A mannuronic acid c-5 epimerase, mutants thereof and use in the preparation of products to promote wound healing
By using the mannouronic acid C-5 epimerase AlgEAv7 and its mutant to catalyze alginate, the glucose content was increased, which solved the problem of low catalytic efficiency in the existing technology. The high-glucose alginate-based hydrogel dressing prepared showed excellent effects in wound healing, expanding its application.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- OCEAN UNIV OF CHINA
- Filing Date
- 2026-05-14
- Publication Date
- 2026-06-19
AI Technical Summary
Existing mannouronic acid C-5 epimerases have low catalytic efficiency, insufficient substrate adaptability, and unsatisfactory expression levels and stability, making it difficult to prepare high-G content alginate. This results in unstable performance of the alginate in wound dressings, affecting wound healing.
We provide mannuronic acid C-5 epimerase AlgEAv7 and its mutants. Through gene recombination and enzymatic catalysis, we convert M in alginate into G, increasing the G content to 66.4% and 73.5%, respectively, to prepare a high-G alginate-based hydrogel dressing for promoting wound healing.
The efficient catalysis of the conversion of M to G significantly increased the G content of alginate, and the high-G alginate-based hydrogel dressing prepared showed excellent effects in wound healing, expanding its application in the fields of food, biomedicine and biomaterials.
Smart Images

Figure CN122235124A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a mannulate C-5 epimerase, its mutants, and its application in the preparation of products that promote wound healing. Background Technology
[0002] With an aging population, an increase in chronic diseases such as diabetes, and a rise in the number of surgeries and traumas, the demand for wound care products in clinical and home care is growing. Traditional dry dressings such as cotton gauze and medical tape have certain shortcomings in absorbing exudate, maintaining a moist wound environment, and reducing pain during dressing changes, easily leading to wound scab cracking, dressing adhesion, and secondary damage. Therefore, hydrogel dressings that can maintain a slightly moist wound environment, have good adhesion, and are biocompatible are gradually becoming a research hotspot in the field of wound repair.
[0003] Alginate (SA) is a widely available natural anionic polysaccharide, mainly composed of β-D-mannuronic acid (M) and α-L-guluronic acid (G) arranged in different sequences to form M-segments, G-segments, or alternating MG-M-segments. Due to its excellent biocompatibility, biodegradability, and compatibility with substances such as Ca... 2+ Alginate, capable of rapidly forming gel networks in the presence of divalent metal ions, is widely used in food, drug controlled-release carriers, and tissue engineering scaffolds. Especially in wound dressings, alginate-based hydrogels can form a soft, conforming, and moist barrier on the wound surface, helping to reduce infection and inflammation and promote tissue regeneration. However, the performance of alginate is closely related to its molar ratio (M / G). It is generally believed that high-G content alginate is more likely to form a regular, dense three-dimensional gel network, exhibiting higher gel strength, more stable structure, and superior mechanical and gelling properties compared to low-G content alginate, making it more suitable as a wound hydrogel matrix with certain mechanical support and shape retention capabilities. The M / G ratio of natural alginate is mainly affected by the algal species, origin, and extraction process, resulting in significant differences between different batches. High-G content alginate resources are relatively limited, and their quality is difficult to control consistently, making it difficult to meet the requirements for raw material performance stability in functional hydrogel dressings.
[0004] In existing technologies, studies have attempted to regulate the mechanical properties of alginate through chemical modification, physical blending, or crosslinking to improve its structure and performance. However, chemical modification often requires harsh or complex reaction conditions and can easily introduce residual organic solvents or potentially toxic groups, which may affect the biosafety of the material. While physical blending and simple crosslinking are relatively easy to operate, their ability to regulate the M / G ratio and fine chain structure is limited, making it difficult to precisely adjust the gel properties and biological functions of alginate at the molecular level.
