Plasmid combination, lentivirus combination, drug screening cell model targeting coronavirus NP dimer formation process and preparation and application thereof, and application of natural small molecule compound

Abstract

This invention discloses a plasmid combination, a lentiviral combination, a cell model for drug screening targeting the formation process of coronavirus NP dimers, its preparation and application, and the application of natural small molecule compounds, relating to the field of biotechnology. The plasmid combination includes a first plasmid, a second plasmid, and a third plasmid, each containing three segments of a Nanoluciferase sequence. Two of the plasmids contain NP sequences. This three-segment Nanoluciferase system can construct a cell model reflecting the NP-dimer formation process. This model weakens steric hindrance by fusing two small tags with NPs, ensuring normal NP function. Furthermore, this model directly targets NP dimer screening with a clearly defined target. In addition, the degree of Nano activity recovery reflects NP dimerization ability, and the detection is rapid, making it suitable for high-throughput drug screening platforms.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a plasmid combination, a lentivirus combination, a drug screening cell model targeting the formation process of coronavirus NP dimers, their preparation and application, and the application of natural small molecule compounds. Background Technology

[0002] Coronaviruses are a large family of viruses that are widespread in nature. Currently, seven coronaviruses are known to infect humans, including three highly pathogenic coronaviruses: SARS, MERS-CoV, and SARS-CoV-2. Major infectious diseases caused by highly pathogenic coronaviruses are occurring more and more frequently. Therefore, the development of new broad-spectrum antiviral drugs is urgently needed to prevent and control novel variants or emerging viruses.

[0003] Nucleocapsid protein (NP), a core component of coronaviruses, plays a crucial role in coronavirus genome packaging, replication, innate immunity, and inflammatory responses. Taking SARS-CoV-2 NP as an example, the C-terminal domains (CTDs) of two NP monomers first form an NP dimer through non-covalent linkage. This dimer then binds to the viral genomic RNA, undergoing a conformational change to form an oligomerized state. Subsequently, through weak protein-protein or protein-nucleic acid interactions, liquid-liquid phase separation (LLPS) occurs, forming a ribonucleoprotein complex (RNP), ultimately promoting coronavirus packaging and replication. Therefore, NP-dimer formation is the fundamental and initial rate-limiting step in viral assembly and replication, and interfering with NP-dimer formation can significantly inhibit viral assembly. Furthermore, NPs from various highly pathogenic coronaviruses exhibit high sequence and structural similarity, and the NP-dimer formation process is highly conserved.

[0004] Following coronavirus infection, NP-dimers are formed within cells. Because this is a transitional state, there is currently no drug screening model targeting NP-dimer formation. To date, there are no reports in domestic or international coronavirus research on identifying small molecule drugs targeting the NP-dimer stage. Summary of the Invention

[0005] The main objective of this invention is to propose a plasmid combination, a lentivirus combination, a drug screening cell model targeting the formation process of coronavirus NP dimers, and its preparation and application, as well as the application of natural small molecule compounds, aiming to solve the problem that existing drug screening models cannot target NP dimer formation.

[0006] To achieve the above objectives, the present invention proposes a plasmid combination, which includes a first plasmid, a second plasmid, and a third plasmid: The first plasmid includes the lenti-n8-NP-puro plasmid, the nucleotide sequence of which is shown in SEQ ID NO.9; The second plasmid includes the lenti-NP-c10-neo plasmid, the nucleotide sequence of which is shown in SEQ ID NO.8; The third plasmid includes the Lenti-nano1-7-blast plasmid, the nucleotide sequence of which is shown in SEQ ID NO.6.

[0007] This invention also proposes a lentivirus combination, which includes a first lentivirus, a second lentivirus, and a third lentivirus: The first lentivirus includes a first plasmid, which includes the lenti-n8-NP-puro plasmid, the nucleotide sequence of which is shown in SEQ ID NO.9; The second lentivirus includes a second plasmid, which includes the lenti-NP-c10-neo plasmid, the nucleotide sequence of which is shown in SEQ ID NO.8; The third lentivirus includes a third plasmid, which includes the Lenti-nano1-7-blast plasmid, the nucleotide sequence of which is shown in SEQ ID NO.6.

[0008] This invention also proposes a cell model for drug screening targeting the formation of coronavirus NP dimers, wherein the cell model for drug screening targeting the formation of coronavirus NP dimers comprises the plasmid combination as described above; or, The drug screening cell model targeting the coronavirus NP dimer formation process was obtained by infecting HeLa cells with a combination of lentiviruses as described above.

[0009] This invention also proposes a method for preparing a drug screening cell model targeting the coronavirus NP dimer formation process as described above, comprising the following steps: S1. Replace the Cas9 sequence in the Lenti-CRISPRv2-neo plasmid with the nucleotide sequence of the NP protein of SARS-CoV-2 to obtain the Lenti-NP-neo plasmid. S2. The nano1-7 sequence, n8 mutant sequence, and c10 mutant sequence were amplified from the pcDNA3.1-Nluc plasmid. S3. The n8 mutant sequence is linked to the N-terminus of NP in the Lenti-NP-neo plasmid using the (GS+9×G4S) linker to obtain the lenti-n8-NP-neo plasmid; the neo resistance gene in the lenti-n8-NP-neo plasmid is replaced with the puro sequence to obtain the lenti-n8-NP-puro plasmid, which is the first plasmid. S4. The c10 mutant sequence is linked to the P-terminus of the NP in the Lenti-NP-neo plasmid through the (GS+9×G4S) linker to obtain the lenti-NP-c10-neo plasmid, which is the second plasmid. S5. Replace the Cas9 sequence in the lenti-Cas9-blast vector with the nano1-7 sequence to obtain the Lenti-nano1-7-blast plasmid, which is the third plasmid. S6. Integrate the first plasmid, the second plasmid, and the third plasmid into the genome of HeLa cells and express them to obtain the drug screening cell model targeting the coronavirus NP dimer formation process.

[0010] In one embodiment, step S6 includes: S61. The first plasmid, the second plasmid and the third plasmid are packaged into first lentivirus, second lentivirus and third lentivirus respectively in HEK293T cells; S62. HeLa cells were infected sequentially with the first lentivirus, the second lentivirus, and the third lentivirus. The infected HeLa cells were then screened sequentially with puromycin, genimycin, and blastomycin, and then expanded to obtain the drug screening cell model targeting the formation process of coronavirus NP dimers.

[0011] In one embodiment, the n8 mutant sequence is shown in SEQ ID NO.2; The c10 mutant sequence is shown in SEQ ID NO.3; The nano1-7 sequence is shown in SEQ ID NO.5.

[0012] The present invention also proposes the application of a drug screening cell model targeting the coronavirus NP dimer formation process in screening drugs targeting the coronavirus NP dimer formation process. The drug screening cell model targeting the coronavirus NP dimer formation process includes the drug screening cell model targeting the coronavirus NP dimer formation process as described above, or is prepared by the preparation method of the drug screening cell model targeting the coronavirus NP dimer formation process as described above.

