of initial pH on enzyme production capacity of strain TA-2a The pH of the MRS liquid medium was adjusted to 3.0, 4.0, 5.0, 6.0, and 7.0. The TA-2a strain was inoculated into the MRS liquid medium at a 2% inoculum size and incubated statically at 28°C for 3–7 days. Strains with absorbance between approximately 1.9 and 2.1 were selected to determine fermentation enzyme production using the same method as described in “Determination of EC Degradative Enzyme Activity of Strains”. The results are as follows: Figure 5 As shown.

[0051] Depend on Figure 5 It can be seen that different pH values ​​have a significant impact on the enzyme production capacity of the strain. As the pH value increases, there is a trend of first increasing and then decreasing. When the initial pH is 5, the enzyme production activity of the strain is the highest.

[0052] 3. TA-2a strain and commercial strain O. oeni Determination of the EC-degrading enzyme production capacity of 1 Control strain: Commercial strain O. oeni Purchased from Lamothe Abiet, a French company.

[0053] Comparing TA-2a strain with commercial strains O. oeni 1. Inoculate the bacterial suspension at 2% (v / v) into MRS liquid medium with an initial pH of 5.0 and incubate statically at 28°C for 3-5 days. Select bacterial suspensions with absorbance between approximately 1.9 and 2.1 (indicating approximately 10^6 bacterial viability). 9 The fermentation enzyme production was determined using the same method as described above in "Determination of EC Degradative Enzyme Activity in Strains". Results are as follows: Figure 6 As shown.

[0054] Depend on Figure 6 It was found that the enzyme production activity of strain TA-2a was significantly higher than that of the commercial control strain. O. oeni 1.

[0055] 4. Growth curve determination of TA-2a strain The bacterial culture of TA-2a strain was inoculated into MRS liquid medium, and an equal volume of medium without bacterial culture was used as a blank control. The cultures were incubated at 28°C for 72 hours. The absorbance of the culture medium at 600 nm was monitored every 4 hours, and a growth curve was plotted. The results are as follows: Figure 7 As shown.

[0056] Depend on Figure 7It can be seen that the TA-2a strain conforms to the S-shaped growth curve, with 0h~12h being the lag phase, 12h~48h being the logarithmic growth phase, and entering the stationary phase after 48h.

[0057] Example 3 Factors affecting the activity of EC degrading enzymes produced by TA-2a strain The bacterial suspension of TA-2a strain was inoculated at 2% (v / v) into MRS liquid medium with an initial pH of 5.0 and cultured for 48 h. The bacterial suspension was then placed in a refrigerated centrifuge at 4 °C and centrifuged at 6000 r·min. -1 Centrifuge at 15 min. Wash the bacterial cells twice with phosphate buffer, centrifuge and discard the supernatant. Dilute the bacterial cells with the buffer and adjust the volume to 1 / 5 of the original volume before centrifugation. Sonicate the cells at 4°C for 20 min to obtain crude enzyme solution.

[0058] 1. Effect of temperature on the activity of EC-degrading enzymes produced by strain TA-2a The crude enzyme solution was mixed with 3% EC for enzymatic reaction, and the mixture was incubated in a water bath at temperatures of 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, and 50℃ for 30 min at each temperature. After completion, the EC-degrading enzyme activity was measured, and the results are as follows: Figure 8 As shown.

[0059] Figure 8 As can be seen, the EC enzyme activity first increases and then decreases with increasing temperature, and the EC degrading enzyme activity is highest at 35℃.

[0060] 2. Effect of pH on the activity of EC-degrading enzymes produced by strain TA-2a At the optimal temperature (35℃), the pH of the substrate buffer was adjusted to 3, 4, 5, 6, 7, 8, and 9, respectively. The crude enzyme solution was then mixed with 3% EC at different pH values, and the enzymatic reaction was carried out at 35℃ for 30 min. Enzyme activity was then measured. The results are as follows: Figure 9 As shown.

