Construction and application of synthetic sphaeropsis sapinea-induced expression system

Abstract

This invention belongs to the field of molecular biology breeding technology, and particularly relates to the construction and application of an artificially synthesized *Sclerotinia sclerotiorum* inducible expression system. The nucleotide sequence of the artificially synthesized *Sclerotinia sclerotiorum* inducible promoter is shown in any one of SEQ ID NO. 1-3. The promoter provided by this invention has *Sclerotinia sclerotiorum* inducible activity. Using the promoter of this invention, a recombinant expression vector with "promoter-target gene" fusion expression can be constructed and transformed into wild-type plants. This allows for spatiotemporal control of target gene expression, obtaining transgenic plants that induced expression of the target gene under *Sclerotinia sclerotiorum* infection. This enables controlled expression of disease-resistant and other target genes under specific stress conditions. This is beneficial in reducing the metabolic burden and other negative impacts of constitutive promoters on transgenic plants in disease-resistant genetic engineering breeding, and has broad application prospects and good social benefits in plant genetic engineering disease-resistant breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular biology breeding technology, and in particular to the construction and application of an artificially synthesized Sclerotinia sclerotiorum induced expression system. Background Technology

[0002] Rapeseed, belonging to the Brassicaceae family and the Brassica genus, is one of the world's four major oilseed crops and a major source of edible vegetable oil in my country. Its yield and quality are crucial for ensuring the supply of edible oil. However, sclerotinia stem rot, caused by Sclerotinia sclerotiorum, results in a 10-20% yield loss annually, seriously threatening the sustainable development of the rapeseed industry. Transforming resistance or defense genes into recipient plants through genetic engineering, thereby acquiring the corresponding resistance phenotype, is an economical and effective way to control rapeseed sclerotinia stem rot.

[0003] A promoter is a special non-coding DNA sequence that functions to recognize, bind to, and initiate transcription using RNA polymerase. As a "switch" for gene transcription, it regulates the initiation and degree of gene expression, and is one of the key factors for achieving efficient expression of exogenous genes. Currently, constitutive strong promoters are widely used in the field of plant genetic engineering. Theoretically, exogenous resistance genes driven by these promoters will be highly expressed in all developmental stages and tissues of plants. This persistent ectopic expression not only increases the unnecessary metabolic burden on transgenic plants but may also trigger pleiotropic effects or toxicity, and even lead to epigenetic silencing. Compared with the persistent ectopic expression of constitutive promoters, inducible promoters possess spatiotemporal specificity or inducible response characteristics, and can precisely regulate gene expression under specific spatiotemporal patterns, effectively reducing pleiotropic effects and unnecessary metabolic losses. Inducible promoters are a class of promoters that have been developed by plants during long-term environmental adaptation and can respond to specific biological, physical, or chemical signals. In the absence of inducing factors, the target genes they drive are not expressed or are expressed at a basal level. Once inducing factors are present in the environment, the expression of the target genes increases rapidly, thus causing the plant to exhibit a stress-resistant phenotype. Therefore, using inducible promoters to drive exogenous resistance genes in transgenic plants can minimize negative impacts on plants and is receiving increasing attention in plant genetic engineering research.

[0004] Currently, researchers have constructed several pathogen-inducible promoters and verified their functional activity in various plants, including Arabidopsis thaliana, tobacco, rice, and soybean. Pathogen-inducible promoters can respond to biotic stress signals from pathogen invasion, regulating the transcriptional levels of resistance or defense genes, thereby enhancing disease resistance without affecting normal plant growth. They play a crucial role in crop stress-resistance breeding and genetic improvement. However, currently available naturally derived promoters of this type typically have limitations in terms of induction conditions, transcription efficiency, and sequence length, making it difficult to meet the practical needs of precise regulation. Therefore, identifying and developing novel *Sclerotinia sclerotiorum*-inducible promoters is of great significance for genetic engineering breeding and genetic improvement of rapeseed resistant to *Sclerotinia sclerotiorum*. Summary of the Invention