[0013] In one embodiment, screening for drugs targeting the coronavirus NP dimer formation process includes the following steps: The cell model was seeded into microplates and cultured for 6-8 h. After 6-8 h of adherence, a natural small molecule compound at a concentration of 10 µM was added. A cell model with an equal volume of dimethyl sulfoxide was added as a control group. The cells were treated for 18-24 h. After lysing the cells, luciferase substrate was added and the cells were treated for 10-15 min. The luciferase signal value was detected, and natural small molecule compounds with a difference of more than 2 times from the control group were selected to obtain the initial screening compounds. The cell model was seeded into microplates and cultured for 6-8 h. After 6-8 h of adherent culture, at least four concentration gradients of natural small molecule compounds were added for 18-24 h of treatment. The treated cells were lysed, and luciferase substrate was added for 10-15 min of treatment. The luciferase signal value was detected, and natural small molecule compounds with significant dose-dependent relationships were screened to obtain the drug screening cell model targeting the formation process of coronavirus NP dimers.

[0014] In one embodiment, the natural small molecule compound includes dihydrocyclosporine A.

[0015] The present invention also provides an application of a natural small molecule compound in the preparation of a coronavirus prevention and treatment drug, wherein the natural small molecule compound is obtained by screening a drug screening cell model targeting the coronavirus NP dimer formation process; the drug screening cell model targeting the coronavirus NP dimer formation process includes the aforementioned drug screening cell model targeting the coronavirus NP dimer formation process, or is prepared by the aforementioned method for preparing a drug screening cell model targeting the coronavirus NP dimer formation process. The natural small molecule compound includes dihydrocyclosporine A; The coronavirus prevention and treatment drug is used to prevent and treat at least one of SARS-CoV-2, HCoV-229E, and HCoV-OC43.

[0016] In the technical solution of this invention, the plasmid combination includes a first plasmid, a second plasmid, and a third plasmid. Each of the three plasmids has a three-segment sequence of Nanoluciferase, of which two plasmids have NP sequences. This three-segment Nanoluciferase system can construct a cell model that reflects the NP-dimer formation process. This model weakens the steric hindrance effect by fusing the two small tags n8 and c10 with the respective NPs, ensuring the normal function of NPs. Moreover, this model directly targets NP dimer screening with a clear target. In addition, the degree of Nano activity recovery reflects the NP dimerization ability, and the detection is rapid, making it suitable for high-throughput drug screening platforms. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.

[0018] Figure 1 Image (A) is a schematic diagram of the three segments of Nanoluciferase in Example 1 provided by the present invention; Figure 1 (B) is a schematic diagram of the luciferase model targeting NP dimers in Example 1 provided by the present invention; Figure 1 (C) is the result of selecting the combination with the highest recovery of luciferase activity using the NN-nano model in Example 1 provided by the present invention; Figure 1 (D) is a graph showing the results of the initial screening of a compound library containing 4,300 natural small molecules in Example 2 of the present invention. Figure 2 (A) is a graph showing the dose-dependent experimental results of Dihydrocyclosporin A on NP dimer formation in Example 2 provided by the present invention; Figure 2 (B) is a graph showing the results of detecting the effect of candidate compound DycA on NP-Dimer in Example 3 provided by the present invention; Figure 2 (C) is a Western blotting result of the CETSA experiment in Example 3 of the present invention to verify whether DycA and NP have an interaction; Figure 2 (D) is a graph showing the calculated Tm value of the CETSA experiment in Example 3 of this invention to verify whether DycA and NP have an interaction. Figure 2 Image (E) shows the interaction fitting results of surface plasmon resonance analysis of whether DycA and NP are directly bound in Example 3 of the present invention. Figure 2(F) is a graph showing the results of the analysis of whether DycA and NP are directly bound using surface plasmon resonance technology in Example 3 of the present invention. Figure 2 (G) is the result of predicting the binding site of DycA and SARS-CoV-2 NP-CTD using the AlphaFold3 artificial intelligence system in Example 3 of the present invention; Figure 2 (H) is the result of predicting the binding site of DycA and HCoV-OC43 NP-CTD using the AlphaFold3 artificial intelligence system in Example 3 of the present invention; Figure 2 Image (I) shows the results of predicting the binding site of DycA and MERS-CoV NP-CTD using the AlphaFold3 artificial intelligence system in Example 3 of this invention; Figure 3 (A) is a graph showing the effect of DycA treatment for 24 hours on NP expression levels in Example 3 of the present invention. Figure 3 (B) is a graph showing the effect of DycA treatment for 72 hours on NP expression levels in Example 3 of the present invention. Figure 3 (C) is a graph showing the effect of DycA on NP ubiquitination modification in Example 3 of the present invention; Figure 4 (A) is a graph showing the effect of different concentrations of DycA on viral protein expression levels in Example 4 provided by the present invention; Figure 4 (B) is a Western blotting result of the effect of DycA on the expression level of SARS-CoV-2 viral proteins in Example 4 provided by the present invention; Figure 4 (C) represents the level of DycA inhibiting SARS-CoV-2 replication in Example 4 provided by this invention. 50 and IC 50 Fitted curve; Figure 4 (D) is a graph showing the effect of DycA on the viral titer in cell supernatant in Example 4 of the present invention; Figure 4 The graph in (E) shows the effect of DycA intervention on the body weight of mice infected with SARS-CoV-2 in Example 4 of this invention; Figure 4 (F) is a graph showing the viral titer level in the lung tissue of SARS-CoV-2 infected mice treated with DycA in Example 4 of this invention; Figure 4 (G) is an H&E staining image of lung tissue from SARS-CoV-2 infected mice treated with DycA in Example 4 of this invention; Figure 4(H) is a Western blotting result of Example 5 provided by the present invention, which detects the inhibition of human low pathogenic coronavirus HCoV-229E virus protein expression level by the small molecule compound DycA; Figure 4 (I) shows the detection of the CC level of the small molecule compound DycA inhibiting the replication of low-pathogenic human coronavirus HCoV-229E in Example 5 of this invention. 50 and IC 50 Fitted curve; Figure 4 Figure (J) shows the Western blotting results of Example 5 provided by the present invention, which detected the inhibition of human low-pathogenic coronavirus HCoV-OC43 viral protein expression level by the small molecule compound DycA. Figure 4 (K) represents the detection of the level of inhibition of human low-pathogenic coronavirus HCoV-OC43 replication by the small molecule compound DycA in Example 5 of this invention. 50 and IC 50 Fitted curve; Figure 5 The plasmid diagram of Lenti-CRISPRv2-neo provided by this invention.

[0019] The realization of the objective, functional features and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Where the manufacturers of reagents or instruments are not specified, they are all conventional products that can be purchased commercially. Furthermore, the meaning of "and / or" throughout the text includes three parallel solutions; for example, "A and / or B" includes solution A, or solution B, or a solution where both A and B are satisfied simultaneously. In addition, the technical solutions of the various embodiments can be combined with each other, but this must be based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] After coronavirus infection, NP-Dimer is formed in cells. As this is a transitional state, there is currently no drug screening model that targets the formation of NP-Dimer.