[0061] Figure 9 It can be seen that as pH increases, the activity of EC degrading enzyme first increases and then decreases. The activity of EC degrading enzyme is the highest at pH 5, and it decreases significantly at pH 8. At pH 9, the activity is still 0.71 U / mL.

[0062] 3. Ethanol tolerance of EC-degrading enzymes produced by strain TA-2a The crude enzyme solution was mixed with a 3% ethyl carbamate solution to achieve ethanol volume fractions of 5%, 10%, 15%, 20%, 25%, 30%, and 35% (the ethyl carbamate solutions with different ethanol contents served as substrate buffers). A 3% ethyl carbamate solution without added ethanol was also included as a control.

[0063] At the optimal temperature (35℃) and optimal pH (5.0), the crude enzyme solution and the above substrate buffer were mixed separately and subjected to enzymatic reaction for 30 min. The relative enzyme activity of EC degrading enzyme at different concentrations was then measured.

[0064] The activity of EC degrading enzyme in ethanol-free solution is 100%.

[0065] Enzyme activity calculation formula: Enzyme activity = (ΔOD) 625 -0.0087)×n×k×10 / 30; Where: ΔOD 625 The difference in optical density between the sample and the blank after the enzyme reaction; n: the dilution factor for enzyme activity assay; k: the reciprocal of the slope of the standard curve; 30: the reaction time (min) between the enzyme and the substrate; 10: the factor by which 1 mL of sample solution is diluted to 10 mL.

[0066] The results are as follows Figure 10 As shown.

[0067] Tolerance to ethanol severely affects the application of EC degradative enzymes. Figure 10 It can be seen that the activity of EC degrading enzyme gradually decreases with increasing ethanol concentration. When the ethanol concentration reaches 20%, the relative activity of EC degrading enzyme reaches 60.84%, and at 35%, the activity of EC degrading enzyme is still 43.5%. This indicates that the enzyme has good tolerance to ethanol.

[0068] Example 4 Evaluation of the sensory effects of TA-2a strain treatment on wine The TA-2a strain was inoculated at 2% (v / v) into MRS liquid medium with an initial pH of 5.0 and cultured to the logarithmic growth phase. The bacterial cells were collected by centrifugation, washed with 0.9% NaCl, and resuspended to obtain the TA-2a strain seed culture. The TA-2a strain seed culture was then subjected to a 1×10⁻⁶... 7 An inoculum of CFU / mL was added to the Cabernet Sauvignon dry red wine after alcoholic fermentation and placed at 20°C for malolactic fermentation. The fermentation process was monitored until the malic acid was completely broken down, indicating that fermentation was complete.

[0069] 1. Quantitative sensory description analysis (QDA) was performed on the wine obtained after the fermentation of the experimental group.

[0070] During the tasting process, 15 professionally trained personnel were asked to evaluate the color, clarity, aroma, taste, and typicality of different wines using a 5-point scale, where 1 = very poor, 2 = poor, 3 = average, 4 = good, and 5 = excellent.

[0071] The results are as follows Figure 11 As shown. Figure 11 The original wine in the text refers to Cabernet Sauvignon dry red wine that has completed alcoholic fermentation and has not been treated with the TA-2a strain; TA-2a refers to wine that has been fermented with the TA-2a strain.

[0072] Depend on Figure 11 Sensory analysis of the wine fermented with TA-2a yielded the scores shown in the radar chart. The wine's color, aroma, taste, and typicality scores all significantly improved. This is primarily because after TA-2a inoculation and fermentation, malic acid in the wine was converted to lactic acid, resulting in a significant decrease in total acid content and a smoother taste. The types and contents of acids, esters, alcohols, aldehydes, ketones, and terpenes all increased significantly. These substances contribute to a pleasant aroma and enhance its richness and typicality. *C. taurum* TA-2a is a suitable strain for malolactic fermentation and has no adverse effects on the flavor and taste of the wine.

