A novel method for modulating expression of endogenous genes in somatic cells

By stably expressing CRISPR enzymes in iPSCs and introducing guide RNA after differentiation, the problem of uncontrollable gene expression in human cells has been solved, achieving stable and controllable gene regulation in somatic cells, which is suitable for large-scale applications.

CN122249554APending Publication Date: 2026-06-19BIO BIT LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BIO BIT LTD
Filing Date
2024-10-10
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Controllable transcription or expression of genetic information in human cells is very difficult, especially when regulating the expression of transgenes in human cells. Existing methods are unable to achieve stable transcription and resist the negative effects of silencing and integration sites, and it is difficult to regulate the transcription of inserted genetic material at a specific level.

Method used

Gene editing of pluripotent stem cells was performed using the CRISPR/Cas system. By stably expressing CRISPR enzymes or their derivatives in iPSCs and introducing guide RNA after differentiation into somatic cells, precise genome editing was performed using genomic safe harbor sites to ensure the regulation of endogenous gene expression in post-differentiation somatic cells.

Benefits of technology

It achieves stable and controllable gene expression in human cells, avoids the negative effects of silencing and integration sites, and can regulate the transcription of endogenous genes at specific levels, making it suitable for large-scale applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122249554A_ABST
    Figure CN122249554A_ABST
Patent Text Reader

Abstract

This invention relates to a method for regulating the expression of endogenous genes in somatic cells derived from induced pluripotent stem cells (iPSCs), comprising differentiating engineered iPSCs capable of stably expressing or induced to express CRISPR-related proteins into somatic cells prior to the introduction of a guide RNA (gRNA) sequence. The invention also relates to engineered iPSCs, cells obtained by this method, and their uses.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Invention Field

[0002] This invention relates to methods for regulating the expression of endogenous genes in somatic cells derived from induced pluripotent stem cells (iPSCs) and to iPSC cell lines used in such methods. Specifically, this invention relates to differentiation methods in which guide RNAs involved in regulating target genes are introduced only when the cells are no longer pluripotent. Background Technology

[0003] Stem cell research offers great promise for research in human development, regenerative medicine, disease modeling, drug discovery, and cell transplantation. Furthermore, stem cell-derived cells enable the study of physiological and pathological responses in human cell populations that are not readily available. This often requires the study of genes (and other forms of regulatory mechanisms encoded in non-protein-coding RNA). Unfortunately, the controlled transcription or expression of genetic information in human cells has proven particularly difficult.

[0004] Furthermore, the manipulation and preparation of readily available mature human cell types are essential for several key aspects of regenerative medicine, disease modeling, drug discovery, and cell transplantation. Regulating the expression of transgenes in human cells is fundamental to biological research; however, this has proven challenging in human cells. Moreover, there is an urgent need to prepare large quantities and high-quality specific human cell types in vitro to meet the application needs of drug development and regenerative medicine. Because the directed differentiation of stem cells into desired cell types is often challenging, other methods have emerged, including directly reprogramming cells into the desired cell types. In particular, forward programming, as a method for directly converting pluripotent stem cells into mature cell types, has been considered a powerful human cell-derived strategy. This reprogramming involves the forced expression of key lineage transcription factors, thereby converting stem cells into specific mature cell types.

[0005] Any improvements to the above methods must ensure stable transcription of genetic material, such as transgenes, contained within the inducible cassette, resistant to silencing and other negative effects associated with the integration site. Silencing can be caused by a variety of epigenetic mechanisms, including DNA methylation or histone modifications. For many applications, it is also desirable to regulate the transcription of the inserted genetic material in the cell so that the inducible cassette can be opened as needed and transcribed at specific levels, including high levels.

[0006] WO2018096343 describes a dual-genome safe harbor targeting system. It includes a method for introducing an inducible cassette into a cell and allowing regulated transcription from within the inducible cassette using a system that divides through two genomic safe harbor sites.

[0007] The inventors have developed a method that enables stable reprogramming of pluripotent stem cells while simultaneously optimizing gene editing in somatic cells using a CRISPR / Cas system. This method is advantageous because it can specifically reveal the genetic perturbation phenotype in mature cells. Summary of the Invention

[0008] According to a first aspect of the present invention, a method for regulating the expression of endogenous genes in somatic cells derived from induced pluripotent stem cells (iPSCs) is provided, comprising the following steps: (i) Provides an engineered iPSC capable of stably expressing or inducing the expression of a CRISPR enzyme, a non-catalytically active CRISPR enzyme or a derivative thereof; (ii) Inducing engineered iPSCs to differentiate into somatic cells; and (iii) Introducing a guide RNA (gRNA) sequence into the somatic cells obtained in step (ii), wherein the gRNA sequence is complementary to the endogenous gene. This regulates the expression of endogenous genes in differentiated somatic cells.

[0009] According to another aspect of the invention, a cell having a modified genome is provided, the modified genome comprising: (i) The inserted genetic sequence encoding a transcriptional regulatory protein at the first genomic safe harbor (GSH) site; (ii) an inserted inducible cassette containing a genetic sequence operatively linked to an inducible promoter at a second GSH site, wherein the inducible promoter is regulated by a transcriptional regulatory protein; and (iii) An inserted genetic sequence operatively linked to a promoter, which encodes a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof; The first and second GSH sites are different, and The genetic sequence encoding the CRISPR enzyme, the non-catalytically active CRISPR enzyme, or a derivative thereof is inserted at a site different from the first GSH site and the second GSH site.

[0010] According to another aspect of the invention, an engineered iPSC is provided comprising a genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof, the genetic sequence being operatively linked to a promoter and optionally a reporter gene and a self-cleaving peptide, wherein the genetic sequence is inserted at a GSH site, and wherein the GSH site does not contain any other exogenous coding sequence.

[0011] According to other aspects of the invention, a cell obtained by the method defined herein is provided.

[0012] According to other aspects of the invention, cells as defined herein are provided for use in therapy, in vitro diagnostics, or screening (e.g., drug screening, drug target identification, drug target validation, or functional genomics screening). Attached Figure Description

[0013] Figure 1 Cell line engineering strategies for Cas9 insertion. CAG knock-in drives rtTA into the ROSA26 locus, doxycycline-induced NEUROG2 (NGN2) expression cassette into the AAVS1 locus, and CAG-driven Cas9-2A-mCherry cassette into the CLYBL locus.

[0014] Figure 2 Flow cytometry analysis demonstrating Cas9 activity in engineered iPSCs via B2M knockout. The figure shows unstained and untransduced controls (left), stained and untransduced controls (middle), and stained and transduced samples (right).

[0015] Figure 3 Comparison of immunofluorescence staining of glutamatergic neurons and CRISPR-Ready glutamatergic neurons. The top image shows the staining distribution of MAP2 and TUBB3, highlighting dendritic structures and neuronal differentiation, respectively. The bottom image shows the staining characteristics of MAP2 and VGLUT2, demonstrating the identification of dendritic structures and glutamatergic neurons, respectively.

[0016] Figure 4 Principal component analysis revealed temporal transcriptomic differences between glutamatergic neurons and CRISPR-ready glutamatergic neurons. The figure shows the transcriptomic profiles of the two cell lines at different time points: iPSC stage, day 4 after cryopreservation, and day 18. Circles represent "glutamatergic neurons," while triangles represent "glutamatergic neurons CRISPR-ready." Changes in localization in the figure highlight the transcriptional differences and similarities between the two cell lines at the selected time points.