[0005] In contrast, enzyme-based strategies for regulating the structure of alginate have gained increasing attention. Mannuronic acid C-5 epimerases can epimerize the methyl group (M) in alginate chains to glycogen (G) under mild aqueous conditions, thereby increasing the G residue content in alginate without damaging the polysaccharide backbone. This represents a promising biocatalytic pathway for obtaining high-G alginate. Previous studies have shown that mannuronic acid C-5 epimerases obtained from certain brown algae-related microorganisms can modify alginate in vitro. However, existing enzymes often suffer from limited catalytic efficiency, insufficient substrate adaptability, unsatisfactory expression levels and stability, and high preparation costs, presenting bottlenecks in the preparation and application of high-G alginate. The current technology needs to develop mannuronic acid C-5 epimerases with a clearly defined source, high catalytic efficiency, and stable expression to establish a biological pathway for converting alginate into high-G alginate, thereby constructing high-G alginate polysaccharide-based hydrogel dressings with excellent gelling properties and wound-healing functions. Summary of the Invention
[0006] The purpose of this invention is to provide a mannulate C-5 epimerase, its mutants, and applications in preparing wound-healing products, thereby addressing the problems existing in the prior art. The mannulate C-5 epimerase AlgEAv7 and its mutants of this invention have highly efficient catalytic conversion of methanogens (M) to glucose (G), capable of increasing the glucose content in alginate to 66.4% and 73.5%, respectively. High-G alginate-based hydrogel dressings prepared using the mannulate C-5 epimerase AlgEAv7 and its mutants of this invention can effectively promote wound healing, greatly expanding the applications of high-G alginate and its hydrogels in food, biomedicine, and biomaterials.
[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a mannouronic acid C-5 epimerase AlgEAv7, the amino acid sequence of which is shown in SEQ ID NO.4.
[0008] The present invention also provides a mannuronic acid C-5 epimerase AlgEAv7 mutant, the amino acid sequence of which is shown in SEQ ID NO.8.
[0009] The present invention also provides a recombinant vector expressing mannuronic acid C-5 epimerase, wherein the recombinant vector contains a gene encoding the aforementioned mannuronic acid C-5 epimerase AlgEAv7 or a gene encoding a mutant of the aforementioned mannuronic acid C-5 epimerase AlgEAv7.
[0010] The present invention also provides a recombinant microorganism expressing mannuronic acid C-5 epimerase, wherein the recombinant microorganism contains the above-mentioned recombinant vector.
[0011] The present invention also provides the application of the above-mentioned mannuronic acid C-5 epimerase AlgEAv7 or the above-mentioned mannuronic acid C-5 epimerase AlgEAv7 mutant in increasing the α-L-guluronic acid content in alginate.
[0012] This invention also provides a method for preparing alginate with high α-L-guluronic acid content, comprising the steps of using alginate as a substrate and catalyzing the conversion of β-D-mannuronic acid in the substrate to α-L-guluronic acid using the aforementioned mannuronic acid C-5 epimerase AlgEAv7 or the aforementioned mannuronic acid C-5 epimerase AlgEAv7 mutant, thereby obtaining alginate with high α-L-guluronic acid content.
[0013] Optionally, the catalytic temperature is 37°C, the pH value is 6-8, and the time is 10-16 h.
[0014] The present invention also provides a brown alginate with high α-L-guluronic acid content prepared by the above preparation method.
[0015] The present invention also provides the application of the above-mentioned alginate with high α-L-guluronic acid content in the preparation of products that promote wound healing.
[0016] The present invention also provides a product for promoting wound healing, the product comprising the above-mentioned alginate with high α-L-guluronic acid content.