[0022] The applicant first constructed a model using SARS-CoV-2 NP as an example, initially envisioning the use of a two-segment Nanoluciferase (Nanoluciferase) complementary system to characterize NP dimer formation. This Nanoluciferase complementary system consists of a HiBit (11 amino acid length) and an LgBit (17.6 KD in size). Nano is the luciferase reporter gene with the highest luminescence intensity and longest half-life to date, making it highly suitable for high-throughput drug screening platforms. However, considering the large molecular weight of LgBit, its fusion expression with NP may produce significant steric hindrance, affecting NP-dimer formation or NP binding to drugs.

[0023] In view of this, the applicant further modified the Nanoluciferase by artificially dividing it into three fragments: an n8 tag fragment of 8 amino acids, a c10 tag fragment of 10 amino acids, and a nano1-7 large fragment of approximately 151 amino acids. That is, this invention proposes a plasmid combination comprising a first plasmid, a second plasmid, and a third plasmid: the first plasmid comprises the lenti-n8-NP-puro plasmid, the nucleotide sequence of which is shown in SEQ ID NO. 9; the second plasmid comprises the lenti-NP-c10-neo plasmid, the nucleotide sequence of which is shown in SEQ ID NO. 8; and the third plasmid comprises the Lenti-nano1-7-blast plasmid, the nucleotide sequence of which is shown in SEQ ID NO. 6.

[0024] In the technical solution of this invention, the plasmid combination includes a first plasmid, a second plasmid, and a third plasmid. The three plasmids respectively have three sequences of Nanoluciferase: an n8 tag, a c10 tag, and a nano1-7 fragment. The first and second plasmids have NP sequences. Specifically, the n8 tag and the c10 tag are respectively linked to two NP monomers. When the NPs form a dimer, the n8 tag and the c10 tag can be brought closer in space. The affinity between the n8 tag and the nano1-7 fragment can bring the distance between n8, c10, and nano1-7 closer, and ultimately the Nanoluciferase activity is restored. This three-segment Nano luciferase system can construct a cell model that reflects the NP-dimer formation process. The resulting cell model weakens the steric hindrance effect by fusing the two small tags n8 and c10 with the respective NPs, thus ensuring the normal function of the NPs. Moreover, the model directly targets NP dimer screening with a clear target. In addition, the degree of Nano activity recovery reflects the NP dimerization ability, and the detection is rapid, making it suitable for high-throughput drug screening platforms.

[0025] This invention also proposes a lentiviral ensemble comprising a first lentiviral, a second lentiviral, and a third lentiviral: the first lentiviral includes a first plasmid comprising the lenti-n8-NP-puro plasmid, the nucleotide sequence of which is shown in SEQ ID NO. 9; the second lentiviral includes a second plasmid comprising the lenti-NP-c10-neo plasmid, the nucleotide sequence of which is shown in SEQ ID NO. 8; the third lentiviral includes a third plasmid comprising the Lenti-nano1-7-blast plasmid, the nucleotide sequence of which is shown in SEQ ID NO. 6. Plasmids carrying the tags n8, c10, and nano1-7 are first packaged into chronic viruses to facilitate integration into cells to obtain cell models.

[0026] The present invention also proposes a drug screening cell model targeting the formation process of coronavirus NP dimers, wherein the drug screening cell model targeting the formation process of coronavirus NP dimers includes the plasmid combination as described above; or, the drug screening cell model targeting the formation process of coronavirus NP dimers is obtained by infecting HeLa cells with the lentivirus combination as described above.

[0027] To further facilitate drug screening, plasmids with the tags n8, c10, and nano1-7 can be stably integrated into HeLa cells to construct an NN-Nano cell drug screening model. The advantages of this cell model are: direct targeting of NP-dimers for screening, with a clearly defined target; rapid detection of dimer formation ability by measuring luciferase activity, high drug screening throughput, and low time cost.

[0028] This invention also proposes a method for preparing a drug screening cell model targeting the coronavirus NP dimer formation process as described above, comprising the following steps: S1. Replace the Cas9 sequence in the Lenti-CRISPRv2-neo plasmid with the nucleotide sequence of the NP protein of SARS-CoV-2 to obtain the Lenti-NP-neo plasmid. S2. The nano1-7 sequence, n8 mutant sequence, and c10 mutant sequence were amplified from the pcDNA3.1-Nluc plasmid. S3. The n8 mutant sequence is linked to the N-terminus of NP in the Lenti-NP-neo plasmid using the (GS+9×G4S) linker to obtain the lenti-n8-NP-neo plasmid; the neo resistance gene in the lenti-n8-NP-neo plasmid is replaced with the puro sequence to obtain the lenti-n8-NP-puro plasmid, which is the first plasmid. S4. The c10 mutant sequence is linked to the P-terminus of the NP in the Lenti-NP-neo plasmid through the (GS+9×G4S) linker to obtain the lenti-NP-c10-neo plasmid, which is the second plasmid. S5. Replace the Cas9 sequence in the lenti-Cas9-blast vector with the nano1-7 sequence to obtain the Lenti-nano1-7-blast plasmid, which is the third plasmid. S6. Integrate the first plasmid, the second plasmid, and the third plasmid into the genome of HeLa cells and express them to obtain the drug screening cell model targeting the coronavirus NP dimer formation process.

[0029] In the technical solution of this invention, three plasmids—lenti-n8-NP-puro (first plasmid), lenti-NP-c10-neo (second plasmid), and lenti-nano1-7-blast (third plasmid)—are packaged into lentiviruses in HEK293T cells, respectively, to obtain the first lentivirus, the second lentivirus, and the third lentivirus. First, HeLa cells are infected with the first lentivirus, and the cells express a fusion peptide containing n8-NP, resulting in the first cell. Subsequently, the first cells are infected with the second lentivirus, and the first cells express a fusion peptide containing NP-c10, resulting in the second cell. Because there is a natural interaction between NPs, the two fusion peptides, n8-NP and NP-c10, approach each other to form an NP dimer containing both n8 and c10 peptides, i.e. The target NP dimer is identified. Subsequently, a third lentivirus is used to infect a second cell, which expresses a fusion peptide with nano1-7-blasts. Due to affinity, the nano1-7-blast fusion peptide is drawn closer to the NP dimer containing n8 and c10 peptides, thus restoring Nanoluciferase activity and yielding a third cell containing the target NP dimer. When a drug targets the target NP dimer, the drug molecule binds to the NP, blocking or disrupting the NP-NP interaction, leading to the dissociation of the target NP dimer. Consequently, the n8 and c10 fragments separate, and nano1-7 cannot bind to both simultaneously. Luciferase cannot assemble, and the luminescence signal weakens or disappears. Therefore, the cell model screened in this invention can be used to screen drugs targeting the formation process of coronavirus NP dimers.