[0017] Figure 5 Western blot analysis of Cas9 expression over time in CRISPR-Ready glutamatergic neurons. The blots demonstrated the temporal dynamics of Cas9 protein levels at specified time points: day 3, day 1, day 4 (if cells were cryopreserved), and day 6 (if cells were cryopreserved). The observed decrease in Cas9 band intensity indicates a reduction in Cas9 expression in CRISPR-Ready glutamatergic neurons with increasing culture time. β-actin was used as a loading control to ensure consistency of loading protein between samples.

[0018] Figure 6Amplicon sequencing analysis of indel formation in the SOX11 gene. This figure shows the percentage of indel formation within the target region of the SOX11 gene. Two methods were used to deliver the guide RNA: the lipid-based method RNAiMAX and lentivirus. Indel formation results were compared between guide delivery on day 1 and day 3, with cells analyzed 5 days after guide delivery. A non-targeted guide was used as a control to provide a comparative baseline for the efficiency of targeted modification.

[0019] Figure 7 Immunofluorescence staining analysis of SOX11 expression after lipid-based guide RNA delivery. Images of SOX11 immunofluorescence staining after delivery of guide RNA using the RNAiMAX lipid-based method. SOX11 expression levels were compared on days 1 and 3 after delivery guidance, with cell analysis performed on day 11 of forward programming. DAPI staining provided visualization of the cell nucleus as a reference for cell localization. A non-targeted guide RNA was used as a control, providing a comparative baseline for assessing changes in SOX11 expression.

[0020] Figure 8 Immunofluorescence staining analysis of SOX11 expression after lentiviral guide RNA delivery. This figure shows the immunofluorescence staining results of SOX11 after the introduction of guide RNA via lentivirus. Differences in SOX11 expression were compared between guide RNA delivery on day 1 and day 3, with cells assessed on day 11 of forward programming. DAPI was used to stain cell nuclei, aiding in cell localization and density interpretation. The non-targeted guide RNA was used as a control to provide a baseline for assessing changes in SOX11 expression.

[0021] Figure 9 UMAP visualizations from pooled scCRISPR screenings demonstrate transcriptomic similarity among specific gene knockouts. Four distinct UMAP plots are presented, characterizing the transcriptomic profiles of cells with AARS1, GARS1, HARS1, or CARS1 knockouts, respectively. In each plot, cells with these specific knockouts cluster together, highlighting their transcriptomic consistency. All four genes are key players in unfolded protein responses and are associated with a neurological condition known as Charcot-Marie-Tooth disease. The prominent clustering not only underscores the functional interactions of these genes in the disease but also validates the potential of these cells for robust CRISPR screening.

[0022] Figure 10Principal component analysis revealed temporal transcriptomic differences between microglia and microglia CRISPR-Ready cell lines. The figure shows the transcriptomic profiles of the two cell lines at different time points: iPSC stage, day 10 (before cryopreservation), and day 20 (10 days after cryopreservation). Circles represent "microglia," while triangles represent "microglia CRISPR-ready." Changes in localization in the figure highlight the transcriptional differences and similarities between the two cell lines at the selected time points.

[0023] Figure 11 Cytokine secretion profiles of microglia and CRISPR-Ready microglia. Cytokine secretion profiles produced by microglia and Cas9-expressing microglia after + / - LPS treatment were comparable. Secretion profiles were assessed using the Proteome Profiler Human Cytokine Array kit (R&D Systems).

[0024] Figure 12 Functionality of Cas9 in positively programmed microglia. This figure shows the knockout efficiency in positively programmed microglia on day 9. After cryopreservation, guide RNA targeting B2M was delivered via lentiviral transduction on day 9. Cells were stained with B2M antibody, and knockout efficiency (86.4%) was assessed by flow cytometry. A non-targeted guide RNA was used as a control, providing a comparative baseline for the efficiency of targeted modification. Cells were stained with CD11b, a marker for microglia.

[0025] Figure 13 The function of Cas9 over time in positively programmed microglia. Cells were transduced at different time points after resuscitation (D1, D6, D9, D18). Guide RNA targeting B2M was delivered via lentiviral transduction. Cells were stained with B2M antibody, and knockout efficiency was assessed by flow cytometry 5 days after transduction (knockout efficiency at different time points of guide delivery; D1: 86.9%, D6: 84.8%, D9: 86.4%, D18: 78.4%). Cells were stained with CD11b, a marker of microglia.

[0026] Figure 14 Transcriptomic profiles of gene knockouts selected by scCRISPR. The heatmap shows genes identified as activation markers by batch RNA sequencing of cells treated with (+ / -) LPS (y-axis).

[0027] Cosine similarity analysis employed a non-targeted guide from the (+ / -)LPS condition. Gene knockouts resulting in higher similarity between cells under LPS conditions and those under non-targeted-LPS conditions were plotted on the x-axis. Genes marked in gray are associated with the TLR4 pathway, responsible for microglia activation in response to LPS treatment.

[0028] Figure 15 Cell line engineering strategies for dCas9-VPR insertion. CAG knock-in drives rtTA into the ROSA26 locus, doxycycline-induced NEUROG2 (NGN2) expression cassette into the AAVS1 locus, and CAG drives the dCas9-VPR cassette into the CLYBL locus.

[0029] Figure 16 Flow cytometry analysis demonstrating the activity of dCas9-VPR in engineered iPSCs via CD274 activation. The figure shows unstained and untransduced controls (left), stained and untargeted controls (middle), and stained and sgRNACD274 transduced samples (right).

[0030] Figure 17 Flow cytometry analysis demonstrating dCas9-VPR activity in glutamatergic neurons via CD274 activation. dCas9-VPR functionality was demonstrated at three different time points (left: day 1, middle: day 3, right: day 11). The top panel shows transduction efficiency based on GFP signaling. The bottom panel confirms CD274 activation compared to non-targeted guide RNA at all three time points.

[0031] Figure 18 Cell line engineering strategies for dCas9-ZIM3 insertion. CAG knock-in drives rtTA into the ROSA26 locus, doxycycline-induced NEUROG2 (NGN2) expression cassette into the AAVS1 locus, and CAG drives the dCas9-ZIM3 cassette into the CLYBL locus.

[0032] Figure 19 Immunofluorescence staining analysis of SOX11 expression after lentiviral guide RNA delivery. This figure shows the immunofluorescence staining results of SOX11 after the introduction of guide RNA via lentivirus. Differences in SOX11 expression are contrasted between cells transduced with SOX11 targeting guide RNA, cells transduced with non-targeted guide RNA (NTV), and untransduced cells (No VR). The viral solution of SOX guide RNA was used at two different dilutions, 1:500 and 1:1000 DAPI, for staining the cell nuclei, which aided in cell localization and interpretation of knockdown results.

[0033] Figure 20Cell line engineering strategies for Cas9 insertion. CAG knock-in drives rtTA into the ROSA26 locus, doxycycline-induced OLIG2-SOX10 expression cassette into the AAVS1 locus, and CAG drives the Cas9 cassette into the CLYBL locus.