[0005] To address the aforementioned technical problems in the prior art, this invention replicates the cis-acting element SIE by making 3, 4, and 6 copies respectively, and then combines it with the promoter core truncated region P. G17-609 By fusing these synthetic promoters, SISP1, SISP2, and SISP3 were obtained. Induced by *Sclerotinia sclerotiorum* infection, these promoters can activate the high expression of downstream target genes, providing valuable promoter tools for plant genetic engineering and disease resistance breeding. They have significant application potential in plant, especially in the field of genetic engineering breeding for *Sclerotinia sclerotiorum* resistance in rapeseed. This invention is specifically achieved through the following technical solutions:

[0006] The first aspect of the present invention provides an artificially synthesized Sclerotinia sclerotiorum inducible promoter, the nucleotide sequence of which is shown in any one of SEQ ID NO.1-3.

[0007] Furthermore, the nucleotide sequence of the artificially synthesized Sclerotinia sclerotiorum inducible promoter is shown in SEQ ID NO.2.

[0008] A second aspect of the present invention provides a recombinant expression vector comprising the synthetic Sclerotinia sclerotiorum inducible promoter as described above.

[0009] Furthermore, the original vector of the recombinant expression vector is pDX2181.

[0010] A third aspect of the present invention provides a recombinant microorganism comprising the recombinant expression vector described above.

[0011] Furthermore, the starting strain of the recombinant microorganism is Agrobacterium.

[0012] The fourth aspect of the present invention provides the application of the artificially synthesized Sclerotinia sclerotiorum inducible promoter, recombinant expression vector or recombinant microorganism as described above in the construction of transgenic plants induced by Sclerotinia sclerotiorum expression.

[0013] Optionally, the transgenic plant includes transgenic Arabidopsis thaliana or transgenic Brassica napus.

[0014] The advantages and positive effects of this invention are as follows:

[0015] The artificially synthesized promoter provided by this invention has Sclerotinia sclerotiorum induction activity. By using the promoter of this invention, a recombinant expression vector with "promoter-target gene" fusion expression can be constructed and transformed into wild-type plants. This allows for the spatiotemporal control of target gene expression, resulting in transgenic plants that express the target gene under Sclerotinia sclerotiorum infection. This enables the controlled expression of disease-resistant and other target genes under specific stress conditions. This is beneficial for reducing the metabolic burden and other negative impacts of constitutive promoters on transgenic plants in disease-resistant genetic engineering breeding. It has broad application prospects and good social benefits in plant genetic engineering disease-resistant breeding. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 This is a schematic diagram of the assembly of artificially synthesized promoters SISP1, SISP2 and SISP3 in an embodiment of the present invention;

[0018] Figure 2 This is a map of the recombinant expression vector fused with the promoter and GUS gene in an embodiment of the present invention, wherein Figures (a)-(d) are P, respectively. G17-609 Vector spectra of -pDX2181, SISP1-pDX2181, SISP2-pDX2181 and SISP3-pDX2181;

[0019] Figure 3 Figure 1 shows GUS staining and relative expression level detection of transgenic Arabidopsis leaves in an embodiment of the present invention. Figure 2 shows GUS staining of Arabidopsis leaf tissue and Figure 3 shows the relative expression level detection of the GUS gene.

[0020] Figure 4 Figure 1 shows GUS staining and protease activity detection images of transgenic rapeseed leaves in an embodiment of the present invention. Figure 2 shows GUS staining of rapeseed leaf tissue, and Figure 3 shows GUS protease activity detection images. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0022] Based on the information contained in this application, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0023] To better understand the invention and not to limit its scope, all figures indicating amounts, percentages, and other numerical values ​​used in this application should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0024] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.

[0025] The terms “including,” “contains,” “includes,” “has,” and similar words are non-restrictive and can include other steps and other components that do not affect the result.

[0026] The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0027] To make the objectives and features of this invention more apparent and understandable, the technical principles and specific implementation methods of this invention will be described in detail below.