[0017] The present invention discloses the following technical effects: This invention originates from brown nitrogen-fixing bacteria Azotobacter vinelandii The gene for a mannouronic acid C-5 epimerase, AlgEAv7, was obtained and expressed via recombination to yield AlgEAv7. This enzyme was verified to have highly efficient catalytic activity in converting methyl (M) to glucose (G), significantly increasing the glucose content in alginate (31.3% → 66.4%). Furthermore, a mutant of AlgEAv7 was prepared by mutating the enzyme Q225A. This mutant enzyme also exhibited highly efficient catalytic activity in converting M to G, with higher efficiency than the original enzyme, increasing the glucose content in alginate to 73.5%. High-G alginate-based hydrogel dressings prepared using AlgEAv7 and its mutants effectively promote wound healing, showing superior healing effects compared to low-G alginate-based hydrogels, greatly expanding the applications of high-G alginate and its hydrogels in food, biomedicine, and biomaterials. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 Electrophoresis diagram of the amplified nucleic acid of the mannouronic acid C-5 epimerase AlgEAv7; Figure 2 Electrophoresis diagram of the protein expression product of mannouronic acid C-5 epimerase AlgEAv7; Figure 3 The HPLC chromatogram shows the content of M and G in the substrate alginate. Figure 4 The HPLC chromatogram shows the M and G content in alginate catalyzed by mannouronic acid C-5 epimerase AlgEAv7. Figure 5 The HPLC chromatogram shows the M and G content in alginate catalyzed by the mannouronic acid C-5 epimerase AlgEAv7 mutant. Figure 6 SEM images of 31.3% G alginate polysaccharide hydrogel and 73.5% G alginate polysaccharide hydrogel; Figure 7 Schematic diagram of FTIR analysis of 31.3% G alginate polysaccharide-based hydrogel and 73.5% G alginate polysaccharide-based hydrogel (blue: SA-HA hydrogel, red: SA-hydrogel, black: SA-raw material); Figure 8 The images show the wound healing effects of 31.3% G alginate polysaccharide hydrogel (A) and the statistical results of wound area (B). Detailed Implementation
[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.
[0026] Example 1: Preparation of recombinant mannuronic acid C-5 epimerase AlgEAv7 1. Gene Acquisition Based on nitrogen-fixing bacteria ( Azotobacter sp. The whole genome analysis of Av1 (deposited at the China General Microbiological Culture Collection Center, September 25, 2023, accession number CGMCC No. 28548, address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing) revealed the presence of the mannouronic acid C-5 epimerase AlgEAv7 gene through functional gene annotation and NCBI gene sequence alignment.
[0027] Using the bacterial genome as a template, the mannouronic acid C-5 epimerase AlgEAv7 gene was prepared by PCR amplification. The first primer sequence used for PCR was ATGGAATACAACGTTAAGGATTTTGG (SEQ ID NO.1), and the second primer sequence was TCAGGCAGCCTGCGAGCT (SEQ ID NO.2). The DNA amplification enzyme used in the reaction was Phanta® Super-Fidelity DNA Polymerase. The specific reaction system was as follows: Buffer 10 μL; dNTP 1 μL; Phanta® 1 μL; first primer 2 μL; second primer 2 μL; genomic template 1 μL; ddH2O to a final volume of 50 μL. The annealing temperature was set at 55℃, and the extension time was 72℃ for 2 min. The PCR products were examined by agarose gel electrophoresis, and the results are shown below. Figure 1 As shown, the PCR product with the expected molecular weight was obtained. The tested PCR product was then purified using the Cycle PureKit PCR purification kit, following the instructions in the Cycle PureKit PCR purification kit manual. The purified DNA fragment was the PCR amplification product of the mannouronic acid C-5 epimerase AlgEAv7.
[0028] The PCR amplification product sequence is as follows:
[0029] 2. Construction of recombinant expression vectors The Pichia pastoris X33 expression vector pPICZαA was linearized by double digestion with Not I and EcoRI. The PCR product from the previous step was then ligated with the linearized expression vector for in vitro homologous recombination. The ligation was performed in Escherichia coli DH5α by heat shock and cultured at 37°C for 12-16 h. Single colonies were selected and positive clones were verified to obtain the mannuronic acid C-5 epimerase AlgEAv7 recombinant expression vector.
[0030] 3. Induced expression and purification The constructed recombinant expression vector was linearized by Sac I enzyme digestion. The linearized recombinant expression vector was then transformed into Pichia pastoris X33 competent cells by electroporation. The specific transformation method was as follows: the linearized recombinant expression vector was transformed into competent cells, incubated on ice for 30 min, and then electroporated using an electroporator. 1 mL of pre-cooled 1 M sorbitol solution was added, and the cells were incubated at 30°C for 1 h. The cells were then plated onto LB agar plates containing Zeocin antibiotic and cultured at 30°C for 2-3 days.