[0073] Example 5 Application of EC-degrading enzymes obtained from TA-2a strain in alcoholic beverages The bacterial suspension of TA-2a strain was inoculated at 2% (v / v) into MRS liquid medium with an initial pH of 5.0 and cultured for 48 h. The bacterial suspension was then placed in a refrigerated centrifuge at 4 °C and centrifuged at 6000 r·min. -1 Centrifuge at 15 min. Wash the bacterial cells twice with phosphate buffer, centrifuge and discard the supernatant. Dilute the bacterial cells with the same buffer, adjusting the volume to 1 / 5 of the original volume before centrifugation. Sonicate the cells at 4°C for 20 min to obtain crude enzyme solution. Measure enzyme activity for later use.

[0074] 10 mL each of baijiu (40.8% vol), wine (12.5% ​​vol), grape brandy (45% vol), and huangjiu (10.5% vol) were placed in test tubes, and crude enzyme solution (0.2 U / mL) was added to each. The tubes were incubated at 35°C for 15 min. The EC content before and after treatment was measured. The results are shown in Table 1.

[0075] Table 1. The degradation effect of EC-degrading enzymes obtained from strain TA-2a on EC in finished wine.

[0076] Table 1 shows that the EC degrading enzymes obtained from strain TA-2a exhibited degradation capabilities at different alcohol contents, with the degradation rate decreasing as the alcohol content increased. The highest degradation rate was observed in Shaoxing wine (31.30%), followed by wine (26.59%), baijiu (15.15%), and grape brandy (13.01%).

[0077] Example 6 Validation of the effect of using TA-2a strain in winemaking The TA-2a strain was inoculated at 2% (v / v) into MRS liquid medium with an initial pH of 5.0 and cultured to the logarithmic growth phase. The bacterial cells were collected by centrifugation, washed with 0.9% NaCl, and resuspended to obtain the TA-2a strain seed culture. The TA-2a strain seed culture was then subjected to a 1×10⁻⁶... 7 An inoculum of CFU / mL was added to Cabernet Sauvignon dry red wine after alcoholic fermentation, and the mixture was placed at 20°C for malolactic fermentation. The fermentation process was monitored using paper chromatography. This group served as the experimental group.

[0078] Will O. oeni One strain was inoculated at 2% (v / v) into MRS liquid medium with an initial pH of 5.0 and cultured to the logarithmic phase. The bacterial cells were collected by centrifugation, washed with 0.9% NaCl, and resuspended to obtain… O. oeni Seed culture of strain 1. O. oeni Seed culture of strain 1 at 1×10 7 An inoculum of CFU / mL was added to Cabernet Sauvignon dry red wine after alcoholic fermentation, and the wine was placed at 20°C for malolactic fermentation. The fermentation process was monitored using paper chromatography. A control group was also included.

[0079] The fermentation process is monitored until the malic acid is completely decomposed, at which point the fermentation is complete.

[0080] Meanwhile, Cabernet Sauvignon dry red wine that had completed alcoholic fermentation (without fermentation by *C. tauren*) was used as the base wine as a blank control group.

[0081] 1. After fermentation, the basic physicochemical properties of the Cabernet Sauvignon wine are shown in Table 2. The alcohol content, reducing sugar, total acid, volatile acid content, and total SO2 content of the wine were determined according to the national standard GB / T 15038-2006 "General Analytical Methods for Wines and Fruit Wines". The pH value of the wine was measured using a pH meter.

[0082] Table 2 Basic Physicochemical Indicators of Cabernet Sauvignon Wines

[0083] Different letters in the table indicate significant differences, and the same applies below.

[0084] Table 2 shows that after MLF treatment, the total acidity and pH value of the wine significantly decreased and increased, respectively, indicating that TA-2a can effectively convert malic acid into lactic acid, meeting the selection criteria for MLF strains. Other basic physicochemical indicators showed no significant differences, meeting the limits required by GB / T 15038-2006.