[0028] Sclerotinia stem rot (SSR), caused by *Sclerotinia sclerotiorum*, is a common and serious disease of rapeseed, causing significant losses to rapeseed production in my country. Transgenic technology, which involves converting defense / resistance genes into rapeseed for SSR resistance breeding, is an effective control strategy. However, constitutive overexpression of the target gene can lead to plant growth defects and toxic effects. Therefore, *Sclerotinia sclerotiorum*-induced promoters driving controlled expression of resistance / defense genes or host-induced gene silencing for SSR resistance improvement hold great promise. However, naturally derived promoters of this type typically have limitations in terms of induction conditions, transcription efficiency, and sequence length, making it difficult to meet the practical needs of precise regulation. Compared to natural promoters, synthetic promoters have advantages such as shorter sequences and reduced gene silencing effects, enabling stronger tissue specificity and induction control, and can be used to construct complex gene circuits for multi-gene differential regulation. Although synthetic promoters have been successfully applied in various plants, inducible synthetic promoters developed specifically for *Sclerotinia sclerotiorum* in rapeseed have not yet been reported.

[0029] This invention utilizes the promoter of the Sclerotinia sclerotiorum-induced response, which is truncated to obtain the core active region P. G17-609 Subsequently, three synthetic promoters, named SISP1, SISP2, and SISP3, were constructed by fusing different copy repeats of the cis-acting element SIE. These synthetic promoters were then fused with the β-glucuronidase reporter gene (GUS) and introduced into Arabidopsis thaliana and Brassica napus via Agrobacterium-mediated transformation. The expression levels and protein activities of GUS in transgenic lines and wild-type plants under normal and Sclerotinia sclerotiorum infection conditions were detected. The results showed that the synthetic promoters SISP1, SISP2, and SISP3 had high inducibility in transgenic Arabidopsis thaliana and Brassica napus. Under Sclerotinia sclerotiorum infection induction, they effectively activated GUS gene expression, exhibiting increased GUS staining, and significant upregulation of GUS transcription level and protein activity. In transgenic Arabidopsis thaliana, they drove upregulation of the target gene GUS by 13.12, 39.22, and 18.37-fold, respectively, and in transgenic Brassica napus, they drove upregulation of GUS protein activity by 9.13, 33.29, and 11.04-fold, respectively. These results confirm that the three novel synthetic promoters SISP1, SISP2 and SISP3 provided by this invention can regulate the foreign genes introduced into transformed plants during Sclerotinia sclerotiorum infection, enabling the introduced genes to be expressed under pathogen-induced conditions, providing valuable promoter tools for plant genetic engineering and disease-resistant breeding genetic improvement.

[0030] Based on this, one embodiment of the present invention provides an artificially synthesized Sclerotinia sclerotiorum inducible promoter, wherein the nucleotide sequence of the artificially synthesized Sclerotinia sclerotiorum inducible promoter is shown in any one of SEQ ID NO.1-3, corresponding to promoters SISP1, SISP2 and SISP3 respectively.

[0031] The promoter provided by this invention is strongly induced by Sclerotinia sclerotiorum infection, activating high expression of downstream exogenous genes only during Sclerotinia sclerotiorum infection. Under normal growth conditions, the background expression level of exogenous genes in transgenic plants is low. Therefore, by using the promoter of this invention to construct a recombinant expression vector that achieves "promoter-target gene" fusion expression, and transforming it into wild-type plants, spatiotemporal control of target gene expression can be achieved, resulting in transgenic plants that express the target gene induced by Sclerotinia sclerotiorum infection. For example, by replacing the GUS reporter gene activated by the promoter with a disease resistance gene, the controlled expression of the disease resistance gene under specific stress conditions can be achieved. This helps to reduce the metabolic burden and other negative impacts of constitutive promoters on transgenic plants in disease resistance genetic engineering breeding, maximize the advantages of transgenics, and improve the resistance of transgenic plants to Sclerotinia sclerotiorum. It has broad application prospects and good social benefits in plant genetic engineering disease resistance breeding.

[0032] Preferably, the nucleotide sequence of the artificially synthesized Sclerotinia sclerotiorum inducible promoter is shown in SEQ ID NO.2. This SISP2 promoter sequence exhibits stronger Sclerotinia sclerotiorum induction activity and has significant application potential in the field of genetic engineering for rapeseed resistance to Sclerotinia sclerotiorum disease.

