A kit of reagents for detecting or aiding in the detection of rickettsia parkeri

Abstract

This invention discloses a complete set of reagents for detecting or assisting in the detection of Rickettsia proteus. The complete set of reagents includes an ERA primer pair consisting of upstream primer F5 (SEQ ID No. 5) and downstream primer R2 (SEQ ID No. 7), and crRNA9 (SEQ ID No. 20). Experiments have shown that the ERA primer pair and crRNA9 provided by this invention can detect Rickettsia proteus, with a detection sensitivity of up to 10 copies / reaction for the Rickettsia proteus genome. This invention features low cost, convenient operation, short time consumption, high sensitivity, strong specificity, and simplicity. The entire process is carried out at 37–42℃, effectively eliminating dependence on large laboratory instruments, and has broad application prospects in the on-site diagnosis of Rickettsia proteus. This invention has significant application value.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a complete set of reagents for detecting or assisting in the detection of Rickettsia proteus. Background Technology

[0002] Rickettsia prowazekii ( Rickettsia prowazekii Rickettsia prowazekii belongs to the genus Rickettsia and is the pathogen of epidemic typhus. The term "typhus" in epidemic typhus originates from the Greek word "typhos," meaning "dim" or "blurred," describing the delirious state of consciousness experienced by patients with high fever. Rickettsia prowazekii was discovered and died by Howard Taylor Ricketts and Stanislaus von Prowazek while researching epidemic typhus, and was named in their honor. Rickettsia prowazekii multiplies within the epithelial cells of the louse's intestines and is excreted with the louse's feces, entering the human body through scratching broken skin or mucous membranes.

[0003] Clinically, epidemic typhus is characterized by acute high fever, severe headache, generalized rash, and central nervous system symptoms. The rash typically appears on days 4-7 of the illness, initially as pale red maculopapules on the trunk, which later spread to the whole body and turn into dark red petechiae. Severe cases may present with delirium, coma, and circulatory failure. Because the early symptoms of epidemic typhus are similar to those of typhus, measles, and meningitis, it is often misdiagnosed as a common febrile illness, delaying anti-infective treatment. Laboratory diagnosis of *Richard de Proteus* mainly relies on serological methods (such as the Weil-Felix test and indirect immunofluorescence detection of specific antibodies) and molecular detection (PCR targeting genes such as gltA and ompB). While serological methods are simple, they suffer from cross-reactivity, and antibodies often appear in the later stages of the illness, hindering early diagnosis. Molecular detection is sensitive and specific, but requires specialized laboratory support, making it difficult to implement in resource-scarce areas. Traditional pathogen isolation requires cell culture or animal inoculation, which is complex and carries high biosafety risks (requiring a level 3 laboratory).

[0004] CRISPR-Cas technology is a rapidly developing gene-editing technology in recent years. The CRISPR-Cas system consists of clustered, regularly interspaced short palindromic repeats (CRISPR) and their associated proteins (Cas). Originally, the CRISPR-Cas system was an adaptive immune mechanism found in prokaryotes. Currently, after a series of modifications, CRISPR-Cas technology is widely used in various life science research fields, including genome editing, gene expression regulation, gene therapy, pathogen detection, high-throughput screening of target genes, and epigenetic modification. Besides being a gene-editing tool, class II Cas proteins (such as Cas12a protein) also possess "accessory cleavage" properties and have been developed into nucleic acid detection methods to identify different types of targets, showing great potential in the field of rapid detection.

[0005] Recombinase polymerase amplification (RPA) is a novel isothermal amplification technique widely used for the molecular diagnosis of pathogenic nucleic acids. In China, due to differences in the companies developing it and the sources of the enzymes used, it is also known as recombinase-mediated isothermal amplification (RAA) or enzymatic recombinase amplification (ERA). ERA replaces the thermal cycling required for polymerase chain reaction (PCR) with three core enzymes. Unlike many other isothermal techniques, ERA eliminates the need for a heating or precise temperature control stage; the amplification reaction can be carried out within a temperature range of 25-42℃, and the reaction is usually completed within 5-15 minutes. ERA technology has been making its mark since its inception, boasting advantages such as rapid reaction (5-15 min), high specificity (primers), low-temperature operation (25-42℃), sample tolerance (relatively lenient requirements on sample type), high sensitivity (single copy), wide applicability, flexible reagent form (liquid reagents or dry powder are both acceptable), and diverse detection methods. It has been widely used in the field of nucleic acid detection. Summary of the Invention

[0006] The purpose of this invention is to detect or assist in the detection of Protochalcogenide.

[0007] This invention first protects a set of reagents for detecting or assisting in the detection of Rickettsia proteus. The set of reagents may include ERA primer pairs and crRNA9;

[0008] The ERA primer pair consists of upstream primer F5 and downstream primer R2; The upstream primer F5 can be either a1) or a2). a1) The single-stranded DNA molecule shown in SEQ ID No. 5; a2) A single-stranded DNA molecule that has undergone substitution and / or deletion and / or addition of one or more nucleotides of SEQ ID No. 5 and has the same function as SEQ ID No. 5; The downstream primer R2 can be either a3) or a4) as follows: a3) The single-stranded DNA molecule shown in SEQ ID No. 7; a4) A single-stranded DNA molecule that has undergone substitution and / or deletion and / or addition of one or more nucleotides of SEQ ID No. 7 and has the same function as SEQ ID No. 7; The crRNA9 may include, from 5' to 3', RNA fragment A and RNA fragment B for binding the Cas12a protein; RNA fragment B is identical to or inversely complementary to the target sequence portion of the ERA primer pair in the Rickettsia proterozoa genome.