[0030] It should be noted that the Lenti-CRISPRv2-neo plasmid itself contains the Cas9 sequence; see the specific plasmid diagram for details. Figure 5 .

[0031] It should also be noted that the link sequences used in the first and second plasmids are relatively long, and the n8 and c10 peptide tags are free outside, which does not affect the function of the NP protein.

[0032] In some embodiments, step S6 includes: S61. The first plasmid, the second plasmid and the third plasmid are packaged into first lentivirus, second lentivirus and third lentivirus respectively in HEK293T cells; S62. HeLa cells were infected sequentially with the first lentivirus, the second lentivirus, and the third lentivirus. The infected HeLa cells were then screened sequentially with puromycin, genimycin, and blastomycin, and then expanded to obtain the drug screening cell model targeting the formation process of coronavirus NP dimers.

[0033] In this process, puromycin was used to screen cells that expressed Puro (puromycin resistance, therefore these cells expressed n8-NP fusion peptide); then G418 was used to screen cells that expressed Neo (G418 resistance); and blastcin was used to screen cells that expressed Blast (blastcin resistance). This sequential screening strategy ensures that the three key components n8-NP, NP-c10, and nano1-7 are stably expressed simultaneously in the final HeLa cell model, thus constructing a complete three-segment Nanoluc reporter system.

[0034] In some embodiments, the n8 mutant sequence is shown in SEQ ID NO.2; the c10 mutant sequence is shown in SEQ ID NO.3; and the nano1-7 sequence is shown in SEQ ID NO.5. After expression of the above sequences, the formation of NP-Dimer and the binding of NP to the drug proceeded smoothly.

[0035] This invention also proposes the application of a drug screening cell model targeting the coronavirus NP dimer formation process in screening drugs targeting this process. The drug screening cell model targeting the coronavirus NP dimer formation process includes the aforementioned drug screening cell model targeting the coronavirus NP dimer formation process, or is prepared using the aforementioned method for preparing such a cell model. Therefore, it possesses all the beneficial effects of the aforementioned drug screening cell model targeting the coronavirus NP dimer formation process or the aforementioned method for preparing such a cell model, which will not be elaborated further here.

[0036] In some embodiments, screening for drugs that target the coronavirus NP dimer formation process includes the following steps: The cell model was seeded into microplates and cultured for 6-8 h. After 6-8 h of adherence, a natural small molecule compound at a concentration of 10 µM was added. A cell model with an equal volume of dimethyl sulfoxide was added as a control group. The cells were treated for 18-24 h. After lysing the cells, luciferase substrate was added and the cells were treated for 10-15 min. The luciferase signal value was detected, and natural small molecule compounds with a difference of more than 2 times from the control group were selected to obtain the initial screening compounds. The cell model was seeded into microplates and cultured for 6-8 h. After 6-8 h of adherent culture, at least four concentration gradients of natural small molecule compounds were added for 18-24 h of treatment. The treated cells were lysed, and luciferase substrate was added for 10-15 min of treatment. The luciferase signal value was detected, and natural small molecule compounds with significant dose-dependent relationships were screened to obtain the drug screening cell model targeting the formation process of coronavirus NP dimers.

[0037] The above screening method is relatively simple and can quickly screen for drugs that have a significant dose-dependent relationship with NP dimers. These drugs can target NPs, thereby causing the NP dimers in the cell model to dissociate and reduce fluorescence.

[0038] In some embodiments, the natural small molecule compound includes dihydrocyclosporin A. The applicant screened a library of natural compounds (4300 small molecule compounds) and ultimately identified that the natural small molecule compound Dihydrocyclosporin A can interact with NPs of various coronaviruses and significantly affect the formation process of NP-dimers. Prolonged treatment with Dihydrocyclosporin A can also promote the degradation of NPs via the ubiquitin-proteasome pathway.

[0039] This invention also proposes the application of a natural small molecule compound in the preparation of a coronavirus prevention and treatment drug. The natural small molecule compound is obtained through screening using a drug screening cell model targeting the coronavirus NP dimer formation process. The drug screening cell model targeting the coronavirus NP dimer formation process includes the aforementioned drug screening cell model targeting the coronavirus NP dimer formation process, or is prepared using the aforementioned method for preparing such a cell model. The natural small molecule compound includes dihydrocyclosporin A. The coronavirus prevention and treatment drug is used to prevent and treat at least one of SARS-CoV-2, HCoV-229E, and HCoV-OC43. Dihydrocyclosporin A can inhibit the replication of these multiple coronaviruses in vitro and in vivo.

[0040] In conclusion, the strategy of using the NN-Nano model to screen NP-Dimer inhibitors is feasible, and the finally identified Dihydrocyclosporin A is also the first time that it has been found to interfere with the replication of multiple coronaviruses by interfering with NP-Dimer.

[0041] The technical solution of the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be understood that the following embodiments are only used to explain the present invention and are not intended to limit the present invention.

[0042] Example 1: Construction of the NN-Nano cell model (i.e., a cell model for screening drugs targeting the formation process of coronavirus NP dimers) Example 1 uses a three-segment Nanoluciferase system to construct a system for characterizing the interaction between two NP proteins.

[0043] (1) The Nanoluciferase (Nluc) nucleic acid sequence was amplified from the pcDNA3.1-Nluc plasmid (catalog number: #180501) purchased from Addgene. The pCMV3-NP-HA plasmid (catalog number: VG40588-CY) was purchased from Sinocare and the NP sequence (as shown in SEQ ID NO.1) was amplified. The pCMV3-NP-HA plasmid (catalog number: VG40588-CY) was constructed into the Lenti-CRISPRv2-neo plasmid vector (company: Addgene, catalog number: Plasmid #98292), and the Cas9 sequence was replaced to finally construct the Lenti-NP-neo plasmid.

[0044] SEQ ID NO.1 (NP sequence):

[0045] (2) Primers were designed to amplify the n8 and c10 mutant sequences from the pcDNA3.1-Nluc plasmid. The n8 mutant sequence was ligated to the N-terminus or C-terminus of the NP in a lenti-NP-neo vector using a (GS+9×G4S) linker, and the c10 mutant sequence was ligated to the N-terminus or C-terminus of the NP in a lenti-NP-neo vector using a (GS+9×G4S) linker, thus constructing four plasmids: lenti-n8-NP-neo, lenti-NP-n8-neo, lenti-NP-c10-neo, and lenti-c10-NP-neo. The sequences of the n8 mutant sequence, the c10 mutant sequence, and the GS+(GS+9×G4S) linker are shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively.

[0046] SEQ ID NO.2: CTGTTCCGAGTAACCATCAACAGC; SEQ ID NO.3: GTGAGCGGCTGGCGGCTGTTCAAGAAGATTAGC; SEQ ID NO.4: GGATCAGGCGGTGGCGGTTCAGGAGGTGGTGGCTCAGGCGGAGGAGGTTCCGGTGGCGGCGGCAGTGGTGGTGGAGGCTCTGGTGGTGGAGGCTCTGGAGGCGGAGGTTCAGGAGGTGGTGGATCTGGAGGAGGTGGATCT.