[0033] Another embodiment of the present invention provides a recombinant expression vector comprising the artificially synthesized Sclerotinia sclerotiorum inducible promoter as described above.

[0034] The advantages of the recombinant expression vector over the prior art are the same as those of the recombinant expression vector over the prior art as described above, and will not be repeated here.

[0035] Optionally, the original vector of the recombinant expression vector is a plant expression vector, specifically the pDX2181 vector or other plant expression vectors suitable for the expression of the target gene.

[0036] Optionally, the recombinant expression vector further includes an exogenous target gene, which is located downstream of the artificially synthesized *Sclerotinia sclerotiorum* inducible promoter, and its type is not particularly limited. This target gene can be a reporter gene, such as a GUS gene or a GFP gene, to rapidly drive the upregulation of its downstream reporter gene under *Sclerotinia sclerotiorum* infection, thereby detecting promoter activity; the target gene can also be an antibacterial related functional gene, such as a *Sclerotinia sclerotiorum*-related resistance gene, defense gene, or a small RNA-coding gene used to interfere with *Sclerotinia sclerotiorum* gene expression, to drive the expression of disease resistance genes under *Sclerotinia sclerotiorum* infection, thereby enhancing resistance to sclerotinia rot.

[0037] The transformation of wild-type plant cells or tissues by the recombinant expression vectors described above can be performed using conventional techniques well known to those skilled in the art, such as microinjection, gene gun method, electroporation, liposome packaging method, viral vector method, or Agrobacterium-mediated transformation.

[0038] Another embodiment of the present invention provides a recombinant microorganism, which includes the recombinant expression vector described above.

[0039] The starting strain of the recombinant microorganism can be Agrobacterium or other microorganisms that can mediate transformation or transfection, such as Rhizobium, Lentiviral, Adenovirus, etc.

[0040] Another embodiment of the present invention provides the application of the artificially synthesized Sclerotinia sclerotiorum inducible promoter, recombinant expression vector or recombinant microorganism as described above in the construction of transgenic plants induced by Sclerotinia sclerotiorum, especially in the breeding of plants to improve resistance to Sclerotinia sclerotiorum disease.

[0041] The application includes: using the artificially synthesized Sclerotinia sclerotiorum inducible promoter as the target gene promoter, fusing it with a target gene related to disease resistance function, constructing a recombinant expression vector, and transferring it into wild-type plants, thereby inducing transgenic plants to express the target gene after Sclerotinia sclerotiorum infection.

[0042] Alternatively, the wild-type plants mentioned above include Arabidopsis thaliana or Brassica napus.

[0043] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or as recommended by the manufacturer. Furthermore, all materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0044] Example

[0045] 1. Artificial synthesis of Sclerotinia sclerotiorum inducible promoters SISP1, SISP2 and SISP3

[0046] This invention utilizes the selected Sclerotinia sclerotiorum induction-related regulatory element—the Sclerotinia sclerotiorum inducible promoter P. G17 Based on this, truncated sites were determined through cis-element analysis and the distribution of pathogen-inducing elements, thus obtaining the truncated promoter P. G17-609 Then, the cis-acting elements SIE and P of different copies (3, 4, and 6 copies, single-copy sequence tatgacgtg) were... G17-609 Assembly yielded three new artificially synthesized promoters, SISP1, SISP2, and SISP3, as follows: Figure 1 As shown. The above three synthetic promoters were sent to the Chengdu branch of Beijing Qingke Biotechnology Co., Ltd. for synthesis.

[0047] The nucleotide sequence of SISP1 is shown below:

[0048] (See SEQ ID NO.1).