[0034] Figure 21 Flow cytometry analysis of Cas9 functionality in engineered iPSCs was demonstrated through B2M knockout efficiency. The figure shows two clones (P1D1 heterozygous and P1F6 homozygous) transduced with a non-targeted control (top) and B2M-targeted guide RNA (bottom). Cells were stained with B2M antibody, confirming high knockout efficiency in both clones (P1D1: 84% B2M negative cells; P1F6: 91% B2M negative cells).

[0035] Figure 22 On day 11, Cas9 functionality was observed in positively programmed glutamatergic neurons. SOX11-targeting guide RNA (sgRNA_SOX11) was delivered to glutamatergic neurons via both lipid-based and lentiviral transduction. Five days after guide RNA delivery, cells were stained with SOX11 antibody, and knockout efficiency was assessed by immunofluorescence staining. Non-targeting guide RNA (sgRNA_NT) and untransduced (virus-free) cells served as baseline controls. Image analysis showed significant SOX11 protein knockout following the introduction of the SOX11-specific gRNA. Detailed Implementation

[0036] This invention describes a method using induced pluripotent stem cell (iPSC) cell lines that have been engineered to express CRISPR-related proteins from genomic safe harbor loci, but in which these cells lack any guide RNAs before they differentiate into somatic cells. The iPSCs expressing CRISPR-related proteins are differentiated into specific somatic cells, such as neurons, using directed differentiation or forward programming methods. After differentiation, and importantly after loss of pluripotency, one or more guide RNAs are introduced into the somatic cells, allowing for targeted genome editing at this stage.

[0037] The core of this invention lies in the strategic combination of stable expression of CRISPR-related proteins in iPSCs, the absence of guide RNA during the pluripotent stage, and the introduction of guide RNA after differentiation, ensuring precise genome editing in non-pluripotent somatic cells. The introduction of cryopreservation further enhances the applicability of the system, ensuring its relevance in large-scale applications.

[0038] As described herein, the method includes: 1. Engineer iPSCs to express CRISPR-related proteins, such as those from genomic safe harbor loci.

[0039] 2. Optionally, cryopreserve predifferentiated cells expressing CRISPR-related proteins for large-scale and long-term use.

[0040] 3. In the absence of any guide RNA, these cells are initiated to differentiate into specific somatic cells.

[0041] 4. Introduce guide RNA after cells have lost their pluripotency to achieve targeted genome editing.

[0042] Therefore, according to a first aspect of the present invention, a method for regulating the expression of endogenous genes in somatic cells derived from iPSCs is provided, comprising the following steps: (i) Provides an engineered iPSC capable of stably expressing or inducing the expression of a CRISPR enzyme, a non-catalytically active CRISPR enzyme or a derivative thereof; (ii) Inducing engineered iPSCs to differentiate into somatic cells; and (iii) Introducing a guide RNA (gRNA) sequence into the somatic cells obtained in step (ii), wherein the gRNA sequence is complementary to the endogenous gene. This regulates the expression of endogenous genes in differentiated somatic cells.

[0043] In one implementation, the engineered iPSC contains an insertion of a genetic sequence operatively linked to a promoter, which encodes a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof. A promoter is a nucleotide sequence that initiates and regulates the transcription of polynucleotides. The terms "promoter" or "control element" include the full-length promoter region and the functional (e.g., controlling transcription or translation) segments of these regions. "Operationally linked" refers to an arrangement of elements in which the components are configured to perform their usual functions. Thus, a given promoter operably linked to a genetic sequence can influence the expression of that sequence when a suitable enzyme is present. The promoter need not be adjacent to the sequence, as long as it can perform the function of directing the expression of that sequence.

[0044] Therefore, for example, there may be an untranslatable but transcribed intermediate sequence between the promoter sequence and the genetic sequence; and this promoter sequence can still be considered "operably linked" to the genetic sequence. Thus, the term "operably linked" is intended to cover any spacing or orientation between the promoter element and the genetic sequence in the inducible cassette, which allows transcription of the inducible cassette to be initiated after the transcription complex recognizes the promoter element.

[0045] In one implementation, the promoter is a constitutive promoter. Constitutive promoters ensure sustained and high levels of gene expression. Commonly used constitutive promoters include the human β-actin promoter (ACTB), cytomegalovirus (CMV), elongation factor-1α (EF1α), phosphoglycerate kinase (PGK), and ubiquitin C (UbC). The CAG promoter is a strong synthetic RNA polymerase II promoter, frequently used to drive high levels of gene expression, and is constructed from the following sequences: (C) an early enhancer element of cytomegalovirus (CMV), (A) the promoter, first exon, and first intron of the chicken β-actin gene, and (G) the splice acceptor of the rabbit β-globin gene. Other examples of suitable constitutive promoters include RNA polymerase III promoters, such as the human U6 promoter, mouse U6 promoter, or human H1 promoter. RNA polymerase III promoters, such as those mentioned above, are commonly used to express guide RNA.

[0046] In an alternative implementation, the promoter is an inducible promoter. An "inducible promoter" is a nucleotide sequence in which the expression of a genetic sequence operatively linked to the promoter is controlled by analytes, cofactors, regulatory proteins, etc.

[0047] In one implementation, the inserted genetic sequence additionally includes a reporter gene. The marker gene or reporter gene encodes molecules capable of inducing visually recognizable features, including fluorescent proteins and luminescent proteins. Examples include genes encoding jellyfish green fluorescent protein (GFP), which causes cells expressing it to emit green light under blue / ultraviolet light; luciferase, which catalyzes the reaction with luciferin to produce light; and red fluorescent protein or derivatives thereof from the dsRed gene, such as mCherry. Such marker or reporter genes are useful because the presence of the reporter protein confirms the expression of CRISPR-related proteins, indicating successful insertion.

[0048] In one embodiment, the inserted genetic sequence contains at least two coding regions linked together by nucleic acids encoding a self-cleaving peptide to form a single open reading frame. Therefore, the inserted genetic sequence additionally contains a self-cleaving peptide, for example, between a CRISPR enzyme and a reporter gene. In one embodiment, the self-cleaving peptide is a viral 2A peptide. Self-cleaving peptides are present in viral members of the Picornaviridae family, including oral thrush viruses such as foot-and-mouth disease virus (FMDV), equine rhinitis A virus (ERAV), Thosea asigna virus (TaV), and porcine chezinvirus-1 (PTV-1). 2A peptides derived from FMDV, ERAV, PTV-1, and TaV are sometimes referred to as “F2A,” “E2A,” “P2A,” and “T2A,” respectively. The 2A sequence is believed to mediate a “ribosome jump” between proline and glycine, impairing normal peptide bond formation between P and G without affecting downstream translation.

[0049] Engineered iPSC

[0050] Engineered iPSCs can stably express or induce the expression of CRISPR enzymes, non-catalytically active CRISPR enzymes, or their derivatives.