[0047] (3) The nano1-7 sequence shown in SEQ ID NO.5 was amplified from the pcDNA3.1-Nluc plasmid and replaced the Cas9 sequence in the lenti-Cas9-blast vector (company: Addgene, catalog number: #52962) to form the lenti-nano1-7-blast plasmid, wherein the expression cassette nano1-7-blast sequence is the sequence shown in SEQ ID NO.6.

[0048] SEQ ID NO.5: ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTG; SEQ ID NO.6: ATGGTCTTCACACTCGAAGATTTCGTTGGGGACTGGCGACAGACAGCCGGCTACAACCTGGACCAAGTCCTTGAACAGGGAGGTGTGTCCAGTTTGTTTCAGAATCTCGGGGTGTCCGTAACTCCGATCCAAAGGATTGTCCTGAGCGGTGAAAATGGGCTGAAGATCGACATCCATGTCATCATCCCGTATGAAGGTCTGAGCGGCGACCAAATGGGCCAGATCGAAAAAATTTTTAAGGTGGTGTACCCTGTGGATGATCATCACTTTAAGGTGATCCTGCACTATGGCACACTGGTAATCGACGGGGTTACGCCGAACATGATCGACTATTTCGGACGGCCGTATGAAGGCATCGCCGTGTTCGACGGCAAAAAGATCACTGTAACAGGGACCCTGTGGAACGGCAACAAAATTATCGACGAGCGCCTGATCAACCCCGACGGCTCCCTGGGATCCGGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGATGGCCAAGCCTTTGTCTCAAGAAGAATCCACCCTCATTGAAAGAGCAACGGCTACAATCAACAGCATCCCCATCTCTGAAGACTACAGCGTCGCCAGCGCAGCTCTCTCTAGCGACGGCCGCATCTTCACTGGTGTCAATGTATATCATTTTACTGGGGGACCTTGTGCAGAACTCGTGGTGCTGGGCACTGCTGCTGCTGCGGCAGCTGGCAACCTGACTTGTATCGTCGCGATCGGAAATGAGAACAGGGGCATCTTGAGCCCCTGCGGACGGTGCCGACAGGTGCTTCTCGATCTGCATCCTGGGATCAAAGCCATAGTGAAGGACAGTGATGGACAGCCGACGGCAGTTGGGATTCGTGAATTGCTGCCCTCTGGTTATGTGTGGGAGGGCTAA。

[0049] Figure 1(A) is a schematic diagram of the three segments of Nanoluciferase (also known as NanoLuc in the figure) in this embodiment. Nanoluciferase is artificially divided into one large segment and two small segments, which are named nano1-7 sequence, n8 mutant sequence and c10 mutant sequence, respectively.

[0050] Figure 1 (B) is a schematic diagram of the luciferase model targeting NP dimers in this embodiment. The n8 mutant sequence and the c10 mutant sequence are connected to the two NP monomers respectively. When the NP forms a dimer, n8 and c10 can be brought closer in space. In addition, the high affinity between n8 and nano1-7 allows the activity of Nanoluciferase to be restored.

[0051] (4) The following plasmid combination was transiently transfected into HeLa cells (ATCC, catalog number: #CBP60232M). 48 hours after transfection, luciferase activity was detected using the Nano-Glo® kit (Promega, catalog number: N1110). The combination with the highest luciferase activity recovery was selected: Combination plasmids ①: lenti-n8-NP-neo, lenti-NP-c10-neo, lenti-nano1-7-blast; Combination plasmids ②: lenti-n8-NP-neo, lenti-c10-NP-neo, lenti-nano1-7-blast; Combination plasmids ③: lenti-NP-n8-neo, lenti-NP-c10-neo, lenti-nano1-7-blast; Combination plasmids ④: lenti-NP-n8-neo, lenti-c10-NP-neo, lenti-nano1-7-blast.

[0052] Figure 1 In (C), “c10-NP+n8-NP” represents the combined plasmid ②; “c10-NP+NP-n8” represents the combined plasmid ④; “NP-c10+n8-NP” represents the combined plasmid ①; “NP-c10+NP-n8” represents the combined plasmid ③; and “Blank” represents the blank group without the combined plasmid.

[0053] like Figure 1As shown in (C), the experimental results show that when n8 is linked to the N-terminus of NP (lenti-n8-NP-neo) and c10 is linked to the C-terminus of NP (lenti-NP-c10-neo), the Nanoluciferase activity can be restored to the greatest extent. Therefore, the combined plasmid ① was selected for subsequent experiments. The expression cassette sequences of the lenti-n8-NP-neo and lenti-NP-c10-neo plasmids are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0054] SEQ ID NO.7: SEQ ID NO.8:

[0055] (5) The neo resistance gene in lenti-n8-NP-neo was replaced with the puro sequence to obtain the plasmid lenti-n8-NP-puro. The three plasmids lenti-n8-NP-puro, lenti-NP-c10-neo, and lenti-nano1-7-blast were packaged into lentiviruses in HEK293T cells and then sequentially infected HeLa cells. The open reading frame sequence of the lenti-n8-NP-puro plasmid is shown in SEQ ID NO.9.

[0056] SEQ ID NO.9:

[0057] (6) After infection, HeLa cells were sequentially screened with 2 µg / mL puromycin (for screening the puromycin resistance gene), 100 µg / mL G418 (for screening the neomycin resistance gene), and 10 µg / mL blastin (for screening the blastin resistance gene Blast). The surviving cells were then expanded and cultured to obtain the NN-Nano stable cell line, which is a drug screening cell model targeting the formation process of coronavirus NP dimers.

[0058] Example 2: Compound library screening in NN-nano cell lines (1) First round of screening: Screening of a natural small molecule compound library (containing 4300 small molecule compounds). NN-nano cells were seeded in 96-well plates. After 8 hours of adhesion, a 10 µM solution of natural small molecule compounds (as the NN-nano cell group) was added in DMSO (dimethyl sulfoxide). The control group was treated with an equal volume of DMSO. After 24 h of treatment, the cells were lysed and Nanoluciferase substrate (derived from Nano-Glo) was added. TM The Luciferase Assay kit (brand: Promega, catalog number: N1120) was used for 10 minutes. The luciferase signal value was read using a Bio-Tek multi-reader. Figure 1 As shown in (D), by comparing the luciferase signal values ​​of the NN-nano cell group and the control group, small molecule compounds with a difference of more than two times from the luciferase signal value of the control group were finally selected from the NN-nano cell group for a second round of screening.

[0059] (2) Second round of screening: dose-dependent screening. Cell preparation was the same as in the first round of screening. Six concentration gradients were set for each compound: 0 µM, 1 µM, 2 µM, 5 µM, 10 µM, and 20 µM. After treating NN-Nano cells with the compound for 24 hours, their luciferase activity was detected using the same method as in the first round of screening. Compounds with significant dose-dependent relationships were selected as candidate compounds. Here, dose-dependent relationship refers to the situation where the luciferase signal value obtained by the test shows a significant decrease as the compound concentration gradually increases.