[0049] The nucleotide sequence of SISP2 is as follows:

[0050] tatgacgtgtatgacgtgtatgacgtgtatgacgtgaaggagaaggaacactagtgtcttggttaaaacatccaccgccgtctgtggggatcgaacccacggccacgggattaaaagtcacgcgctctaccactgagctaagacggcatcggatgattagtgtttcttgttaaactttcataacacctaaataactcatgtatccacgtactggaaaaagacacagcaaacatcaatcaaacaggcgaagagtaatgatcaagagatgtcaatatctcaggtttatacatgagtcatgaattcacacaatgtttcgtattgaaaggcgacaagaaactacgtaatagaatcaatcaattattactaaaaaaacaattactacaattagcaaaatgataaggatggttcattgattgaaaggcatcttagtagtaggtccaatatcactgctaggccctagtggcggcttctgtaacgcaccaacacgtccacttggcttaatttatttgaccattttcgaacattgctttctccaagtttgaataatcaaactcgatggcttacgtaaactcttatataaacacattaccaccctgagatctttcatcatcatcaatcaatcttctcacacttcagtcacataca (see SEQ ID NO.2).

[0051] The nucleotide sequence of SISP3 is as follows:

[0052] (See SEQ ID NO.3).

[0053] 2. Construction of recombinant expression vectors

[0054] P G17-609 The three synthetic promoters SISP1, SISP2, and SISP3 were cloned into the multiple cloning site of the promoter function analysis vector pDX2181 (purchased from Wuhan Tianwen Biotechnology Co., Ltd.), respectively, to obtain recombinant expression vectors in which the corresponding promoters were fused with the reporter gene β-glucuronidase (GUS), and named P, respectively. G17-609 -pDX2181, SISP1-pDX2181, SISP2-pDX2181 and SISP3-pDX2181, carrier frame and key components such as Figure 2 As shown, Figures (a) to (d) are P respectively. G17-609Vector maps of -pDX2181, SISP1-pDX2181, SISP2-pDX2181, and SISP3-pDX2181. Specific construction methods include: using restriction endonucleases SalⅠ and BamHI to inhibit P... G17-609 The target fragment was double-digested with three synthetic promoters, SISP1, SISP2, and SISP3, and the pDX2181 vector. The correctly banded fragments were purified by gel extraction and then ligated with DNA ligase to the promoter fragment and the double-digested linearized pDX2181 vector. The product was transformed into *E. coli* DH5α competent cells and plated on antibiotic-resistant plates. After overnight culture, single clones were picked, and after PCR identification, plasmids were extracted.

[0055] 3. Agrobacterium-mediated genetic transformation in Arabidopsis thaliana

[0056] The successfully constructed recombinant expression vector was transformed into *Agrobacterium tumefaciens* strain GV3101. The *Agrobacterium* carrying the recombinant vector was then transformed into *Arabidopsis thaliana* using the inflorescence infection method. The recipient strain was *Arabidopsis thaliana*. The main steps and solution formulations for *Agrobacterium*-mediated genetic transformation of *Arabidopsis thaliana* are as follows:

[0057] 1) Preparation of infection solution: Take 500 μL of frozen Agrobacterium tumefaciens bacterial suspension and inoculate it into 50 mL of antibiotic resistance medium, and incubate at 28℃ with shaking until OD reaches 100%. 600 The value was approximately 2.2. After positive identification by bacterial culture PCR, the bacterial cells were collected by centrifugation at 8000 rpm for 2 min, the supernatant was discarded, and the cells were resuspended in inflorescence infection resuspension to OD. 600 The concentration was 0.8-1.0, and the solution was incubated in the dark for 30 min. Then, 30 μL of Silwet L-77 was added and mixed well to prepare the infiltration solution.

[0058] 2) Inflorescence infection: Pour the prepared infection solution into a beaker, completely immerse the Arabidopsis inflorescence for 30 seconds, then remove it. Gently absorb excess liquid with absorbent paper, wrap with plastic wrap, and incubate in the dark for 16 hours. Then remove the film and restore light exposure. Infect once every 3-5 days, for a total of 3 times.

[0059] 3) Identification of positive plants: T0 generation seeds were harvested, dried, and stored. After sterilization, the seeds were sown on solid MS medium containing 20 μg / mL hygromycin, vernalized at 4℃ for 3 days, and then transferred to a light incubator for selection and culture for 10-14 days. Resistant seedlings with robust root systems were selected for transplanting. DNA was extracted from leaves of T1 generation plants and amplified by PCR using hygromycin gene primers to verify positive plants. T2 generation positive transgenic plants were selected after self-pollination of T1 positive plants, and T2 generation seeds were harvested for subsequent research.