[0031] The grown yeast transformants were screened for positive transformants and inoculated into BMGY liquid medium for shake-flask fermentation at 30 ℃ and 200 rpm. Induction was performed by adding 1% methanol every 24 h, for a total of 3 additions. After expression was complete, the cells were centrifuged, and the supernatant was collected, which was the prepared mannuronic acid C-5 epimerase AlgEAv7. The fermentation expression of mannuronic acid C-5 epimerase AlgEAv7 was detected by SDS-PAGE, and the results are as follows: Figure 2 As shown, the fermentation broth contains bands with a molecular weight (99.9 kDa) similar to that of the mannuronic acid C-5 epimerase AlgEAv7, indicating that the mannuronic acid C-5 epimerase AlgEAv7 was successfully expressed in Pichia pastoris X33.
[0032] The amino acid sequence of the obtained mannouronic acid C-5 epimerase AlgEAv7 is as follows: MEYNVKDFGAKGDGKTDDTDAIQAAIDAAYKAGGGTVYLPSGEYRVSGGDEASDGALIIKSNVYIVGAGMGETVIKLVDGWDEKLTGIIRSANGEKTHDYGISDLTIDGNQDNTEGEVDGFYTGYIPGKDGADYNVTVERVEIREVSRYAFDPHEQTINLTIRDSVAHDNGKDGFVADFQIGAVFENNVSYNNGRHGFNIVTSSHDIVFTNNVAYGNGANGLVVQRGSEDRDFVYNVEIEGGSFYDNGQEGVLIKMSTDVSLQGAEIYGNGYAGVRVQGVEDVQILDNYIHDNAQSKANAEVIVESYDDRDGPSDDYYETQNVTVKGNTIVGSANSTYGIQERADGTDYTSIGNNSVSGTQRGIVQLSGTNSTFSGRSGDAYQFIDGSTGNDLLTGTPIADLIVGGSGNDTLSGDAGNDVLEGGAGSDRLTGGEGADIFRFTAVSDSYYTASSSVADQILDFDASEDRIDLTGLGFTGLGDGYGGTLAVLTNSDGSRTYLRSYEKDADGRYFSLTLDGNFVGRLDDSNLVFRHKTIAGTEGDDSLTGNAMAEILDGGGGNDSLSGGLGNDVLRGGAGDDILNGGLGRDQLSGGEGADIFRFTSVADSYQNSGDNFSDLILDFDPGEDRIDLSGLGFSGLGDGHNGTLLLWTSSETNRTYLKNFDTDADGRRFEIALEGVFSDLGEKQLVFERLVLEGTRLGDQLSGTELNEELLGGAGRDILNGGAGDDILDGGSERDTLTGGSGADVFRFNATLDSFRNYDSGTSRVDDITDFTVGEDLIDLSALGYSGLGDGYDGTLAVLLNADGTKTYLKDRESDADGNHFEIALDGNYADQLSNGDFVFTNLEVIGSSSQAA, SEQ ID NO.4。
[0033] Construction and Expression of Mannuronic Acid C-5 Epimerase AlgEAv7 Mutant, Example 2 The 225th amino acid Gln of the mannuronic acid C-5 epimerase AlgEAv7 obtained in Example 1 was mutated to Ala to construct the mannuronic acid C-5 epimerase AlgEAv7 mutant. Using the AlgEAv7 recombinant expression vector as a template, the mutant gene sequence was amplified using mutation primers (F: TGCGCGCGGCTCGGAAGACCGGGACTTCGTC, SEQ ID NO.5; R: TTCCGAGCCGCGcgcGACCACCAGGCCGTTGGC, SEQ ID NO.6). The PCR amplification products were detected by agarose gel electrophoresis. The PCR products with the correct molecular weight were then digested with DpnI and purified using the Cycle Pure Kit PCR purification kit. Specific procedures were performed according to the instructions for use of the DpnI enzyme and the Cycle Pure Kit PCR purification kit. The purified DNA fragment was the mutant gene. The expression vector of the mutant was constructed according to the method in Example 1 and transformed into Escherichia coli DH5α cells by heat shock. After being cultured at 37°C for 12-16 h, single colony selection was performed, and positive clones were sequenced. The clones with correct sequencing were operated according to the steps in Example 1 to successfully express the mutant in Pichia pastoris X33, and the mannouronic acid C-5 epimerase AlgEAv7 mutant was obtained.