[0060] In this embodiment, the natural small molecule compound Dihydrocyclosporin A (abbreviated as DycA) was screened. Figure 2 (A) shows the dose-dependent experimental results of the effect of Dihydrocyclosporin A on NP dimer formation, from... Figure 2As shown in (A), increasing the dose of Dihydrocyclosporin A can gradually reduce the luciferase luminescence value of NN-nano and inhibit the formation of NP dimers.

[0061] Example 3: Identification of candidate compound Dihydrocyclosporin A and investigation of its mechanism of action (1) Detection of the effect of candidate compound DycA on NP-Dimer HeLa cells were seeded in 12-well plates and transfected with NP-flag plasmid (product: Sinocare, catalog number: VG40588-NF) after adherence. Eight hours after transfection, the medium was replaced with DMEM containing 10% fetal bovine serum, and 0 µM, 2 µM, 5 µM, and 10 µM DycA were added. Cells were cultured for another 24 hours. After discarding the medium, the cells were washed with PBS, and 250 µL / well of NP-40 lysis buffer was added. The cells were lysed on a shaker at 4°C for 30-60 min. The lysate was then centrifuged at 13000 rpm for 10 min at 4°C. 150 µL of the supernatant was collected and added to an equal volume of 2×SDD sample buffer. The cells were incubated at 37°C for 5 min to prepare a semi-denatured sample. 60 µL of the supernatant was collected and added to an equal volume of 2×SDS lysis buffer. The cells were boiled at 100°C for 10 min to prepare a denatured sample. Semi-denatured samples were gelled using 2% agarose gel (1×TBE buffer), and denatured samples were gelled using standard SDS-PAGE gel. Western blot analysis was performed to detect NP dimerization ability in both samples. Results are shown below. Figure 2 As shown in (B), DycA was found to significantly inhibit the dimerization / oligomerization function of coronavirus NPs, thereby suppressing NP dimer levels.

[0062] (2) Verify the interaction between DycA and NP A. Cell thermal shift assay (CETSA) was used to assess the interaction between DycA and NP. HeLa cells were transfected with pCMV3-NP-HA plasmid. After 8 hours, the medium was replaced with fresh medium (DMEM + 10% fetal bovine serum) and cultured for 24 hours. Then, DMSO (as a control) or DycA (50 µM) was added and the cells were co-incubated for 3 hours to obtain incubated cells. The incubated cells were resuspended in phosphate-buffered saline (lysis buffer) containing 0.5% DMSO, 1 g / L sucrose, and 1×cocktail protease inhibitor. The cells were aliquoted into PCR tubes and heated in a 96-well thermal cycler at 45°C, 46°C, 47°C, 48°C, 49°C, and 50°C for 3 minutes each, followed by three freeze-thaw cycles in liquid nitrogen. The treated cells were mixed with the lysis buffer and centrifuged at 13,000 rpm for 30 minutes at 4°C. The supernatant was mixed with 2×SDS lysis buffer, boiled, and then subjected to Western blot analysis to detect the expression of soluble proteins.

[0063] Experimental results are as follows Figure 2 (C) and Figure 2 As shown in (D), compared with the DMSO group, DycA treatment altered the thermal stability of NPs, causing the Tm value of NPs to shift to the right, demonstrating that DycA can specifically interact with NPs.

[0064] B. Surface-plasmon resonance (SPR) technology was used to analyze whether DycA and NP directly bind. First, the CM5 chip (Cytiva, catalog number 29104988) was activated. The NP protein was diluted with sodium acetate and immobilized in the channels of the CM5 chip at a flow rate of 10 μL / min. The channels were then blocked with ethanolamine at a flow rate of 10 μL / min. After solvent correction, the candidate compound DycA or the positive control (NP antibody, purchased from Sinocare, catalog number Cat: 40143-R001) was diluted to several concentrations and conjugated with the NP protein from low to high concentrations through the chip at a flow rate of 30 μL / min. Finally, Biacore Insight evaluation software (Cytiva, Marborough, MA.USA) was used to evaluate the data. After subtracting the reference channel from the experimental channels, the data were globally fitted to a 1:1 Langmuir binding model to obtain the binding and dissociation constants.

[0065] Experimental results are as follows Figure 2 China (E) and Figure 2As shown in Figure (F), the SPR results of the positive control group indicate that the NP protein binds directly to the NP antibody with extremely high affinity, proving the reliability of the experimental conditions. Based on this, the SPR results of the DycA group demonstrate that DycA can bind directly to the NP protein, with an affinity of approximately 1.42 × 10⁻⁶. -6 M.

[0066] C. Predict the binding sites of DycA and NP-CTD using the AlphaFold3 artificial intelligence system.

[0067] like Figure 2 G) Figure 2 (H) and Figure 2 As shown in Figure (I), the Alphafold3 software further verified the binding sites of DycA with the CTD domains of SARS-CoV-2, HCoV-OC43, and MERS-CoV NP.

[0068] (3) Verify the effect of DycA on NP expression level pCMV3-NP-HA plasmid was transfected into HeLa cells. After 8 h, different concentrations of DycA were added for 24 h or 72 h. Before receiving the samples, the proteasome inhibitor MG132 (10 µM, TargetMol) was added and incubated for 12 h. Then, Western blot was used to detect whether the proteasome inhibitor MG132 reversed the degree of NP degradation by DycA.

[0069] In addition, pCMV3-NP-HA plasmid and His-Ubiquitin (His-Ub) plasmid (company: Addgene, catalog number: #107107) were transfected into HeLa cells, and DycA was added for 48 h after 8 h. 10 µM proteasome inhibitor MG132 was added 12 h before sample collection to reverse NP degradation caused by DycA. The effect of DycA on NP ubiquitination was detected by immunoprecipitation.

[0070] Experimental results are as follows Figure 3 As shown, by Figure 3 As shown in (A), short-term (24 h) DycA treatment does not affect NP expression levels; Figure 3 As shown in (B), prolonged (72 h) treatment with DycA can promote the degradation of NP protein; Figure 3 In (C), "Ub" refers to "Ubquitin antibody"; "IP" refers to the result of immunoprecipitation; "Input" refers to the loading control, used to prove that the initial protein amount in each experimental group is consistent; Figure 3 As shown in (C), the ubiquitination experiment proved that after long-term treatment with DycA, NP was degraded via the ubiquitin-proteasome pathway, thereby reducing the expression level of NP.

[0071] Example 4: Test of the ability of the small molecule compound DycA to inhibit SARS-CoV-2 replication (1) Detection of the effect of DycA on viral protein expression level: HeLa-ACE2 cells (brand: VITALSTAR, catalog number: hACE2-HeLa) were seeded in 24-well plates. When the cell adhesion density reached 80%-90%, they were infected with SARS-CoV-2 Wild-Type strain (MOI=0.1) and DycA of different concentrations (0 µM, 0.2 µM, 0.5 µM, 1 µM, 2 µM, 5 µM, 10 µM, 20 µM) were added and incubated together.