[0009] The complete set of reagents may specifically consist of the ERA primer pair and the crRNA9.

[0010] Each of the above-mentioned crRNA9 segments, from 5' to 3', can be composed of RNA fragment A and RNA fragment B, respectively.

[0011] The nucleotide sequence of any of the RNA fragments described above may be as shown in SEQ ID No. 20 from position 1 to 21 starting from the 5' end.

[0012] The nucleotide sequence of any of the RNA fragments B described above may be as shown in SEQ ID No. 20 from position 22 to 43 starting from the 5' end.

[0013] The nucleotide sequence of any of the above-described crRNA9 may be as shown in SEQ ID No. 20.

[0014] The nucleotide sequence of the target sequence of any of the above-described ERA primer pairs in the Rickettsia proteoglycan genome is as shown in SEQ ID No. 1 from position 314 to 528 starting from the 5' end.

[0015] The aforementioned reagent kit for detecting Rickettsia proteus may further include an ssDNA fluorescent reporter group with a nucleotide sequence as shown in SEQ ID No. 21; one end of the ssDNA fluorescent reporter group is modified with a fluorescent group, and the other end is modified with a quenching fluorescent group. In a specific embodiment of the present invention, the fluorescent group may specifically be FAM, and the quenching fluorescent group may specifically be BHQ1.

[0016] The complete set of reagents for detecting Rickettsia proteus described above may specifically consist of the ERA primer pair described above, the crRNA9 described above, and the ssDNA fluorescent reporter group described above.

[0017] The reagent kits for detecting Proteus rickettsia described above may also include the Cas12a protein.

[0018] The complete set of reagents for detecting Rickettsia proteus described above may specifically consist of the ERA primer pair described above, the crRNA9 described above, the ssDNA fluorescent reporter group described above, and the Cas12a protein described above.

[0019] The complete set of reagents for detecting Rickettsia proteus described above may specifically consist of any of the above-described ERA primer pairs, crRNA9 and Cas12a protein described above.

[0020] This invention also protects the application of any of the aforementioned kits of reagents, which may be as follows: b1) or b2). b1) Prepare kits for detecting or assisting in the detection of Rickettsia proteus; b2) Detection or auxiliary detection of Proteus rickettsia.

[0021] Methods for detecting or assisting in the detection of whether a sample contains or is a candidate for containing Proteus rickettsia are also within the scope of protection of this invention.

[0022] The method for detecting or assisting in the detection of whether a sample contains or is a candidate for containing Rickettsia proteus, protected by this invention, may specifically be Method 1, which may include the following steps: (c1) Using the nucleic acid of the sample to be tested as a template, perform ERA amplification with any of the ERA primer pairs described above to obtain the ERA amplification product; (c2) The ERA amplification product obtained in step (c1) is cleaved by CRISPR using any of the above-described crRNA9, any of the above-described ssDNA fluorescent reporter groups and Cas12a protein to obtain the cleavage reaction product; (c3) Detect the fluorescence of the cleavage reaction product obtained in step (c2), and then make the following judgments: If fluorescence can be detected in the cleavage reaction product, the sample to be tested contains or is a candidate to contain Proteus rickettsia. If the cleavage reaction product does not show fluorescence, then the sample to be tested does not contain or the candidate does not contain Proteus rickettsia.

[0023] In step (c1), each 50 μL ERA reaction system can consist of 20 μL of solubilizer DA (a component in the basic nucleic acid amplification kit (ERA method)), 2.5 μL of 10 μM upstream primer F5 aqueous solution, 2.5 μL of 10 μM downstream primer R2 aqueous solution, 22 μL of water, 1 μL of nucleic acid from the sample to be tested, and 2 μL of activator MC (a component in the basic nucleic acid amplification kit (ERA method)).

[0024] In step (c1), the reaction conditions for ERA can be 35-41℃ (e.g., 35-37℃, 37-39℃, 39-41℃, 35℃, 37℃, 39℃, or 41℃) for 20-40 min (e.g., 20-30 min, 30-40 min, 20 min, 30 min, or 40 min). In the embodiments of the present invention, the specific reaction conditions for ERA can be 39℃ for 30 min.

[0025] In step (c1), when the nucleic acid of the sample to be tested is replaced with water or other non-Proteinian rickettsia nucleic acid, all other steps remain unchanged, and it can be used as a negative control.

[0026] In step (c2), each 20 μL CRISPR cleavage reaction system can consist of 2 μL NEBuffer™ r2.1, 1 μL Cas12a protein dilution (Cas12a protein concentration of 1 μM), 1 μL crRNA9 solution (crRNA9 concentration of 5 μM), 1 μL ssDNA fluorescent reporter (ssDNA fluorescent reporter concentration of 2.5 μM), 10 μL DEPC water, and 5 μL of the ERA amplification product obtained in step (c1). In the cleavage reaction system, the concentration of Cas12a protein is 50 nM, the concentration of crRNA9 is 250 nM, and the concentration of ssDNA fluorescent reporter is 125 nM.