[0034] The gene sequence of the mannouronic acid C-5 epimerase AlgEAv7 mutant is as follows:
[0035] The amino acid sequence of the mannuronic acid C-5 epimerase AlgEAv7 mutant is as follows: MEYNVKDFGAKGDGKTDDTDAIQAAIDAAYKAGGGTVYLPSGEYRVSGGDEASDGALIIKSNVYIVGAGMGETVIKLVDGWDEKLTGIIRSANGEKTHDYGISDLTIDGNQDNTEGEVDGFYTGYIPGKDGADYNVTVERVEIREVSRYAFDPHEQTINLTIRDSVAHDNGKDGFVADFQIGAVFENNVSYNNGRHGFNIVTSSHDIVFTNNVAYGNGANGLVVARGSEDRDFVYNVEIEGGSFYDNGQEGVLIKMSTDVSLQGAEIYGNGYAGVRVQGVEDVQILDNYIHDNAQSKANAEVIVESYDDRDGPSDDYYETQNVTVKGNTIVGSANSTYGIQERADGTDYTSIGNNSVSGTQRGIVQLSGTNSTFSGRSGDAYQFIDGSTGNDLLTGTPIADLIVGGSGNDTLSGDAGNDVLEGGAGSDRLTGGEGADIFRFTAVSDSYYTASSSVADQILDFDASEDRIDLTGLGFTGLGDGYGGTLAVLTNSDGSRTYLRSYEKDADGRYFSLTLDGNFVGRLDDSNLVFRHKTIAGTEGDDSLTGNAMAEILDGGGGNDSLSGGLGNDVLRGGAGDDILNGGLGRDQLSGGEGADIFRFTSVADSYQNSGDNFSDLILDFDPGEDRIDLSGLGFSGLGDGHNGTLLLWTSSETNRTYLKNFDTDADGRRFEIALEGVFSDLGEKQLVFERLVLEGTRLGDQLSGTELNEELLGGAGRDILNGGAGDDILDGGSERDTLTGGSGADVFRFNATLDSFRNYDSGTSRVDDITDFTVGEDLIDLSALGYSGLGDGYDGTLAVLLNADGTKTYLKDRESDADGNHFEIALDGNYADQLSNGDFVFTNLEVIGSSSQAA, SEQ ID NO.8.
[0036] Example 3: Catalysis of the conversion of M to G by AlgEAv7 and its mutants and preparation of alginate with a high G content The mannuronic acid C-5 epimerase AlgEAv7 and its mutants prepared in Examples 1 and 2 were subjected to Ni + Affinity chromatography purification was performed, and the protein concentration of the purified enzyme sample was determined using a BCA kit. The content of M and G in the substrate before and after the enzyme reaction was determined by HPLC to evaluate the enzyme's catalytic efficiency in converting M to G. The specific reaction system was as follows: 1000 μL of substrate (1% commercial alginate) was added to a 10 mL test tube, followed by 1000 μL of appropriately diluted enzyme solution to achieve a final concentration of 1 mg / mL. The mixture was vortexed, the pH was adjusted to 7, and the reaction was carried out in a 37℃ water bath for 12 h. After the water bath, the reaction system was placed in a boiling water bath for 10 min, immediately cooled, and then subjected to acid hydrolysis and derivatization to determine the M and G content in the sample.
[0037] The G and M contents in 1% commercial alginate substrate and alginate prepared by AlgEAv7 and its mutants were determined by HPLC. For the assay, an XDB-C18 column was used, the sample injection volume was 20 μL, the absorbance was set to 245 nm, and the column temperature was 25℃. The mobile phase A was 0.05 mol / L phosphate buffer (KH₂PO₄, NaOH, pH 6.9), and the mobile phase B was acetonitrile. The elution mobile phase composition was 17% acetonitrile + 83% phosphate buffer, and the flow rate was 1 mL / min.