[0051] CRISPR-related proteins can be delivered via vectors such as viral vectors. A "vector" is a nucleic acid molecule, such as a DNA molecule, used as a means of artificially transferring foreign genetic material into cells. A vector is typically a nucleic acid sequence consisting of an insert fragment (such as a sequence encoding a CRISPR-related protein) and a larger sequence that acts as the "backbone" of the vector. Vectors can be in any suitable form, including plasmids, microcircles, linear DNA, or single-stranded AAV templates. A vector must contain at least a sequence encoding a CRISPR-related protein, as well as a minimal sequence capable of being inserted into that sequence. Optionally, the vector also has an origin of replication (ori), which allows for vector amplification, for example, in bacteria. Additionally or alternatively, the vector may include selection markers, such as antibiotic resistance genes, colored marker genes, and / or suicide genes.

[0052] Vectors include, but are not limited to, plasmids, serosomes, viruses (bacteriophages, animal viruses, and plant viruses) and artificial chromosomes (e.g., yeast artificial chromosomes or YAC).

[0053] In one embodiment, the vector is a viral vector. The viral gene delivery system can be an RNA-based or DNA-based viral vector. Viral vectors include retroviral vectors (e.g., lentiviral vectors derived from HIV-1, HIV-2, SIV, BIV, FIV, etc.), gamma retroviral vectors, adenovirus (Ad) vectors (including their replicative, replication-defective, and non-replicating forms), adeno-associated virus-derived (AAV) vectors, simian virus 40 (SV-40) vectors, bovine papillomavirus vectors, Epstein-Barr virus vectors, herpesvirus vectors, vaccinia virus vectors, Harvey murine sarcoma virus vectors, murine papillomavirus vectors, Rous sarcoma virus vectors, and Sendai virus vectors. In other embodiments, the viral vector is selected from lentiviral vectors, adeno-associated virus vectors, or Sendai virus vectors. In other embodiments, the viral vector is a lentiviral vector.

[0054] Lentiviral vectors are well known in the art. Lentiviral vectors are complex retroviruses capable of randomly integrating into the host cell genome. In addition to the common retroviral genes gag, pol, and env, they contain other genes with regulatory or structural functions (e.g., helper genes Vif, Nef, Vpu, Vpr). Lentiviral vectors have the advantage of being able to infect undividing cells and can be used for in vivo and in vitro gene transfer and nucleic acid sequence expression. For example, recombinant lentiviral vectors can infect non-dividing cells by transfecting suitable host cells with two or more vectors carrying packaging functional genes, namely gag, pol, and env, and rev and tat.

[0055] In another implementation, the vector is a plasmid. The plasmid can be episodic. Episodic vectors are capable of introducing large fragments of DNA into cells but maintaining them outside the chromosome, replicating once per cell cycle, efficiently distributing them to daughter cells, and substantially not eliciting an immune response. Alternatively, episodic vectors based on Epstein-Barr virus (EBV), yeast-based vectors, adenovirus-based vectors, simian virus 40 (SV40)-based vectors, or bovine papillomavirus (BPV)-based vectors can be used.

[0056] In another embodiment, the vector is a transposon (i.e., involving a transposon plasmid). The transposon delivery system consists of two plasmids, one encoding a transposase and the other encoding the genetic sequence to be delivered. The transposase protein mediates the random integration of the transcript encoded in the transposon plasmid into the genome. In one embodiment, the transposon system is selected from the PiggyBac or Sleeping Beauty transposon system. The transposon plasmid encodes a payload / genetic sequence flanked by two ITRs (internal terminal repeats).

[0057] In one implementation, the transposase and transposon plasmid are delivered into the cell via nuclear transfection or lipid transfection. The number of integration events, and therefore the effective payload copy number per cell, can be partially controlled by adjusting the total and relative amounts of the transposase and transposon plasmid DNA.

[0058] In one implementation, the engineered iPSC contains a genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof at a target site, such as a genomic safe harbor (GSH) site. Targeted integration can be achieved using one or more of the methods described herein.

[0059] iPSCs can be engineered to include other genetic material. Such material includes reporter genes, suicide genes, and selection markers. This article discusses genes for markers or reporter molecules, such as genes that induce visually identifiable features, including fluorescent and luminescent proteins. Selection markers may also include genes for resistance to antibiotics or other drugs. Non-inducible expression of molecular tools is also desired, including optogenetic tools, nuclear receptor fusion proteins such as the tamoxifen-inducible system ERT, and designed receptors specifically activated by designed drugs. Furthermore, sequences encoding signaling factors that can alter the function of signaling factors in the same cell, neighboring cells, or even distant cells within an organism, including hormones, autocrine or paracrine factors, may be co-expressed.

[0060] Additionally, as described herein, extra genetic material may include sequences encoding non-coding RNA. Examples of such genetic material include gRNA sequences and miRNA genes, which can function as genetic switches.

[0061] CRISPR enzyme

[0062] It should be understood that the “CRISPR-related protein” mentioned in this article refers to CRISPR enzymes, non-catalytically active CRISPR enzymes, or their derivatives. “CRISPR enzymes” are the main protein components of the CRISPR-CRISPR-related protein (Cas) system and form a complex with guide RNA (gRNA) to form the CRISPR-Cas system.

[0063] Three CRISPR mechanisms have been identified, with type II being the most studied. The CRISPR / Cas9 system (type II) utilizes the Cas9 nuclease to create double-strand breaks in DNA at sites determined by short guide RNAs (also referred to as guide RNAs in this paper). The CRISPR / Cas system is the prokaryotic immune system, which confers resistance to foreign genetic elements. CRISPR consists of segments of prokaryotic DNA containing short, repetitive base sequences. Each repetition is followed by a short segment of protospacer DNA that has previously been exposed to a foreign genetic element. The CRISPR spacer region uses RNA interference to recognize and cleave the foreign genetic element. The CRISPR immune response occurs in two steps: CRISPR-RNA (crRNA) biogenesis and crRNA-guided interference. CrRNA molecules consist of a variable sequence transcribed from protospacer DNA and a CRISPR repetitive sequence. Each crRNA molecule then hybridizes with a second RNA called trans-activating CRISPR RNA (tracrRNA), and together they eventually form a complex with the nuclease Cas9. The prespacer sequence of crRNA encodes a portion of the DNA that guides Cas9 to cleave complementary target DNA sequences if they are adjacent to a short sequence called a prespacer-adjacent motif (PAM). This natural system has been engineered and utilized to introduce double-strand breaks (DSBs) at specific sites in genomic DNA, among many other applications. In particular, sequences derived from *Streptococcus pyogenes* can be used. Streptococcus pyogenes The CRISPR type II system. In its simplest form, the CRISPR / Cas9 system contains two components delivered to the cell to provide genome editing: the Cas9 nuclease itself and gRNA. The gRNA is a fusion of a custom site-specific crRNA (targeted to the target sequence) and a standardized tracrRNA.

[0064] In one embodiment, the CRISPR enzyme is Cas9. In another embodiment, the CRISPR enzyme is Cas12a / Cpf1. CRISPR enzymes are known in the art, such as those described in Wang et al., Genome Biol. 19, 62 (2018). Other CRISPR enzymes have been used in human cells and are known to those skilled in the art.

[0065] Once a double-stranded DNA break (DSB) has formed, a donor template homologous to the target locus can be provided. Different cellular repair mechanisms can be used to repair the DSB and introduce the desired sequence: non-homologous end joining repair (NHEJ), which is more prone to error; and homologous recombination repair. DSBs can also be repaired via homology-directed repair (HDR), allowing for precise insertion.