[0027] In step (c2), the reaction conditions for CRISPR cutting can be 35-39℃ (e.g., 35-37℃, 37-39℃, 35℃, 37℃ or 39℃) for 10-30 min (e.g., 10-20 min, 20-30 min, 10 min, 20 min or 30 min).

[0028] In step (c3), the method for detecting the fluorescence of the cleavage reaction product obtained in step (c2) can be as follows: When performing step (c2), the fluorescence value is read every 20 seconds using the RAA-F1620 isothermal amplification fluorescence detection system, and the accumulated fluorescence value is used as the fluorescence amount. Then, the following judgment is made: if the fluorescence amount is more than twice that of the negative control, the cleavage reaction product is determined to be detectable; if the fluorescence amount of the sample to be tested is less than twice that of the negative control, the cleavage reaction product is determined to be undetectable.

[0029] The method for detecting or assisting in the detection of whether a sample contains or is a candidate for containing Rickettsia proteus, protected by this invention, can specifically be Method 2, which may include the following steps: detecting whether the nucleic acid of the sample contains a specific DNA fragment, and then making the following determination: if the nucleic acid of the sample contains a specific DNA fragment, then the sample contains or is a candidate for containing Rickettsia proteus; if the nucleic acid of the sample does not contain a specific DNA fragment, then the sample does not contain or is a candidate for not containing Rickettsia proteus. The specific DNA fragment is SEQ ID No. 1 or the nucleic acid molecule shown in SEQ ID No. 1 from position 314 to 528 starting from the 5' end.

[0030] The application of the nucleic acid molecule shown in SEQ ID No. 1 or the nucleic acid molecule shown in positions 314 to 528 from the 5' end of SEQ ID No. 1 as a target sequence for detecting Rickettsia proteus in the detection or auxiliary detection of Rickettsia proteus is also within the scope of protection of this invention.

[0031] In the above applications, if the nucleic acid of the sample to be tested contains the nucleic acid molecule shown in SEQ ID No. 1 or the nucleic acid molecule shown in positions 314 to 528 from the 5' end of SEQ ID No. 1, then the sample to be tested contains or is a candidate to contain Rickettsia proteus.

[0032] The applications of any of the above-described detection or auxiliary detection methods for Rickettsia proteus are non-disease diagnostic and therapeutic applications. Specifically, the applications and methods are intended for the preparation of Rickettsia proteus drug models or for screening therapeutic drugs for Rickettsia proteus.

[0033] The Cas12a protein mentioned above can specifically be the LbCas12a protein.

[0034] The inventors of this application obtained the *Rickettsia prowlerii*-specific gene—m9w_00075 (CP014865.1 REGION: 16695-17255)—by comparing and screening reference genome sequences of *Rickettsia prowlerii* and closely related species. Furthermore, using the nucleotide sequence of the m9w_00075 gene (shown in SEQ ID No. 1), they designed and synthesized ERA primer pairs and crRNA9 (for CRISPR cleavage). First, an ERA reaction was performed using the ERA primer pairs, followed by detection using CRISPR technology. In the CRISPR-Cas system, the Cas protein, guided by crRNA9, recognizes the target sequence and initiates "collateral cleavage" activity. Simultaneously, a fluorescent reporter molecule was added to the system, utilizing the collateral cleavage activity of the Cas protein to convert the information of the target sequence into a fluorescent signal. Experiments have demonstrated that the ERA primer pairs, crRNA9, and corresponding detection methods provided in this invention feature short detection time, high amplification efficiency, high sensitivity, and strong specificity. The detection sensitivity for *Rickettsia proteus* genome reaches 10 copies / reaction, and the sensitivity for plasmid pUC57-m9w_00075 is 1 copy / reaction. This invention is characterized by low cost, convenient operation, short time consumption, high sensitivity, strong specificity (able to distinguish it from other closely related species), and simplicity. The entire process is conducted at 37–42℃, effectively eliminating reliance on large laboratory instruments, and has broad application prospects in the field diagnosis of *Rickettsia proteus*. Attached Figure Description

[0035] Figure 1 This is the Blast alignment result of the m9w_00075 gene in Example 1.

[0036] Figure 2 The results show the screening results for the optimal crRNA for detecting Rickettsia proteus in Example 2.

[0037] Figure 3 The results show the screening of the optimal ERA primer pair for detecting Rickettsia proteus in Example 2.

[0038] Figure 4 The results show the screening of the optimal ERA primer pair for detecting Rickettsia proteus in Example 2.

[0039] Figure 5 The results of screening for the optimal ERA primer pair for detecting Rickettsia proteus in Example 2. Figure 6 This is for the detection of plasmid copy sensitivity in Example 3.

[0040] Figure 7 This is for the detection of genome copy sensitivity in Example 3.