[0060] Solid MS medium (Murashige & Skoog medium): Weigh 2.215 g MS powder, 7.5 g sucrose, and 3.5 g agar and dissolve them in approximately 400 mL ddH2O. Adjust the pH to 5.7-5.8 with 3 mol / L potassium hydroxide and bring the volume to 500 mL. After aliquoting, seal and sterilize. After cooling, aliquot into sterile plates. If preparing hygromycin-resistant medium, add hygromycin to a final concentration of 20 μg / mL when cooled to 50°C, shake well, aliquot, and store at 4°C after solidification.

[0061] Acetyleugenol (AS) solution: Weigh 0.196 g AS, dissolve it in 10 mL dimethyl sulfoxide (DMSO), and after complete dissolution, dispense it into 1.5 mL centrifuge tubes and store at -20℃ for later use.

[0062] Arabidopsis inflorescence infection resuspension: Weigh 0.2215 g MS powder and 5.0 g sucrose, add to 80 mL ddH2O and dissolve thoroughly. Adjust the pH to 5.7-5.8 with 3 mol / L potassium hydroxide, add 200 μL AS solution, and bring the volume to 100 mL to prepare the infection resuspension. Add 30 μL Silwet L-77 to the resuspension after incubating in the dark for 30 min, mix well, and then use for infection.

[0063] 4. Agrobacterium-mediated genetic transformation of rapeseed

[0064] This invention employs the hypocotyl transformation method to transform Agrobacterium-mediated rapeseed carrying recombinant vectors, using the conventional Brassica napus L. variety Westar as the transformation recipient. The main steps and solution formulations for Agrobacterium-mediated rapeseed genetic transformation are as follows:

[0065] 1) Rapeseed sowing: Disinfect the seeds with 75% alcohol for 1 minute, pour off the alcohol, and soak them in 10% sodium hypochlorite solution for 3 minutes, shaking continuously during the process; then wash them with sterile water 4-5 times; place the washed seeds on sterile filter paper to drain the surface moisture, inoculate them in M0 medium, and incubate them in the dark for 7 days.

[0066] 2) Preparation of infection solution: Take 500 μL of frozen Agrobacterium tumefaciens bacterial suspension and inoculate it into 50 mL of antibiotic resistance medium. Incubate at 28°C with shaking until OD reaches 100°C. 600 The concentration is approximately 0.4. Centrifuge at 5000 rpm for 5 min to collect the bacterial cells, discard the supernatant, add an equal volume of DM medium to resuspend, centrifuge again to discard the supernatant, and resuspend again with an equal volume of DM. Take 2 mL of the above bacterial solution and add 20 mL of DM, mix well and the solution is the infection solution.

[0067] 3) Hypocotyl infection: Cut about 1 cm of rapeseed hypocotyl with sterile scissors, immerse it in the prepared infection solution for 15 minutes, then place it on sterile filter paper to blot dry the bacterial solution; transfer it to M1 medium for dark incubation for 2 days, and then transfer it to M2 medium for normal incubation for 2 weeks.

[0068] 4) Subculture: Transfer to M3 medium and subculture every 2-3 weeks until the hypocotyl grows green shoots. Then transfer to M4 medium and after roots grow, transfer to soil culture.

[0069] M0 medium: Weigh 4.4 g MS and 30 g sucrose, dissolve them, adjust the pH to 5.84-5.88, add 8 g agar, and bring the volume to 1 L. Sterilize and set aside.

[0070] DM medium: Weigh 4.4 g MS and 30 g sucrose, dissolve them, adjust the pH to 5.84-5.88, bring the volume to 1 L, sterilize, and add 100 μM AS when cooled to 50℃.

[0071] M1 medium: Weigh 4.4 g MS, 30 g sucrose, 18 g mannitol, 1 mg 2,4-D and 0.3 mg KT and dissolve them. Adjust the pH to 5.84-5.88, then add 8 g agar and bring the volume to 1 L. After sterilization and cooling to 50°C, add 100 μM AS.