[0066] In one implementation, the endogenous gene contains an insertion or deletion after the introduction of the gRNA sequence, thereby disrupting the coding sequence of the endogenous gene (CRISPR knockout). In other implementations, the endogenous gene is completely or partially deleted after the introduction of the gRNA sequence.

[0067] Derivatives of the CRISPR / Cas system are also possible. For example, mutant forms of Cas9, such as Cas9D10A, can be utilized, which possess only cleavage enzyme activity. This means it cuts only one DNA strand without activating NHEJ. Instead, when a homology repair template is provided, DNA repair proceeds only via the high-fidelity (HDR) pathway. Cas9D10A can be used in paired Cas9 complexes designed to bind to two sgRNAs to create adjacent DNA cleavages, the sgRNAs being complementary to adjacent regions on the opposite strand of the target site.

[0068] CRISPR enzymes without catalytic activity

[0069] In one implementation, engineered iPSCs can stably express or induce the expression of a catalytically inactive CRISPR enzyme or a derivative thereof. A catalytically inactive CRISPR enzyme can also be referred to as "dead." A programmable nuclease can be rendered catalytically inactive through point mutations in its endonuclease domains, such as the RuvC and HNH domains in Cas9. Examples of point mutations in the endonuclease domains of such catalytically inactive Cas9 (also known as dCas9) are D10A and H840A, which lead to its inactivation. However, it is readily understood that such mutations do not affect the programmable nuclease's ability to bind gRNA and target genes, as such binding is affected by other domains.

[0070] In one embodiment, the catalytically inactive CRISPR enzyme is catalytically inactive Cas9 (i.e., inactive Cas9 or dCas9). In another embodiment, the catalytically inactive CRISPR enzyme is catalytically inactive Cas12a (i.e., dCas12a). In other embodiments, the catalytically inactive CRISPR enzyme (e.g., dCas9 or dCas12a) is a derivative containing point mutations in the RuvCI and HNH nuclease domains. In a specific embodiment, the catalytically inactive CRISPR enzyme is dCas9 and contains point mutations D10A and H840A compared to the wild-type sequence of Cas9.

[0071] The method presented herein utilizes CRISPR activation (CRISPRa), employing a modified form of CRISPR effector that lacks endonuclease activity but is contained within a transcription activator attached to a non-catalytically active CRISPR enzyme (e.g., dCas9 and dCas12a fused with a transcription activator) and / or gRNA. Therefore, the transcription activator fused to or bound to the CRISPRa component (e.g., through the presence of an aptamer sequence) can enhance gene expression after the gRNA targets it to the target gene.

[0072] Therefore, in one embodiment, the expression of the endogenous gene is activated (CRISPR activation). In this embodiment, one or more transcriptional activating proteins can be fused to the non-catalytically active CRISPR enzyme. In other embodiments, the non-catalytically active CRISPR enzyme is dCas9 and fused with transcriptional activating proteins VP64, p65, and Rta (i.e., the non-catalytically active programmable nuclease is dCas9-VPR). In yet another embodiment, the gRNA sequence is engineered to include a transcriptional activation domain capable of recruiting one or more transcriptional activating proteins to upregulate the expression of the endogenous gene.

[0073] The method presented herein can utilize CRISPR interference (CRISPRi), which uses a modified form of CRISPR effector that does not have endonuclease activity but is contained in a transcriptional repressor protein attached to a non-catalytically active CRISPR enzyme (e.g., dCas9 and dCas12a fused with a transcriptional repressor protein) and / or gRNA.

[0074] Therefore, in one embodiment, the expression of endogenous genes is suppressed (CRISPR interference). In this embodiment, one or more transcriptional repressor proteins are fused to the non-catalytically active CRISPR enzyme. In one embodiment, the transcriptional repressor protein is selected from KRAB repressor proteins, particularly the KRAB domain of KOX1 or ZIM3. According to this embodiment, the non-catalytically active CRISPR enzyme can be a dCas9 fused to the KRAB domain of KOX1 or ZIM3 (i.e., the non-catalytically active CRISPR enzyme can be dCas9-KOX1 or dCas9-ZIM3). In another embodiment, the gRNA sequence is engineered to include a transcriptional repressor domain capable of recruiting one or more transcriptional repressor proteins to downregulate the expression of endogenous genes.

[0075] In one implementation, the gRNA sequence is complementary to the coding exon of the endogenous gene. Depending on the CRISPR-related protein targeted by the gRNA, affecting the coding exon of the endogenous gene will lead to the regulation of said endogenous gene expression.

[0076] In one implementation, the gRNA sequence is complementary to the transcription start site (TSS) of the endogenous gene. Depending on the CRISPR-related protein targeted by the gRNA, influencing the TSS of the endogenous gene will lead to regulation of the endogenous gene's expression.

[0077] Guide RNA (gRNA) sequence

[0078] "gRNA" refers to an RNA that can specifically target the CRISPR complex (i.e., the gRNA-CRISPR enzyme complex) to a target gene or nucleic acid. gRNA is a target sequence (i.e., an endogenous gene) specific RNA that can bind to the CRISPR enzyme and guide the CRISPR enzyme to the target gene or nucleic acid.

[0079] Therefore, gRNA sequences can target endogenous genes with CRISPR enzymes, non-catalytically active CRISPR enzymes, or their derivatives to regulate their expression.

[0080] Methods for delivering RNA into cells are known in the art. The gRNA may be synthetic RNA, or it may be incorporated into a plasmid or a lentiviral donor plasmid. The gRNA may be delivered via a vector such as a viral vector, as described above. In one embodiment, the gRNA is introduced via viral transduction. In another embodiment, the gRNA is introduced using lipid-based transfection or electroporation with a vector expressing the gRNA. In yet another embodiment, the gRNA is introduced using lipid-based transfection or electroporation with synthetic gRNA.

[0081] In one implementation, gRNA is introduced approximately 6 days into differentiation. In other implementations, gRNA is introduced 1–3 days after differentiation.

[0082] In one implementation, two or more gRNA sequences are introduced. In other implementations, each gRNA sequence is complementary to an alternative or different endogenous gene, or to an alternative sequence of the TSS of more than one endogenous gene.

[0083] According to embodiments in which multiple (e.g., two or more) gRNA sequences or gRNA sequence libraries are incorporated, the multiple gRNA sequences may be separated by cleavable sequences. A cleavable sequence is a sequence that can be recognized by an entity capable of specifically cleaving DNA, including restriction sites that are target sequences of restriction enzymes or sequences recognized by other DNA-cutting entities, such as nucleases, recombinases, ribozymes, or artificial constructs. At least one cleavable sequence may be included. These cleavable sequences can be located at any suitable point, allowing selective removal of selected portions or the entire sequence. Thus, cleavable sites may be side-joined to portions / the entire sequence that can subsequently be removed. Such cleavable sequences can be recognized by nucleases, recombinases, ribozymes, or artificial constructs (e.g., bacterial DNA endonucleases, such as Csy4). In one embodiment, multiple gRNA sequences are provided in an array comprising a promoter, two or more gRNA sequences, and two or more cleavable sequences. In a specific embodiment, multiple gRNA sequences are provided in an array comprising a constitutive promoter (e.g., the hU6 promoter), two gRNA sequences, and two cleavable sequences. In other implementations, each guide RNA sequence may be driven by a separate promoter, such as a first gRNA driven by the human U6 promoter, a second gRNA driven by the mouse U6 promoter, a third gRNA driven by the bovine U6 promoter, a fourth gRNA driven by the H1 promoter, and so on.