[0041] Figure 8 This is the specific detection in Example 4. Detailed Implementation

[0042] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0044] In the following examples, LbCas12a protein is a product of Nanjing Genscript Biotech Co., Ltd., catalog number Z03753; NEBuffer™ r2.1 is a product of New England Biolabs, catalog number B6002S; DEPC water is a product of Beyotime Biotechnology Co., Ltd.; the fluorescent nucleic acid amplification kit (ERA method) is a product of Suzhou Xianda Gene Technology Co., Ltd., catalog number KS103; the basic nucleic acid amplification kit (ERA method) is a product of Suzhou Xianda Gene Technology Co., Ltd., catalog number KS101; and the RAA-F1620 isothermal amplification fluorescence detection system is a product of Jiangsu Qitian Gene Biotechnology Co., Ltd.

[0045] Example 1: Establishment of a rapid, sensitive and specific method for detecting Protozoa rickettsia. I. Obtaining the specific conserved sequence of Rickettsia proteus and synthesizing plasmid pUC57-m9w_00075 1. The inventors of this application obtained the *Rickettsia prowleri*-specific gene—m9w_00075 (CP014865.1 REGION: 16695-17255) by comparing and screening the reference genome sequences of *Rickettsia prowleri* and closely related species. The nucleotide sequence of the m9w_00075 gene is shown in SEQ ID No. 1.

[0046] SEQ ID No.1 is: TAGTTTATCGTATTCTTGAGTAAAGTAAGCTGCTACTACCTCTTCTTGATTTTTTGCCTGCTCACTTGGGTTTTGCTTTCTTTGTTCTATAGTCTGCTGGTATATTTCAGCAACCTCATTTACATAATCTTGTTG TACTCTAATTAGCATAGGCAATACTATATTTATATTAGGAGAAGTTTGCATTTGTTCTAATGTATTTTTGAGTTCATCAATACTTAATTGCTTTGTTTTATTTGAAAGTGTATATGATAAATTATATACATCTGATGTATTT GCACATCGTAGTTGATTTATACAATCATTAAGCGAACTGTTCGTATCACTCAATGAACTATGCAACAACTTTGGTAGTTCAATGCTAGAGTTTTGATGATGCTCATTACTAAACATGTCGTTAACATAAGAAGAAGGTGATA ACACCGATTTATATTTAGTTTGCTTTAATTGTGATGATAAAGATCCATCTTCTATATCTTCTAGACTTTTAGTTTTTTTAAACTGTTGTGATTCTACAAGAACTGCTGAATCTAAACTATTAATAGAATTAATTTCCTGTTT 2. After completing step 1, the inventors of this application performed a BLAST sequence alignment of the m9w_00075 gene, whose nucleotide sequence is shown in SEQ ID No. 1, in the NCBI database. The alignment results are as follows: Figure 1 As shown.

[0047] The results showed that 11 species of Rickettsia proteoglycan genome sequences exist in the NCBI database, and the m9w_00075 gene is present in all 11 species with high specificity. Using the m9w_00075 gene as a specific conserved sequence (i.e., target gene) of Rickettsia proteoglycan can specifically detect Rickettsia proteoglycan.

[0048] 3. The plasmid pUC57-m9w_00075 was synthesized by Shanghai Sangon Biotech Co., Ltd. The plasmid pUC57-m9w_00075 is a recombinant plasmid obtained by replacing a small DNA fragment between the restriction endonucleases BamHI and HindIII in the pUC57 vector (Shanghai Sangon Biotech Co., Ltd., B522201) with the m9w_00075 gene, whose nucleotide sequence is shown in SEQ ID No: 1.

[0049] II. Preparation of a complete set of reagents for detecting Protodyakonovite 1. Based on the nucleotide sequence of the m9w_00075 gene, an ERA primer pair (for amplifying the m9w_00075 gene), crRNA, and ssDNA fluorescent reporter group (a single-stranded DNA molecule) were designed for the detection of Rickettsia proteus. The ERA primer pair consists of an upstream primer and a downstream primer. The design principles are as follows: (1) The length of the upstream and downstream primers is between 30-40 bp, and the length of the amplification product is between 100-500 bp to achieve the best amplification efficiency; (2) The length of the crRNA is between 30-60 bp, and it consists of an anchor sequence and a guide sequence for binding Cas12a protein. The guide sequence matches the amplification product sequence of the ERA primer pair.

[0050] Based on the above design principles, the nucleotide sequences of the designed upstream primer (names containing "upstream primer" in Table 1), downstream primer (names containing "downstream primer" in Table 1), crRNA (names containing "crRNA" in Table 1), and ssDNA fluorescent reporter group are shown in Table 1.

[0051] Table 1

[0052] Note: In crRNA, the single underlined portion is the guide sequence, which matches the amplification product sequence of the ERA primer pair; the double underlined portion is the anchoring sequence, used to bind to the Cas12a protein. In probe P1, i6FAMdT adds a 6-FAM fluorescent group to the 32nd T base from the 5' end of probe P1, idSp is a single-base vacancy, and iBHQ1dT adds a BHQ1 quenching fluorescent group to the 15th T base from the 3' end of probe P1. In the ssDNA fluorescent reporter, 6-FAM adds a 6-FAM fluorescent group to the 5' end of the ssDNA fluorescent reporter, and BHQ1 adds a BHQ1 quenching fluorescent group to the 3' end of the ssDNA fluorescent reporter.