[0072] M2 medium: Weigh 4.4 g MS, 30 g sucrose, 18 g mannitol, 1 mg 2,4-D and 0.3 mg KT and dissolve them. Adjust the pH to 5.84-5.88, then add 8 g agar and bring the volume to 1 L. After sterilization and cooling to 50°C, add 300 mg TMT and 100 μM AS.

[0073] M3 medium: Weigh 4.4 g MS, 30 g sucrose, 0.6 g MES and 0.25 g xylose and dissolve them. Adjust the pH to 5.84-5.88, then add 8 g agar and bring the volume to 1 L. After sterilization and cooling to 50℃, add 0.1 mg IAA, 2 mg ZT, 300 mg TMT and 3 mg AgNO3.

[0074] M4 medium: Weigh 4.4 g MS and 30 g sucrose, dissolve them, adjust the pH to 5.84-5.88, add 8 g agar, bring the volume to 1 L, sterilize, and cool to 50℃ before adding 300 mg TMT.

[0075] 5. Activation and inoculation of Sclerotinia sclerotiorum

[0076] Take *Sclerotium sclerotiorum* culture stored at 4℃, and inoculate a piece of mycelium from the outer edge of the mycelium in a clean bench into the center of a PDA medium. Activate the medium by incubation in the dark at 25℃. After 2 days of incubation, cut another piece of mycelium from the outer edge of the activated plate and subculture once using the same method. When the mycelium grows to near the edge of the plate, cut off pieces of mycelium with uniform diameter for later use.

[0077] Seeds of T2 generation transgenic Arabidopsis thaliana and T1 generation transgenic rapeseed were collected for germination experiments. Positive T2 generation transgenic Arabidopsis thaliana plants aged 4-6 weeks and T1 generation transgenic rapeseed plants aged 6-8 weeks were inoculated. In the experimental group, *Sclerotinia sclerotiorum* mycelial blocks (mycelial side down) were picked up with sterile forceps and attached to the upper surface of leaves, then secured with transparent tape; the control group was inoculated with blank agar blocks without mycelium. After inoculation, sterile water was sprayed evenly onto the leaf surface, and the plants were then covered with plastic film to maintain a high-humidity environment. After 24 hours of covering and moisturizing, leaves around the inoculation point were cut using a 0.6 cm diameter punch.

[0078] 6. GUS histochemical staining, expression analysis, and protein activity detection of transgenic plants

[0079] For samples requiring histochemical staining, after 24 h of infection with *Sclerotinia sclerotiorum*, leaves around the inoculation point were cut using a 0.6 cm diameter punch. The leaves were then immersed in GUS staining solution, vacuum treated for 10 min, and stained overnight at 37°C. The staining was then completely destained with 75% ethanol and observed and photographed under a microscope. The staining solution formulation followed the method reported by Jefferson et al. (Jefferson, RA, Kavanagh, TA and Bevan, MW GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987, 6, 3901-3907).

[0080] For samples used for GUS expression analysis, total RNA was extracted and reverse transcribed into cDNA. Using Arabidopsis thaliana Actin as an internal reference gene, GUS gene expression levels were detected by qRT-PCR. Each treatment group had three biological replicates and three technical replicates. The primer sequences used for detection are as follows:

[0081] GUS-F: CGATGCGGTCACTCATT (see SEQ ID NO.4);

[0082] GUS-R: GTCTGCCAGTTCAGTTCG (see SEQ ID NO.5);

[0083] Actin-F: TCGTACAACCGGTATTGTGC (see SEQ ID NO.6);

[0084] Actin-R: GCTGTTGTGGTGAACATGTAAC (see SEQ ID NO. 7).

[0085] For samples used for GUS protein activity assay, protein extraction and concentration determination followed the method reported by Bradford et al., and GUS activity assay followed the method of Xu et al. (Bradford, MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248-254; Xu, L. et al. Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants. Plant Cell Rep. 2010, 29, 1061-1068).