[0072] After 24 hours of incubation, the cells were first fixed with 4% paraformaldehyde and then subjected to immunofluorescence staining analysis. NP protein expression and distribution were detected using NP antibody. The results are as follows: Figure 4 As shown in (A), DycA can drastically reduce viral replication.

[0073] Secondly, after incubation, cell lysis was performed. After cell lysis, proteins were collected and analyzed by Western blot. The results are as follows: Figure 4 As shown in (B), DycA dose-dependently inhibits the replication level of SARS-CoV-2 viral proteins.

[0074] Furthermore, total RNA was extracted from cells after 24 hours of incubation, and the effect of DycA on viral mRNA expression was detected by real-time quantitative PCR. The 50% maximum inhibitory concentration (IC50) of viral mRNA was calculated. 50 Meanwhile, the cytotoxicity of DycA was detected using the CCK8 method, and the half-maximal cytotoxicity concentration (CMC) was calculated. 50 ), and the corresponding selection index (SI), i.e., SI = (CC 50 / IC 50 The result is as follows: Figure 4 As shown in (C), DycA can significantly inhibit SARS-CoV-2 viral replication in HeLa-ACE2, and its CC 50 =204.2 µM, IC 50 =0.44 µM, SI index of approximately 464, indicating that DycA can significantly inhibit the mRNA expression level of SARS-CoV-2, demonstrating that DycA has high antiviral efficacy.

[0075] (2) Effect of DycA on viral titer in cell supernatant: Calu3 cells (ATCC, #CBP60086M) were seeded into 12-well plates. When the cell density reached 90%, SARS-CoV-2 Wild-Type strain (MOI=2) was added. One h after inoculation, the supernatant was discarded, the cells were washed twice with PBS, and the culture medium (DMEM + 10% fetal bovine serum) containing different concentrations of DycA was replaced. The cells were cultured for another 24 h and the cell supernatant was collected for later use. Vero-E6 cells (ATCC, #CBP60972M) were seeded into 96-well plates. When the cell density reached 90%-100%, the cell supernatant was serially diluted 5-fold into 8 groups, 100 µL of each group, and added to the 96-well plates. One h after infection, the culture medium was replaced with 1.6% Carboxymethylcellulose and the cells were cultured at 37°C for another 24 h. The supernatant was discarded and the cells were washed once with PBS. After fixing with 4% paraformaldehyde for 30 min, wash twice with PBS; permeabilize with 0.1% Triton for 30 min, wash twice with PBS; incubate overnight at 4°C with Nucleocapsid-HRP antibody (company: Sinocare, catalog number: 40143-R001-H), wash three times with PBS; stain with TrueBlue Peroxidase at room temperature for 10 min, wash three times with PBS, and pat dry; photograph and count spots using ELISpot software (Bio-Tek, Cytation 7) to calculate viral titer.

[0076] Experimental results are as follows Figure 4 As shown in (D), DycA significantly inhibits viral titers in the supernatant of SARS-CoV-2 infected cells.

[0077] (3) Detection of the antiviral effect of DycA in SARS-CoV-2 infected mice: After K18-hACE2 transgenic mice were intranasally infected with SARS-CoV-2 virus, they were given intraperitoneal injections of 5 mg / kg DycA daily for 5 consecutive days. A DMSO control group was also included. The weight of the mice was recorded daily, and their condition was observed. The results are as follows: Figure 4 As shown in (E). Lung tissue from mice was collected on day six, a portion of which was fixed with 4% paraformaldehyde. Subsequent H&E staining and immunohistochemical analysis were performed, and the results are shown in Figure 1. Figure 4 As shown in Figure (G); a portion of lung tissue was ground with Trizol, and total RNA was extracted. The viral RNA level was detected by RT-qPCR. Another portion of lung tissue was homogenized with PBS, and the viral titer level was detected by FFU. The results are shown in Figure (G). Figure 4 As shown in (F).

[0078] The experimental results show that, compared with the DMSO group, the DycA group significantly alleviated the decrease in body weight of challenged mice and also reduced the viral load in the lungs of challenged mice.

[0079] Example 5: Test of the small molecule compound DycA inhibiting the replication of other human pathogenic coronaviruses To investigate the ability of the small molecule compound DycA to inhibit the replication of human low-pathogenic coronaviruses HCoV-229E and HCoV-OC43.

[0080] HeLa-ACE2 (supporting HCoV-229E virus infection) and HCT116 (brand: BHcell, catalog number: H-C056, supporting HCoV-OC43 virus infection) cells were seeded in 24-well plates. When the cell adhesion density reached 80%-90%, different concentrations (0 µM, 5 µM, 10 µM, 20 µM) of DycA were added, followed by infection with coronaviruses HCoV-229E (MOI=0.5) and HCoV-OC43 (MOI=1), respectively. After 24 hours of incubation, protein samples were collected using 2×SDS lysis buffer. The expression levels of NP proteins in HCoV-229E and HCoV-OC43 were detected by Western blot. The results are shown below. Figure 4 (H) and Figure 4 As shown in (J), Figure 4 In the (H) group, "229E-NP" refers to the NP protein of HCoV-229E. Figure 4 In the middle (J): OC43-NP is the NP protein of HCoV-OC43; on the other hand, RNA was extracted from infected cells after incubation and the effect of DycA on the RNA expression of the two viruses was detected. The results are as follows: Figure 4 China (I) and Figure 4 As shown in (K), DycA can significantly inhibit the replication of HCoV-229E and HCoV-OC43.

[0081] The experimental results show that DycA can significantly inhibit the protein and mRNA expression levels of HCoV-229E virus in HeLa-ACE2 cells, and its CC... 50 =204.2 µM, IC 50 =5.4 µM, with a therapeutic index (SI) of 37.8, indicating that DycA can effectively inhibit HCoV-229E viral replication; DycA can significantly inhibit HCoV-OC43 viral protein and mRNA expression levels in HCT116 cells, and its CC 50 =204.2 µM, IC 50=6.17 µM, with a therapeutic index (SI) of 33.09, indicating that DycA can effectively inhibit the replication of HCoV-OC43 virus. These results demonstrate that DycA can inhibit the replication of multiple human coronaviruses, suggesting that it has broad-spectrum anti-coronavirus function.

[0082] In summary, this invention provides a cell model for drug screening targeting the formation process of coronavirus NP dimers. This model utilizes a three-segment Nanoluciferase system to construct a cell model that reflects the NP-dimer formation process. This model reduces steric hindrance by fusing small tags with NPs, ensuring normal NP function. It directly targets NP dimers for screening, providing a clear target. The degree of Nano activity recovery reflects NP dimerization ability, and the detection is rapid and suitable for high-throughput drug screening platforms. The formation of NP dimers is the initial rate-limiting step in coronavirus assembly, and this invention fills the current gap in drug development strategies targeting NP-dimers.