[0053] The upstream primers F1, F2, F4, F5, R1, R2, R3, R4, probe P1, crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8, crRNA9 and ssDNA fluorescent reporter group listed in Table 1 were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0054] 2. Preparation of a complete set of reagents for detecting Prototype rickettsia The complete reagent kit for detecting Rickettsia proteus consists of ERA primer pairs, crRNA, and ssDNA fluorescent reporter groups. The ERA primer pairs consist of an upstream primer (upstream primer F1, upstream primer F2, upstream primer F4, or upstream primer F5) and a downstream primer (downstream primer R1, downstream primer R2, downstream primer R3, or downstream primer R4). The crRNA is crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8, or crRNA9.

[0055] In the complete reagent kit for detecting Rickettsia proteus, the upstream primer, downstream primer, crRNA, and ssDNA fluorescent reporter groups are packaged separately.

[0056] III. Establishment of a method for detecting Protozoa The inventors of this application have established a method for detecting Prototype rickettsia through extensive experimentation. The specific steps are as follows: 1. ERA amplification (1) Prepare the ERA reaction premix. The ERA reaction premix is ​​47 μL and consists of 20 μL of solvent DA (a component in the basic nucleic acid amplification kit (ERA method)), 2.5 μL of 10 μM upstream primer aqueous solution, 2.5 μL of 10 μM downstream primer aqueous solution and 22 μL of water.

[0057] (2) Add 47 μL of ERA reaction premix to each reaction unit of the basic nucleic acid amplification kit (ERA method) and dissolve it evenly. Then add 1 μL of nucleic acid of the sample to be tested, and then add 2 μL of activator MC (a component in the basic nucleic acid amplification kit (ERA method)) into the tube cap and mix well. Then react at 39°C for 30 min to obtain ERA amplification product.

[0058] Following the steps described above, replace the nucleic acid in the sample to be tested with water, keeping all other steps unchanged, as a negative control.

[0059] Following the steps above, replace the nucleic acid in the sample to be tested with plasmid pUC57-m9w_00075, keeping all other steps unchanged, as a positive control.

[0060] 2. CRISPR cutting (1) Preparation of the cleavage reaction system. The cleavage reaction system consisted of 20 μL of NEBuffer™ r2.1, 1 μL of LbCas12a protein dilution buffer (LbCas12a protein concentration was 1 μM), 1 μL of crRNA solution (crRNA concentration was 5 μM), 1 μL of ssDNA fluorescent reporter group (ssDNA fluorescent reporter group concentration was 2.5 μM), 10 μL of DEPC water, and 5 μL of the ERA amplification product obtained in step 1. In the cleavage reaction system, the concentration of LbCas12a protein was 50 nM, the concentration of crRNA was 250 nM, and the concentration of ssDNA fluorescent reporter group was 125 nM.

[0061] (2) The cleavage reaction system prepared in step (1) was placed in the RAA-F1620 isothermal amplification fluorescence detection system and incubated at 37°C for 20 minutes to carry out the cleavage reaction and obtain the cleavage reaction product.

[0062] 3. Fluorescence detection During step 2 (2), the RAA-F1620 isothermal amplification fluorescence detection system reads fluorescence values ​​every 20 seconds, and the accumulated fluorescence value is taken as the fluorescence amount. The following criteria are then used for determination: If the fluorescence intensity of the test sample is more than twice that of the negative control, then the test sample contains or is a candidate for containing Rickettsia proteus. If the fluorescence intensity of the test sample is less than twice that of the negative control, then the test sample does not contain or is a candidate sample that does not contain Rickettsia proteus.

[0063] Optimization of the methods established in Example 2 and Example 1 I. Screening for the optimal crRNA for detecting Rickettsia proteus A. Experimental Group 1. Preparation of the cleavage reaction system. The cleavage reaction system consists of 20 μL of NEBuffer™ r2.1, 1 μL of LbCas12a protein dilution buffer (LbCas12a protein concentration is 1 μM), 1 μL of crRNA solution (crRNA concentration is 5 μM), 1 μL of ssDNA fluorescent reporter group solution (ssDNA fluorescent reporter group concentration is 2.5 μM), 14 μL of DEPC water, and 1 μL of plasmid pUC57-m9w_00075 aqueous solution (concentration is 40 nM). In the cleavage reaction system, the concentration of LbCas12a protein is 50 nM, the concentration of crRNA is 250 nM, and the concentration of ssDNA fluorescent reporter group is 125 nM.

[0064] crRNA can be crRNA1, crRNA2, crRNA3, crRNA4, crRNA5, crRNA6, crRNA7, crRNA8, or crRNA9.

[0065] 2. Place the cleavage reaction system prepared in step 1 into the RAA-F1620 isothermal amplification fluorescence detection system and incubate at 37°C for 40 minutes to carry out the cleavage reaction, and detect the fluorescence value in real time.

[0066] B. Negative control group Following the steps described above, replace the aqueous solution of plasmid pUC57-m9w_00075 with DEPC water, keeping all other steps unchanged, as a negative control group.