[0086] Figure 3 The images show GUS staining and relative expression levels in transgenic Arabidopsis leaves. Figure (a) shows GUS staining in Arabidopsis leaf tissue, and Figure (b) shows the relative expression levels of the GUS gene. Figure 4 The images show GUS staining and protease activity assays in transgenic rapeseed leaves. Figure (a) shows the GUS staining of rapeseed leaf tissue, and Figure (b) shows the GUS protease activity assay. In the aforementioned figures, PC represents the positive control, a transformant with the CaMV 35S promoter fusion expressing GUS, and NC represents the negative control, a pDX2181 empty vector transformant without the promoter. The results show that P G17-609 The synthesized promoters SISP1, SISP2, and SISP3 showed inducible activity in both Arabidopsis and rapeseed transgenic plants. After induction with Sclerotinia sclerotiorum, the promoter P was truncated. G17-609 GUS staining and GUS gene expression levels were significantly higher than those of its full-length promoter P. G17 Furthermore, the three synthetic promoters drive GUS transcription and expression levels compared to the truncated promoter P. G17-609 Further enhanced.

[0087] In transgenic Arabidopsis, plants synthesizing promoters SISP1, SISP2, and SISP3 exhibited significant color changes before and after Sclerotinia sclerotiorum induction: before infection, GUS staining was lighter, indicating lower transcription levels; after infection, staining significantly deepened, with GUS transcription levels upregulated by 13.12, 39.22, and 18.37 times, respectively, compared to basal expression before Sclerotinia sclerotiorum infection, and also compared to the truncated promoter P after Sclerotinia sclerotiorum infection. G17-609 The levels increased by 1.98, 6.28, and 2.45 times, respectively. In transgenic rapeseed, the GUS coloration of leaves from SISP1, SISP2, and SISP3 transformants was significantly deepened after inoculation with *Sclerotinia sclerotiorum*. Compared with the basal expression in uninfected plants, GUS protein activity was upregulated by 9.13, 33.29, and 11.04 times, respectively, and also increased compared to the truncated promoter P after *Sclerotinia sclerotiorum* infection. G17-609 The increases were 1.76, 6.34, and 2.12 times, respectively. These data indicate that the three synthetic promoters all possess Sclerotinia sclerotiorum induction activity in transgenic Arabidopsis thaliana and transgenic rapeseed, with SISP2 exhibiting a stronger induction effect. This demonstrates the significant application potential of these synthetic promoters in the field of genetic engineering for rapeseed resistance to Sclerotinia sclerotiorum.

[0088] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A synthetically produced Sclerotinia sclerotiorum inducible promoter, characterized in that, The nucleotide sequence of the artificially synthesized Sclerotinia sclerotiorum inducible promoter is shown in any one of SEQ ID NO.1-3.

2. The artificially synthesized Sclerotinia sclerotiorum inducible promoter according to claim 1, characterized in that, The nucleotide sequence of the artificially synthesized Sclerotinia sclerotiorum inducible promoter is shown in SEQ ID NO.

2.

3. A recombinant expression vector, characterized in that, It includes the synthetic Sclerotium sclerotiorum inducible promoter as described in any one of claims 1-2.

4. The recombinant expression vector according to claim 3, characterized in that, The original vector for the recombinant expression vector is pDX2181.

5. A recombinant microorganism, characterized in that, The recombinant microorganism includes the recombinant expression vector as described in any one of claims 3-4.

6. The recombinant microorganism according to claim 5, characterized in that, The starting strain of the recombinant microorganism was Agrobacterium.

7. The use of the artificially synthesized Sclerotinia sclerotiorum inducible promoter as described in any one of claims 1-2, the recombinant expression vector as described in any one of claims 3-4, or the recombinant microorganism as described in any one of claims 5-6 in constructing transgenic plants induced by Sclerotinia sclerotiorum expression.

8. The application of the artificially synthesized *Sclerotinia sclerotiorum* inducible promoter, recombinant expression vector, or recombinant microorganism according to claim 7 in constructing transgenic plants induced by *Sclerotinia sclerotiorum*, characterized in that, The genetically modified plants include genetically modified Arabidopsis thaliana or genetically modified Brassica napus.

Images