[0084] In other embodiments, two or more gRNA sequences are introduced, for example, via plasmid transfection, electroporation, lentiviral infection, or AAV infection. In one embodiment, a lentiviral vector containing a single gRNA expression cassette is used. In other embodiments, a gRNA library is introduced into a lentiviral vector and provided to target cells for pooled or array-based CRISPR screening.

[0085] In one embodiment, one or more gRNA sequences are operatively linked to a constitutive promoter. In one embodiment, the promoter is an RNA polymerase III-driven promoter, such as the human U6, mouse U6, bovine U6, or human H1 promoter.

[0086] Genome Safe Harbor (GSH) sites and their insertion

[0087] The methods described in this article involve targeting safe harbor sites in the iPSC genome.

[0088] In particular, insertions at genomic safe harbor sites are superior to random genomic integration because this is expected to be a safer modification of the genome and is less likely to cause unwanted side effects, such as silencing of natural gene expression or inducing mutations that lead to cancer cell types.

[0089] Genome safe harbor (GSH) sites are loci within the genome where genes or other genetic material can be inserted without any harmful effects on the cell or the inserted genetic material. Most advantageous are GSH sites where the expression of the inserted genetic sequence is not interfered with by any readthrough expression from neighboring genes, and the expression of inducible cassettes minimizes interference with endogenous transcription programs. More formal criteria have been proposed to help determine whether a particular locus will be a future GSH site (Papapetrou et al., (2011)). Nature Biotechnology , 29(1):73-8, doi: 10.1038 / nbt.1717). These criteria include sites that are (i) 50 kb or more from the 5' end of any gene, (ii) 300 kb or more from any cancer-related gene, (iii) 300 kb or more from any microRNA (miRNA), (iv) located outside a transcription unit, and (v) located outside a highly conserved region (UCR). It may not be necessary to meet all of these proposed criteria, as some identified GSH sites do not meet all of them. A suitable GSH site is considered to meet at least two, three, four, or all of these criteria.

[0090] Other sites can be identified by searching for sites where the virus integrates naturally without disrupting natural gene expression. These can also be defined as sites that cannot be silenced and therefore guarantee stable transgene expression, as described in WO2021152086A1, which is incorporated herein by reference.

[0091] Any suitable GSH site can be used in the method of the present invention because it allows the insertion of genetic material without harming the cell and allows the transcription of the inserted genetic material. Those skilled in the art can use this simplified criterion to identify suitable GSH sites, and / or use the more formal criterion described above.

[0092] For the human genome, several GSHs have been identified, including the AAVS1 locus, the hROSA26 locus, and the CLYBL gene. CCR5 Genes have also been considered potential GSHs, and further research could identify one or more of these GSHs in the human genome. Other GSHs have recently been identified by Aznauryan et al., ( Cell Rep Methods , 2022;2(1):100154), https: / / doi.org / 10.1016 / j.crmeth.2021.100154) was discovered and verified, and is incorporated into this paper by reference.

[0093] The adeno-associated virus integration site 1 (AAVS1) locus is located within the protein phosphatase 1 regulatory subunit 12C (PPP1R12C) gene on human chromosome 19, which is uniformly and widely expressed in human tissues. This locus, being a specific integration locus for AAV serotype 2, has been identified as a potential GSH site. AAVS1 has been shown to be a favorable environment for transcription because it contains open chromatin structures and natural chromosome insulators, making the inducible cassette resistant to silencing. Currently, there is no evidence that disruption of the PPP1R12C gene has adverse effects on cells. Furthermore, inducible cassettes inserted at this site maintain transcriptional activity in many different cell types. AAVS1 is therefore considered a GSH site and has been widely used for targeted transgenesis in the human genome.

[0094] The hROSA26 locus has been identified based on sequence similarity to the GSH locus from mice (ROSA26 – reverse splice acceptor locus #26). Although orthologous homologous loci have been identified in humans, this locus is not typically used for inducible cassette insertion. The inventors have developed a targeting system specifically for the hROSA26 locus, thus enabling the insertion of genetic material into this locus. The hROSA26 locus is located on chromosome 3 (3p25.3) and can be accessed in the Ensembl database (GenBank: CR624523). The integration site is located at... THUMPD3 Within the open reading frame (ORF) of a long non-coding RNA (reverse strand). Since the hROSA26 site has an endogenous promoter, the inserted genetic material can utilize this endogenous promoter, or alternatively, can be inserted with operative ligation to an exogenous promoter.

[0095] Intron 2 of the citrate lyase β-like (CLYBL) gene on the long arm of chromosome 13 was identified as a suitable GSH site because it is one of the integration hotspots of the identified phage-derived phiC31 integrase. Studies have shown that inducible cassettes randomly inserted at this locus are stable and expressed. It has been demonstrated that inserting an inducible cassette at this GSH site does not interfere with local gene expression (Cerbibi et al., 2015, PLOS One, DOI:10.1371). Therefore, CLYBL provides a suitable GSH site for this invention.

[0096] Located on chromosome 3 (position 3p21.31) CCR5This is the gene encoding the major co-receptor of HIV-1. The interest in using this site as a GSH locus stems from a null mutation in this gene that, while seemingly without any adverse effects, predisposes the individual to resistance to HIV-1 infection. Zinc finger nucleases targeting exon 3 have been developed, thus allowing the insertion of genetic material at this locus. Given that the natural function of CCR5 is not yet elucidated, this site remains a putative GSH site, which can be used in this invention.

[0097] GSH loci have been identified in other organisms, including the ROSA26, HPRT, and Hipp11(H11) loci in mice. Mammalian genomes may include GSH loci based on pseudoattP sites. For these sites, hiC31 integrase—a recombinase derived from Streptomyces bacteriophages—has been developed as a non-viral insertion tool because it can integrate plasmids carrying inducible cassettes containing attB sites into pseudoattP sites.

[0098] GSH is also present in plant genomes, and modifications to plant cells can form part of this invention. GSH sites have been identified in the rice genome (Cantos et al., (2014)). Front.Plant Sci., 5(302), doi:http: / / dx.doi.org / 10.3389 / fpls.2014.00302).

[0099] Therefore, in one implementation, the GSH site is selected from: the hROSA26 locus, the AAVS1 locus, CLYBL Genes and CCR5 The gene, for example, wherein the first genomic safe harbor site is the hROSA26 locus and the second genomic safe harbor site is the AAVS1 locus. In one embodiment, the first, second, and third GSH sites are selected from any three of the following: hROSA26 locus, AAVS1 locus, CLYBL Genes and / or CCR5 Genes, for example, the first genomic safe harbor locus is the hROSA26 locus, the second genomic safe harbor locus is the AAVS1 locus, and the third genomic safe harbor locus is... CLYBL Gene. In another embodiment, the first and second GSH loci are selected from any two of the following: hROSA26 locus, AAVS1 locus, CLYBL Genes and / or CCR5 Genes, for example, in which the first genomic safe harbor site is the hROSA26 locus, and the second genomic safe harbor site is the AAVS1 locus or CLYBL Gene locus.