[0067] Test results are shown Figure 2 (m9w_00075 represents plasmid pUC57-m9w_00075, i.e., the experimental group; DEPC water represents the negative control group). The results showed that crRNA9 was the optimal receptor for plasmid pUC57-m9w_00075, and the experimental group and negative control group exhibited the highest fluorescence curve slope ratio. Therefore, crRNA9 was subsequently selected as the optimal crRNA for detecting Rickettsia proteus.

[0068] II. Screening of the optimal ERA primer pairs for detecting Rickettsia proteus 1. Dilute plasmid pUC57-m9w_00075 with water to obtain a plasmid dilution solution with a concentration of 1000 copies / μL.

[0069] 2. Prepare the ERA reaction premix. The ERA reaction premix is ​​47 μL and consists of 20 μL of solvent DA (a component in the fluorescent nucleic acid amplification kit (ERA method)), 2.1 μL of 10 μM upstream primer aqueous solution, 2.1 μL of 10 μM downstream primer aqueous solution, 0.6 μL of probe P1 solution (probe P1 concentration is 10 μM) and 22.2 μL of water.

[0070] The purpose of adding probe P1 is to bind to a fragment of the m9w_00075 gene and emit fluorescence to indicate the amplification status of the m9w_00075 gene.

[0071] 3. Add 47 μL of ERA reaction premix to each basic reaction unit of the fluorescent nucleic acid amplification kit (ERA method) and dissolve it evenly. Then add 1 μL of plasmid dilution buffer, and add 2 μL of activator MC (a component of the fluorescent nucleic acid amplification kit (ERA method)) to the tube cap. Place the tube in a RAA-B6100 isothermal shaker and press the preprocessing button to perform pre-amplification. After the instrument beeps, remove the reaction tube and place it in the RAA-F1620 isothermal amplification fluorescence detection system. React at 39℃ for 20 min and detect fluorescence in real time.

[0072] Following the steps described above, replace the plasmid dilution buffer with water, keeping all other steps unchanged, as a negative control.

[0073] A fluorescence curve was plotted with reaction time on the x-axis and fluorescence value on the y-axis. Some detection results are shown below. Figure 3 , Figure 4 and Figure 5 (F1 is upstream primer F1, F2 is upstream primer F2, F4 is upstream primer F4, F5 is upstream primer F5, R1 is downstream primer R1, R2 is downstream primer R2, R3 is downstream primer R3, R4 is downstream primer R4, NC is the negative control). The results showed that the ERA primer pair composed of upstream primer F5 and downstream primer R2 began to show fluorescence after approximately 10 minutes of ERA amplification, significantly outperforming other primer pairs. Therefore, the ERA primer pair composed of upstream primer F5 and downstream primer R2 was subsequently selected as the optimal primer pair for detecting Rickettsia proteus.

[0074] III. Based on the above experimental results, the specific steps of the method for detecting Prototype rickettsia established in this application are as follows: 1. ERA amplification (1) Prepare the ERA reaction premix. The ERA reaction premix is ​​47 μL and consists of 20 μL of solvent DA (a component in the basic nucleic acid amplification kit (ERA method)), 2.5 μL of 10 μM upstream primer F5 aqueous solution, 2.5 μL of 10 μM downstream primer R2 aqueous solution and 22 μL of water.

[0075] (2) Add 47 μL of ERA reaction premix to each reaction unit of the basic nucleic acid amplification kit (ERA method) and dissolve it evenly. Then add 1 μL of nucleic acid of the sample to be tested, and then add 2 μL of activator MC (a component in the basic nucleic acid amplification kit (ERA method)) into the tube cap and mix well. Then react at 39°C for 30 min to obtain ERA amplification product.

[0076] Following the steps described above, replace the nucleic acid in the sample to be tested with water, keeping all other steps unchanged, as a negative control.

[0077] Following the steps above, replace the nucleic acid in the sample to be tested with plasmid pUC57-m9w_00075, keeping all other steps unchanged, as a positive control.

[0078] 2. CRISPR cutting (1) Preparation of the cleavage reaction system. The cleavage reaction system consisted of 20 μL of NEBuffer™ r2.1, 1 μL of LbCas12a protein dilution buffer (LbCas12a protein concentration was 1 μM), 1 μL of crRNA9 solution (crRNA9 concentration was 5 μM), 1 μL of ssDNA fluorescent reporter group (ssDNA fluorescent reporter group concentration was 2.5 μM), 10 μL of DEPC water, and 5 μL of the ERA amplification product obtained in step 1. In the cleavage reaction system, the concentration of LbCas12a protein was 50 nM, the concentration of crRNA9 was 250 nM, and the concentration of ssDNA fluorescent reporter group was 125 nM.

[0079] (2) The cleavage reaction system prepared in step (1) was placed in the RAA-F1620 isothermal amplification fluorescence detection system and incubated at 37°C for 20 minutes to carry out the cleavage reaction and obtain the cleavage reaction product.

[0080] 3. Fluorescence detection In step 2 (2), the fluorescence value was read every 20 seconds using the RAA-F1620 isothermal amplification fluorescence detection system, and the accumulated fluorescence value was used as the fluorescence amount. The following criteria were then used for determination: If the fluorescence intensity of the test sample is more than twice that of the negative control, then the test sample contains or is a candidate for containing Rickettsia proteus. If the fluorescence intensity of the test sample is less than twice that of the negative control, then the test sample does not contain or is a candidate sample that does not contain Rickettsia proteus.