[0085] 2. After fermentation, the ethyl carbamate content in Cabernet Sauvignon wines in the experimental and control groups was measured, and the results are as follows: Figure 12 As shown.

[0086] Depend on Figure 12 It can be seen that the EC content of the wine obtained by TA-2a was significantly lower than that of the commercial control strain. O. oeni 1.

[0087] 3. After fermentation, the aroma components of Cabernet Sauvignon wines in the experimental and control groups were analyzed and determined. The results are shown in Table 3. Aroma component analysis: Aroma components were analyzed using SPME-GC-MS, and the instrument used was a GC / MS-TQ8030 gas chromatograph-mass spectrometer.

[0088] Table 3 Effects of TA-2a on aroma compounds in wine (unit: μg / L)

[0089] Note: Different letters in the figure represent significant differences (P < 0.05); the blank control group is the blank control group that has not been fermented by Chlorella vulgaris.

[0090] Table 3 shows that the total amount of major aroma compounds in wine significantly increased after adding TA-2a for MLF. Except for acids, which remained unchanged, the types and contents of esters, alcohols, aldehydes, ketones, and terpenes all increased significantly. This was especially true for acids with cheese and fatty acid properties; 2,3-butanediol with buttery and creamy notes; phenylethyl alcohol with fruity, sweet, and rose-like floral aromas; n-hexanol with a raw, green aroma; ethyl lactate with fruity and sweet aromas; isoamyl lactate with creamy and nutty aromas; and acetates and ethyl hexanoate with fruity and floral aromas.

[0091] Blank control group, TA-2a experimental group and O. oeni The control group showed significant differences in acids, alcohols, esters, and aldehydes / ketones / terpenes. Esters were the main components of aroma compounds and contributed the most to the overall flavor. The TA-2a group had the highest total aroma compound content, significantly higher than the control group. O. oeni The TA-2a group showed significantly better performance than the control group and the blank control group in terms of the content of four major categories of substances: acids, alcohols, esters, and aldehydes / ketones / terpenes. O. oeni Compared to the blank control group, Group 1 also showed superior performance in terms of the variety of aroma compounds. It had the highest number of esters, aldehydes, ketones, and terpenes among the three groups, especially esters and alcohols, which play a key role in fruity, sweet, and floral aromas. This indicates that TA-2a treatment not only significantly enhances the synthesis and accumulation of overall aroma compounds but also enriches their composition, compared to the blank control group. O. oeni The control group showed superior aroma production and flavor enhancement.

[0092] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of *Chlorella vulgaris* ( Oenococcus oeni TA-2a, characterized in that, The preservation number of the *C. tartrazine* TA-2a is: CGMCC No. 36758.

2. A microbial inoculant, characterized in that, Includes the *Chlorella vulgaris* TA-2a as described in claim 1.

3. A method for preparing the microbial inoculant according to claim 2, characterized in that, include: The *Chlorella vulgaris* TA-2a was cultured in a culture medium to obtain a microbial inoculum.

4. The preparation method according to claim 3, characterized in that, The culture temperature is 25~30℃; the culture time is 2~7 days; and the initial pH value of the culture is 4~6.

5. The use of the *Chlorella vulgaris* TA-2a as described in claim 1 in the preparation of ethyl carbamate degrading enzyme.

6. The application of the *C. tauren* TA-2a as described in claim 1 in the degradation of ethyl carbamate.

7. The application of the *Acetobacter TA-2a* as described in claim 1 in improving wine quality.

8. The application according to claim 7, characterized in that, The improvement of wine quality includes improving the wine flavor and / or reducing the content of ethyl carbamate in the wine.

9. The application according to claim 8, characterized in that, The alcoholic beverages include fermented beverages and distilled beverages; the fermented beverages include rice wine and / or fruit wine; the distilled beverages include brandy and / or baijiu (Chinese white liquor).

10. A method for improving the quality of wine, characterized in that, include: During the fermentation process of the wine, the *Coccus tumefaciens* TA-2a described in claim 1 is added.

Images