[0100] In the method of this invention, the insertion occurs at different GSH sites, therefore at least two GSH sites are required. It should be understood that "different GSH sites" refers to GSH sites located at different positions within the genome.

[0101] In one embodiment, a genetic sequence encoding a transcriptional regulatory protein is inserted at a first GSH locus on both chromosomes of the cell. In one embodiment, an inducible cassette is inserted at a second GSH locus on both chromosomes of the cell. In one embodiment, a genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof is inserted at a third GSH locus on both chromosomes of the cell.

[0102] In one implementation, the engineered iPSC contains additional genetic material inserted at the first, second, and / or third GSH sites. This genetic material may be selected from one or more of the following: reporter genes; suicide genes; and selection markers.

[0103] Site-specific delivery & targeting

[0104] Preferably, the insertion into the GSH site is specifically located within the GSH sequence as described above. Any suitable technique for inserting polynucleotides into a specific sequence can be used, and several techniques are described in the art. Suitable techniques include any method that can introduce a break at the desired location and allow the donor vector to recombine into the gap. Therefore, a key first step in site-specific genome modification is the generation of double-stranded DNA breaks (DSBs) at the locus of the genome to be modified. Different cellular repair mechanisms can be used to repair DSBs and introduce the desired sequence, including: non-homologous end joining repair (NHEJ), which is more prone to error; and homologous recombination repair (HR) mediated by the donor DNA template, which can be used for insertion into the inducible cassette. In some embodiments, the technique disclosed in WO 2018 / 096343 is used for GSH site insertion, which is incorporated herein by reference. Therefore, any method that generates specific, targeted double-strand breaks in the genome for gene / inducible cassette insertion can be used in the methods of the present invention. Preferably, the method for inserting the gene / inducible cassette utilizes any one or more of the ZFN, TALEN, and / or CRISPR / Cas9 systems or any derivative thereof.

[0105] Zinc finger nucleases are artificial enzymes created by fusing a zinc finger DNA-binding domain to the nuclease domain of the restriction enzyme FokI. The latter has a non-specific cleavage domain that must dimerize to cut DNA. This means that two ZFN monomers are required to allow dimerization of the FokI domain and cleave DNA. The ZFN DNA-binding domain contains a tandem array of Cys2His2 zinc fingers, each recognizing three consecutive nucleotides in the target sequence and can be programmed to target any genomic sequence. The two binding sites are separated by 5–7 bp to allow for optimal dimerization of the FokI domain. Therefore, the catalytically active enzyme is able to cleave DNA at a specific site. Target specificity is increased by ensuring that two adjacent DNA-binding events must occur to achieve a double-strand break.

[0106] Transcription activator-like effector nucleases (TALENs) are dimeric transcription factors / nucleases. They are prepared by fusing the TAL effector DNA-binding domain to the DNA-cutting domain (a type of deoxyribonuclease). Transcription activator-like effectors (TALENs) can be engineered to virtually bind to any desired DNA sequence, so that when combined with a nuclease, the DNA can be cleaved at a specific location. TAL effectors are produced by *Xanthomonas* species (…). Xanthomonas Bacterial secreted proteins possess DNA-binding domains containing repetitive, highly conserved sequences of 33-34 amino acids, with distinct 12th and 13th amino acids. These two positions are highly variable and exhibit a strong correlation with specific nucleotide recognition. This direct relationship between amino acid sequence and DNA recognition allows for the engineering of specific DNA-binding domains by selecting combinations of repetitive segments containing appropriate residues at the two variable positions. TALEN is therefore constructed from arrays of 33 to 35 amino acid modules, each targeting a single nucleotide. By selecting the module array, virtually any sequence can serve as a target.

[0107] Once the DSB has been prepared by any suitable method, the gene / inducible cassette for insertion can be provided in any suitable manner as described below. The gene / inducible cassette and associated genetic material form donor DNA, which is used to repair the DNA at the DSB site and is inserted using standard cellular repair mechanisms / pathways. As mentioned above, how the break is initiated will change which pathway is used to repair the damage.

[0108] In some implementations, targeted insertion is achieved in the absence of DNA double-strand breaks. For example, this can be achieved using viral vectors such as adeno-associated virus (AAV). In this case, the vector is modified to contain the transgene and accompanied by a suitable selection marker (PuroR, BlaR, HygroR, ZeoR, or eGFP, mCherry, DsRed) flanked by appropriate homologous arms. Infection of target cells produces genetically engineered cells in which the target locus (e.g., the GSH site) contains the transgene.

[0109] Double safe harbor

[0110] There is a strong need for in vitro methods to generate selected cell types in both quantity and quality suitable for drug discovery and regenerative medicine purposes. Directing stem cell differentiation into desired cell types is often challenging, leading to alternative approaches, including direct cell reprogramming. In particular, forward programming, as a method for directly converting pluripotent stem cells, including iPSCs, into mature cell types, has been recognized as a powerful strategy for deriving human cells. This reprogramming involves the forced expression of key lineage-specific transcription factors (referred to herein as “lineage-specific transcription factors”) to convert stem cells into specific somatic cell types. However, robust, controlled expression of transgenes in pluripotent stem cells is often challenging due to silencing mechanisms manipulated within the cell (e.g., as described by Pfaff et al., (2013) Stem Cells 31:488-499). Maintaining sustained and efficient expression during reprogramming is crucial to avoid proliferating pluripotent stem cell remnants and contamination of the final product.

[0111] In one implementation, the engineered iPSC further includes: (a) The inserted genetic sequence encoding a transcriptional regulatory protein at the first GSH site; (b) An inserted inducible cassette containing a genetic sequence operatively linked to an inducible promoter at a second GSH site, wherein the inducible promoter is regulated by a transcriptional regulatory protein. The first and second GSH sites are different.

[0112] Transcription regulatory proteins & inducible transcription

[0113] Transcriptional regulatory proteins are DNA-binding proteins, preferably specifically binding to DNA site sequences located inside or near the promoter, and facilitating the binding of the transcription machinery to the promoter, thereby promoting the transcription of DNA sequences (e.g., transcription activators) or blocking the process (e.g., transcription repressors). Such entities are also called transcription factors.

[0114] The DNA sequence to which transcriptional regulatory proteins bind is called a transcription factor binding site or response element, and these sequences are located inside or near the promoter of the regulated DNA sequence.

[0115] Transcriptional activating proteins bind to response elements and promote gene expression. In the method of the present invention, such proteins are preferably used to control inducible cassette expression.

[0116] Transcriptional repressor proteins bind to response elements and prevent gene expression. Transcriptional regulatory proteins can be activated or inactivated through a number of mechanisms and / or by light, including binding of substances, interaction with other transcription factors (e.g., homodimerization or heterodimerization) or co-regulatory proteins, phosphorylation, and methylation. Transcriptional repressor proteins can be controlled by activation or inactivation.

[0117] If the transcriptional regulatory protein is a transcriptional activator, then preferably, the transcriptional activator needs to be activated. This activation can be achieved by any suitable means, but preferably by adding an exogenous substance to the cell. The supply of the exogenous substance to the cell can be controlled, thereby controlling the activation of the transcriptional regulatory protein. Alternatively, the exogenous substance can be provided to inactivate the transcriptional regulatory protein, and then removed to activate it. Therefore, in one embodiment, the activity of the transcriptional regulatory protein is controlled by an exogenous substance.