[0081] Sensitivity detection of the methods for detecting Protochalcogenides established in Example 3 and Example 2 I. Plasmid Copy Sensitivity 1. Plasmid pUC57-m9w_00075 was serially diluted 10-fold with water to obtain concentrations of 10... 3 Plasmid dilution buffer 1 at a concentration of 10 copies / μL 2 Plasmid dilution 2 with a concentration of 10 copies / μL, plasmid dilution 3 with a concentration of 10 copies / μL, and plasmid dilution 4 with a concentration of 1 copy / μL.

[0082] 2. Following the method in step three of Example 2, replace 1 μL of nucleic acid in the sample to be tested with 1 μL of plasmid diluent 1 (total 10 μL). 3 1 copy), 1 μL plasmid dilution buffer 2 (total 10) 2 1 μL plasmid dilution buffer 3 (total 10 copies), 1 μL plasmid dilution buffer 4 (total 1 copy) or water (as a negative control), with all other steps remaining unchanged.

[0083] A fluorescence curve was plotted with reaction time on the x-axis and fluorescence value on the y-axis. The detection results are shown below. Figure 6 (Negative is negative control, 1 is 1 copy, 10 is 10 copies, 10) 2 10 2 Copy, 10 3 10 3 (Copy). The results showed that the reagent kit consisting of upstream primer F5, downstream primer R2, crRNA9, and ssDNA fluorescent reporter group had a sensitivity of 1 copy / reaction for detecting plasmid pUC57-m9w_00075.

[0084] II. Genome Copy Sensitivity 1. The Rickettsia proterenella genome was serially diluted 10-fold with water to obtain concentrations of 10... 3 Plasmid dilution buffer 1 at a concentration of 10 copies / μL 2 Plasmid dilution 2 with a concentration of 10 copies / μL, plasmid dilution 3 with a concentration of 10 copies / μL, and plasmid dilution 4 with a concentration of 1 copy / μL.

[0085] 2. Following the method in step three of Example 2, replace 1 μL of nucleic acid in the sample to be tested with 1 μL of genomic diluent 1 (total 10 μL). 3 1 copy), 1 μL genome dilution buffer 1 (total 10) 2 1 μL of genomic diluent 2 (total 10 copies), 1 μL of genomic diluent 3 (total 1 copy), or water (as a negative control), with all other steps remaining unchanged.

[0086] A fluorescence curve was plotted with reaction time on the x-axis and fluorescence value on the y-axis. The detection results are shown below. Figure 7 (Negative is negative control, 1 is 1 copy, 10 is 10 copies, 10) 2 10 2 Copy, 10 3 10 3 (Copies). The results showed that the reagent kit consisting of upstream primer F5, downstream primer R2, crRNA9, and ssDNA fluorescent reporter group had a sensitivity of 10 copies / reaction for detecting the Rickettsia proteus genome.

[0087] Specificity of the detection method for Rickettsia protozoa established in Example 4 and Example 2 Coxiella burnetii is described in the following literature: Jiao J, Xiong X, Qi Y, Gong W, Duan C, Yang X, Wen B. Serological characterization of surface-exposed proteins of Coxiella burnetii. Microbiology. 2014 Dec; 160 (Pt12): 2718-31. In the literature, it is named coxiella burnetii Xinqiao strain.

[0088] Orientia tsutsugamushi (Karp strain) is described in the following literature: Real-time quantitative PCR detection of Orientia tsutsugamushi, Chinese Journal of Epidemiology, 2006, 22(3), 228-231. Rickettsia rickettsii (Sheila Smith strain) is described in the following literature: Ellison DW, Clark TR, Sturdevant DE, et al. Genomic comparison of virulent Rickettsia rickettsii Sheila Smith and avirulent Rickettsia rickettsii Iowa. Infect Immun. 76(2):542-50, 2008. The name of Rickettsia rickettsii (Sheila Smith strain) in the literature is Sheila Smith. Rickettsia rickettsii will be abbreviated as Rickettsia rickettsii in the following text.

[0089] Rickettsia heilongjiangensis (HLJ-054) and Rickettsia siberianis (246 strains) are described in the following literature: Establishment of a method for detecting spotted rickettsia by real-time quantitative PCR, Journal of PLA Medical Journal, Vol. 33, No. 11, 1297-1299, 2008. Rickettsia proteus is described in the following literature: Jia Xiaolin, Wang Dongshu, Gao Zhiqi, et al. Functional study of PlcR in Bacillus anthracis A16R [J]. Heredity, 2015, 37(05):494-498. Rickettsia proteus is referred to as Bacillus anthracis A16R in the literature.

[0090] Following the method in step three of Example 2, the nucleic acid of the sample to be tested is replaced with the nucleic acid of Rickettsia proteus, Coxiella belladonna, Orientia scrub typhus, Rickettsia rickettsia, Rickettsia heilongjiangensis, or Rickettsia siberianis, while the other steps remain unchanged.

[0091] Following the method in step three of Example 2, the nucleic acid of the sample to be tested was replaced with water, while all other steps remained unchanged, serving as a negative control.