[0038] The results are as follows Figures 3-5 As shown, the initial G content of the substrate is 31.3% ( Figure 3 After being catalyzed by recombinant mannuronic acid C-5 epimerase AlgEAv7 and mutant, the content of product G was 66.4% ( Figure 4 ) and 73.5% Figure 5 The above results indicate that AlgEAv7 and its mutants have the ability to catalyze the conversion of M to G, and can efficiently catalyze the conversion of M in alginate polysaccharides to G. Among them, the isomerization rate of the mutant reached 42.2% in a short time (12 h), thus enabling the preparation and provision of alginate with a stable increase in G content. The final alginate prepared had a G content of 73.5%.
[0039] Example 4: Preparation of hydrogel dressing using high-G alginate as raw material Low-glucose alginate solutions (glucose content 31.3%) and high-glucose alginate solutions (glucose content 73.5%) with a concentration of 1 w / v were prepared. Calcium carbonate was added to these alginate solutions to achieve a calcium ion to carboxyl group ratio of 0.25. After homogeneous dissolution, citric acid (to a final concentration of 0.17%) and a small-molecule hyaluronic acid solution (10% by weight of alginate) were added, respectively. The solutions were poured into 12-well plates, allowed to stand for one day, and then partially frozen and lyophilized to prepare low-glucose alginate-based hydrogels and high-glucose alginate polysaccharide-based hydrogels, named SA-HA hydrogels. An alginate polysaccharide-based hydrogel without the addition of small-molecule hyaluronic acid was prepared using the same procedure and named SA-hydrogel.
[0040] The microstructure of the two hydrogel surfaces was observed using scanning electron microscopy-X-ray energy dispersive spectroscopy (SEM-EDS), and the surface elements were qualitatively analyzed. The results are as follows: Figure 6 As shown, the high-G alginate-based hydrogel has a denser gel structure, indicating a higher degree of cross-linking. These results demonstrate the successful preparation of the high-G alginate-based hydrogel sample, and that compared to the low-G alginate-based hydrogel, the high-G alginate-based hydrogel exhibits a denser gel structure and a stronger degree of cross-linking.
[0041] Infrared spectroscopy analysis was performed on the high-G alginate-based hydrogel to characterize its structure. SA powder, SA-hydrogel, and SA-HA hydrogel samples were ground and mixed with KBr powder, then pressed into particles at a particle size of 500-4000 cm⁻¹. -1 FTIR measurements and analyses were performed within the frequency range. Results are as follows: Figure 7 As shown, both high-G alginate-based hydrogels and low-G alginate-based hydrogels have a thickness of 3200-3600 cm⁻¹. -1 A broad peak appears at [value missing], which is a characteristic peak of hydrogen bonding between SA molecules or between SA and water. Furthermore, the FTIR spectra show asymmetric stretching vibrations of the carboxyl groups in both hydrogel samples (1600-1610 cm⁻¹). -1 ) and symmetrical stretching vibration (1400-1410 cm) -1 The particles moved to lower and higher wavenumbers respectively, indicating that they were successfully cross-linked with calcium ions, and the hydrogel sample was successfully prepared.