[0083] This invention utilizes a cell model for drug screening targeting the formation of coronavirus NP dimers to identify a novel bifunctional small molecule compound, dihydrocyclosporin A. For the first time, it was discovered that Dihydrocyclosporin A, as a novel bifunctional molecule, does not affect NP protein expression with short-term treatment, but significantly interferes with NP-dimer formation by binding to the CTD domains of various coronavirus NPs. Furthermore, long-term treatment with Dihydrocyclosporin A promotes the degradation of coronavirus NPs via the ubiquitin-proteasome pathway. Moreover, Dihydrocyclosporin A significantly inhibits the replication of various coronaviruses, such as SARS-CoV-2, HCoV-229E, and HCoV-OC43, through these mechanisms, suggesting that the bifunctional molecule Dihydrocyclosporin A holds promise as a promising broad-spectrum anti-coronavirus drug candidate.

[0084] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the patent protection scope of the present invention.

Claims

1. A plasmid combination, characterized in that, The plasmid combination includes a first plasmid, a second plasmid, and a third plasmid: The first plasmid includes the lenti-n8-NP-puro plasmid, the nucleotide sequence of which is shown in SEQ ID NO.9; The second plasmid includes the lenti-NP-c10-neo plasmid, the nucleotide sequence of which is shown in SEQ ID NO.8; The third plasmid includes the Lenti-nano1-7-blast plasmid, the nucleotide sequence of which is shown in SEQ ID NO.

6.

2. A lentivirus combination, characterized in that, The lentivirus combination includes a first lentivirus, a second lentivirus, and a third lentivirus: The first lentivirus includes a first plasmid, which includes the lenti-n8-NP-puro plasmid, the nucleotide sequence of which is shown in SEQ ID NO.9; The second lentivirus includes a second plasmid, which includes the lenti-NP-c10-neo plasmid, the nucleotide sequence of which is shown in SEQ ID NO.8; The third lentivirus includes a third plasmid, which includes the Lenti-nano1-7-blast plasmid, the nucleotide sequence of which is shown in SEQ ID NO.

6.

3. A cell model for drug screening targeting the formation process of coronavirus NP dimers, characterized in that, The drug screening cell model targeting the coronavirus NP dimer formation process includes the plasmid combination as described in claim 1; or, The drug screening cell model targeting the coronavirus NP dimer formation process was obtained by infecting HeLa cells with the lentivirus combination as described in claim 2.

4. A method for preparing a drug screening cell model targeting the coronavirus NP dimer formation process as described in claim 3, characterized in that, Includes the following steps: S1. Replace the Cas9 sequence in the Lenti-CRISPRv2-neo plasmid with the nucleotide sequence of the NP protein of SARS-CoV-2 to obtain the Lenti-NP-neo plasmid. S2. The nano1-7 sequence, n8 mutant sequence, and c10 mutant sequence were amplified from the pcDNA3.1-Nluc plasmid. S3. The n8 mutant sequence is linked to the N-terminus of NP in the Lenti-NP-neo plasmid using the (GS+9×G4S) linker to obtain the lenti-n8-NP-neo plasmid; the neo resistance gene in the lenti-n8-NP-neo plasmid is replaced with the puro sequence to obtain the lenti-n8-NP-puro plasmid, which is the first plasmid. S4. The c10 mutant sequence is linked to the P-terminus of the NP in the Lenti-NP-neo plasmid through the (GS+9×G4S) linker to obtain the lenti-NP-c10-neo plasmid, which is the second plasmid. S5. Replace the Cas9 sequence in the lenti-Cas9-blast vector with the nano1-7 sequence to obtain the Lenti-nano1-7-blast plasmid, which is the third plasmid. S6. Integrate the first plasmid, the second plasmid, and the third plasmid into the genome of HeLa cells and express them to obtain the drug screening cell model targeting the coronavirus NP dimer formation process.

5. The method for preparing a drug screening cell model targeting the coronavirus NP dimer formation process as described in claim 4, characterized in that, Step S6 includes: S61. The first plasmid, the second plasmid and the third plasmid are packaged into first lentivirus, second lentivirus and third lentivirus respectively in HEK293T cells; S62. HeLa cells were infected sequentially with the first lentivirus, the second lentivirus, and the third lentivirus. The infected HeLa cells were then screened sequentially with puromycin, genimycin, and blastomycin, and then expanded to obtain the drug screening cell model targeting the formation process of coronavirus NP dimers.

6. The method for preparing a drug screening cell model targeting the coronavirus NP dimer formation process as described in claim 4, characterized in that, The n8 mutant sequence is shown in SEQ ID NO.2; The c10 mutant sequence is shown in SEQ ID NO.3; The nano1-7 sequence is shown in SEQ ID NO.

5.

7. The application of a cell model for drug screening targeting the formation process of coronavirus NP dimers in screening drugs targeting the formation process of coronavirus NP dimers, characterized in that, The drug screening cell model targeting the formation process of coronavirus NP dimers includes the drug screening cell model targeting the formation process of coronavirus NP dimers as described in claim 3, or is prepared by the method for preparing the drug screening cell model targeting the formation process of coronavirus NP dimers as described in any one of claims 4 to 6.

8. The application as described in claim 7, characterized in that, Screening for drugs that target the formation process of coronavirus NP dimers includes the following steps: The cell models were seeded into microplates and cultured for 6-8 h. After 6-8 h of adherence, a natural small molecule compound at a concentration of 10 µM was added. A cell model with an equal volume of dimethyl sulfoxide was added as a control group. The cells were treated for 18-24 h. After lysing the cells, luciferase substrate was added and the cells were treated for 10-15 min. The luciferase signal value was detected, and natural small molecule compounds with a difference of more than 2 times from the control group were selected to obtain the initial screening compounds. The cell model was seeded into microplates and cultured for 6-8 h. After 6-8 h of adherent culture, natural small molecule compounds at least four concentration gradients were added and the cells were treated for 18-24 h. After lysing the cells, luciferase substrate was added and the cells were treated for 10-15 min. The luciferase signal value was detected, and natural small molecule compounds with significant dose-dependent relationships were screened to obtain the drug targeting the formation process of coronavirus NP dimers.

9. The application as described in claim 8, characterized in that, The natural small molecule compounds include dihydrocyclosporine A.

10. The application of a natural small molecule compound in the preparation of drugs for the prevention and treatment of coronaviruses, characterized in that, The natural small molecule compound was obtained by screening a drug screening cell model targeting the formation process of coronavirus NP dimers; the drug screening cell model targeting the formation process of coronavirus NP dimers includes the drug screening cell model targeting the formation process of coronavirus NP dimers as described in claim 3, or is prepared by the method for preparing the drug screening cell model targeting the formation process of coronavirus NP dimers as described in any one of claims 4 to 6. The natural small molecule compound includes dihydrocyclosporine A; The coronavirus prevention and treatment drug is used to prevent and treat at least one of SARS-CoV-2, HCoV-229E, and HCoV-OC43.

Images