[0092] Following the method in step three of Example 2, the nucleic acid of the sample to be tested was replaced with plasmid pUC57-m9w_00075, while all other steps remained unchanged, serving as a positive control.

[0093] A fluorescence curve was plotted with reaction time on the x-axis and fluorescence value on the y-axis. The detection results are shown below. Figure 8 (NC is the negative control, and m9w_00075 is the positive control). The detection results show that the method provided by this invention has good specificity, and can only detect Rickettsia proteus and plasmid pUC57-m9w_00075. There is no cross-reactivity with Coxiella belladonna, Orientia scrub typhus, Rickettsia rickettsia, Rickettsia heilongjiangensis, and Rickettsia siberianis.

[0094] Therefore, the reagent kit consisting of upstream primer F5, downstream primer R2, crRNA9, and ssDNA fluorescent reporter group has high specificity for Rickettsia proteus.

[0095] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A complete set of reagents for detecting Rickettsia proteus, including ERA primer pairs and crRNA9; The ERA primer pair consists of upstream primer F5 and downstream primer R2; The upstream primer F5 is either a1) or a2) as follows: a1) The single-stranded DNA molecule shown in SEQ ID No. 5; a2) A single-stranded DNA molecule of SEQ ID No. 5 with one or more nucleotide substitutions and / or deletions and / or additions that has the same function as SEQ ID No. 6; The downstream primer R2 is either a3) or a4) as follows: a3) The single-stranded DNA molecule shown in SEQ ID No. 7; a4) A single-stranded DNA molecule of SEQ ID No. 7 that has undergone substitution and / or deletion and / or addition of one or more nucleotides and has the same function as SEQ ID No. 7; The crRNA9 comprises, from 5' to 3', RNA fragment A and RNA fragment B for binding the Cas12a protein; RNA fragment B is identical to or inversely complementary to the target sequence portion of the ERA primer pair in the Rickettsia proterozoa genome.

2. The complete set of reagents according to claim 1, characterized in that: The nucleotide sequence of the RNA fragment A is shown in SEQ ID No. 20 from position 1 to 21 starting from the 5' end.

3. The complete set of reagents according to claim 1, characterized in that: The nucleotide sequence of the target sequence of the ERA primer pair in the Rickettsia proteoglycan genome is shown in SEQ ID No. 1 from position 314 to 528 starting from the 5' end.

4. The complete set of reagents according to claim 1, characterized in that: The nucleotide sequence of RNA fragment B is shown in SEQ ID No. 23 from position 22 to 43 starting from the 5' end.

5. The complete set of reagents according to claim 1, characterized in that: The complete set of reagents for detecting Proteus rickettsia also includes an ssDNA fluorescent reporter group with a nucleotide sequence as shown in SEQ ID No. 21; one end of the ssDNA fluorescent reporter group is modified with a fluorescent group, and the other end is modified with a quenching fluorescent group.

6. The complete set of reagents according to claim 1, characterized in that: The complete set of reagents for detecting Protozoa also includes the Cas12a protein.

7. The application of the complete set of reagents according to any one of claims 1 to 6 is as follows: b1) or b2). b1) Prepare kits for detecting or assisting in the detection of Rickettsia proteus; b2) Detection or auxiliary detection of Proteus rickettsia.

8. A method for detecting or assisting in the detection of whether a sample contains or is a candidate for containing Rickettsia proteoglyptae, comprising the following steps: (c1) Using the nucleic acid of the sample to be tested as a template, ERA is performed using the ERA primer pair described in claim 1 or 3 to obtain the ERA amplification product; (c2) The ERA amplification product obtained in step (c1) is cleaved by CRISPR using any of the crRNA9 described in claims 1 to 4, the ssDNA fluorescent reporter group described in claim 5, and the Cas12a protein to obtain the cleavage reaction product; (c3) Detect the fluorescence of the cleavage reaction product obtained in step (c2), and then make the following judgments: If fluorescence can be detected in the cleavage reaction product, the sample to be tested contains or is a candidate to contain Proteus rickettsia. If fluorescence is not detected in the cleavage reaction product, the sample to be tested does not contain or the candidate does not contain Proteus rickettsia.

9. A method for detecting or assisting in the detection of whether a sample contains or is candidate for containing Rickettsia proteus, comprising the following steps: detecting whether the nucleic acid of the sample contains a specific DNA fragment, and then making the following determination: If the nucleic acid of the sample to be tested contains a specific DNA fragment, then the sample to be tested contains or is a candidate to contain Rickettsia proteus. If the nucleic acid of the sample to be tested does not contain a specific DNA fragment, then the sample to be tested does not contain or is a candidate sample that does not contain Rickettsia proteus. The specific DNA fragment is SEQ ID No. 1 or the nucleic acid molecule shown in SEQ ID No. 1 from position 314 to 528 starting from the 5' end.

10. The application of the nucleic acid molecule shown in SEQ ID No. 1 or the nucleic acid molecule shown in positions 314 to 528 from the 5' end of SEQ ID No. 1 as a target sequence for detecting Rickettsia proteus in the detection or auxiliary detection of Rickettsia proteus.

Images