[0042] Example 5: Evaluation of the wound healing efficacy of high-G alginate polysaccharide-based hydrogel dressing Using the mannouronic acid C-5 epimerase AlgEAv7 mutant prepared in Example 2 and commercial alginate substrate, high-G alginate polysaccharide-based hydrogel dressings and low-G alginate polysaccharide-based hydrogel dressings were prepared, and sterilized under UV light for 30 min. Six- to eight-week-old male ICR mice were used in the experiment and divided into groups: a negative control group (no wound treatment), a positive control group (commercial hydrogel dressing), and experimental groups for high-G and low-G alginate polysaccharide-based hydrogel dressings, with six mice in each group. First, the mice in different groups were acclimatized and anesthetized, then their backs were shaved. The general wound area was disinfected with iodine-soaked cotton balls in a circular motion, and after 1-2 minutes, the iodine was removed with 75% alcohol cotton balls to model the wound. The mice were placed on their sides, and the skin on the mouse's back was pulled out with tweezers. A punch was placed on the pulled-out skin, pressed to make a hole, and the skin on the mouse's back was gently smoothed to complete the wound modeling. Different groups were treated with their respective dressing samples. The wound healing status of the mice was observed daily, and the dressings were changed. The animal experimental protocol was approved by the Animal Ethics Committee of Ocean University of China (Shandong, China), and the experimental procedures were carried out in accordance with the guidelines and the "Guidelines for the Management and Use of Laboratory Animals: Eighth Edition", ISBN-10: 0-309-15396-4.
[0043] To monitor the wound healing process, the wounds of mice were photographed at 0, 3, 6, 9, and 12 days post-injury, and the wound size was calculated using ImageJ software. The wound healing rate was calculated using the formula: Wound Healing Rate = (A0 - At) / A0, where A0 is the wound area and At is the wound area after a fixed time interval. Results are as follows: Figure 8 As shown, after 3 days of treatment, the relative wound area ratio of the high-G alginate-based hydrogel dressing group (41.24%) was significantly lower than that of the low-G alginate-based hydrogel dressing (69.28%) and the negative control group (75.70%), indicating that the composite hydrogel can more effectively promote wound healing. By day 12, the wounds in the high-G alginate-based hydrogel dressing group and the positive control group had basically healed, with the relative wound area ratios decreasing to 7.41% and 6.69%, respectively, significantly better than the negative control group (20.94%).
[0044] The above results demonstrate that, using the mannuronic acid C-5 epimerase AlgEAv7 and its mutants disclosed in this invention, alginate with G contents of 66.4% and 73.5% can be prepared, respectively, to produce high-G alginate polysaccharide hydrogels. High-G alginate promotes wound healing; the higher the G content, the better the wound healing effect, thus greatly expanding the applications of high-G alginate and its hydrogels in food, biomedicine, and biomaterials.
[0045] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A mannouronic acid C-5 epimerase AlgEAv7, characterized in that, Its amino acid sequence is shown in SEQ ID NO.
4.
2. A mannuronic acid C-5 epimerase AlgEAv7 mutant, characterized in that, Its amino acid sequence is shown in SEQ ID NO.
8.
3. A recombinant vector expressing mannouronic acid C-5 epimerase, characterized in that, The recombinant vector contains a gene encoding the mannuronic acid C-5 epimerase AlgEAv7 of claim 1 or a gene encoding the mannuronic acid C-5 epimerase AlgEAv7 mutant of claim 2.
4. A recombinant microorganism expressing mannuronic acid C-5 epimerase, characterized in that, The recombinant microorganism includes the recombinant vector according to claim 3.
5. The application of the mannuronic acid C-5 epimerase AlgEAv7 of claim 1 or the mannuronic acid C-5 epimerase AlgEAv7 mutant of claim 2 in increasing the α-L-guluronic acid content in alginate.
6. A method for preparing alginate with high α-L-guluronic acid content, characterized in that, The method includes the steps of using alginate as a substrate and catalyzing the conversion of β-D-mannuronic acid in the substrate to α-L-guluronic acid using the mannuronic acid C-5 epimerase AlgEAv7 as described in claim 1 or the mannuronic acid C-5 epimerase AlgEAv7 mutant as described in claim 2, thereby obtaining alginate with a high α-L-guluronic acid content.
7. The preparation method according to claim 6, characterized in that, The catalysis was carried out at a temperature of 37°C, a pH of 6-8, and a time of 10-16 h.
8. A type of alginate with high α-L-guluronic acid content prepared by the preparation method according to claim 6 or 7.
9. The use of the high α-L-guluronic acid content alginate as described in claim 8 in the preparation of products that promote wound healing.
10. A product for promoting wound healing, characterized in that, The product contains alginate with high α-L-guluronic acid content as described in claim 8.