[0118] If the transcriptional regulatory protein is a transcriptional repressor, then preferably the transcriptional repressor needs to be inactivated. Therefore, a substance is provided to prevent the transcriptional repressor from inhibiting transcription, thereby allowing transcription.

[0119] Any suitable transcriptional regulatory protein can be used, preferably an activatable or inactivatable transcriptional regulatory protein. Preferably, exogenous substances can be provided to control the transcriptional regulatory protein. Such transcriptional regulatory proteins are also called inducible transcriptional regulatory proteins.

[0120] Tetracycline-controlled transcriptional activation is a method of inducible gene expression in which transcription is reversibly turned on or off in the presence of an antibiotic tetracycline or one of its derivatives (e.g., doxycycline, which is more stable, or minocycline). In this system, the transcriptional activating protein is the inverse tetracycline transactivator (rtTA, also known as the tetracycline-responsive transcriptional activator) or a derivative thereof. The rtTA protein is capable of binding DNA at a specific tet operon (TetO) sequence. Several repeating sequences of this TetO sequence are placed upstream of a minimal promoter (such as the CMV promoter), and together they form a tetracycline-responsive element (TRE). This system exists in two forms, depending on whether the addition of tetracycline or its derivative activates (Tet-on) or inactivates (Tet-off) the rtTA protein.

[0121] In the Tet-off system, tetracycline or its derivatives bind to and inactivate rtTA, preventing it from binding to TRE sequences and thus inhibiting the transcription of TRE-controlled genes. This system was first described by Bujard et al., (1992) Proc. Natl. Acad. Sci. USA 89 (12): 5547-51.

[0122] The Tet-On system consists of two components: (1) a constitutively expressed reverse tetracycline transactivator (rtTa) protein and an rtTa-sensitive inducible promoter (Tet response element, TRE). rtTa binds to the TRE-containing promoter in the presence of tetracycline or its more stable derivatives, including doxycycline (dox), leading to rtTa activation and inducing TRE-controlled gene expression. This approach may be preferred in the method of the present invention.

[0123] Therefore, the transcriptional regulatory protein can be rtTA, which can be activated or inactivated by one of the antibiotic tetracyclines or their derivatives, said antibiotic tetracyclines or their derivatives being exogenously provided. If the transcriptional regulatory protein is rtTA, then the inducible promoter inserted into the second GSH site includes a tetracycline response element (TRE). The exogenously provided substance is one of the antibiotic tetracyclines or their derivatives.

[0124] Variant and modified rtTa proteins can be used in the methods of the present invention, including Tet-On higher transactivator protein (also known as rtTA2S-M2) and Tet-On 3G (also known as rtTA-V16, derived from rtTA2S-S2).

[0125] Tetracycline response elements (TREs) typically consist of seven repeats of a 19 bp bacterial TetO sequence separated by spacer sequences, along with a minimal promoter. Variants and modifications of the TRE sequence are possible because the minimal promoter can be any suitable promoter. Preferably, the minimal promoter does not show or shows minimal expression levels in the absence of rtTa binding. Inducible promoters with a second GSH site can therefore include TREs.

[0126] The tetracycline-controlled modification system is the T-REx™ system (Thermofisher Scientific), in which the transcriptional regulatory protein is the transcriptional repressor TetR. The components of this system include (i) an inducible promoter containing a strong human cytomegalovirus immediate early (CMV) promoter and two tetracycline operon 2 (TetO2) sites, and the Tet repressor protein (TetR). The TetO2 sequence consists of two copies of a 19 bp sequence, 5´-TCCCTATCAGTGATAGAGA-3´ (SEQ ID NO:1), separated by a 2 bp spacer. In the absence of tetracycline, the Tet repressor protein forms a homodimer that binds to each TetO2 sequence in the inducible promoter with extremely high affinity, preventing transcription of the promoter. Once added, tetracycline binds to each Tet repressor protein homodimer with high affinity, preventing it from binding to the Tet operon. The Tet repressor protein:tetracycline complex then dissociates from the Tet operon and allows for induced expression. In this case, the transcriptional regulatory protein is TetR, and the inducible promoter contains two TetO2 sites. The exogenously provided substance is tetracycline or a derivative thereof.

[0127] The cumate switch is another method for inducible gene expression, where transcription is reversibly turned on or off in the presence of cumate. This system can be used in both activator and repressor conformations, where the presence of cumate leads to either repression or activation of transcription, respectively. In the repressor conformation, regulation is mediated by the binding of the repressor protein (CymR) to the operon site (CuO) downstream of the constitutive promoter. The addition of cumate, a small molecule, alleviates repression and allows transcription to proceed. In the activator conformation, a chimeric transactivator (cTA) protein, formed by the fusion of CymR with the VP16 activation domain, activates transcription when it binds to the CuO operon site upstream of the constitutive promoter. The addition of cumate eliminates DNA binding, thus terminating transcription via cTA transactivation.

[0128] Other inducible expression systems are known and can be used in the methods of this invention. These include a complete controlled inducible system from Agilent Technologies. This is based on the insect hormone ecdysone or its analogue ponasterone A (ponA), which can activate fruit flies (…). Drosophila melongasterTranscription of the ecdysone receptor (EcR) gene and an inducible promoter containing the ecdysone receptor binding site occurs in mammalian cells. EcR is a member of the nuclear receptor vitamin X-receptor (RXR) family. In humans, EcR forms a heterodimer with RXR, which binds to the ecdysone response element (EcRE). In the absence of PonA, the heterodimer represses transcription.

[0129] Therefore, transcriptional regulatory proteins can be repressor proteins, such as the ecdysone receptor or its derivatives. Examples of the latter include the VgEcR synthetic receptor from Agilent Technologies, a fusion of EcR, the DNA-binding domain of the glucocorticoid receptor, and the transcriptional activation domain of herpes simplex virus VP16. Inducible promoters contain the EcRE sequence or its modified form, along with a minimal promoter. Modified forms include Agilent Technologies' E / GRE recognition sequence, in which the sequence has been mutated. The E / GRE recognition sequence contains a retinoid X-receptor (RXR) and a reverse half-site recognition element of the GR-binding domain. In all permutations, the exogenously provided substance is pinosterone A, which removes the repressive effect of EcR or its derivatives on the inducible promoter and allows transcription to occur.

[0130] Alternatively, the induction system can be based on the synthetic steroid mifepristone as an exogenously provided substance. In this case, a hybrid transcriptional regulatory protein is inserted, which is based on the DNA-binding domain from yeast GAL4 protein, a truncated ligand-binding domain (LBD) from the human progesterone receptor, and an activation domain (AD) from human NF-κB. This hybrid transcriptional regulatory protein can be marketed under the brand name Gene Switch. TM Adapted from Thermofisher Scientific. Mifepristone activates heterozygous proteins and allows transcription from an inducible promoter containing the GAL4 upstream activation sequence (UAS) and the adenovirus E1b TATA box. This system is described in Wang, Y. et al. (1994) Proc. Natl. Acad. Sci. USA 91, 8180-8184.

[0131] Therefore, transcriptional regulatory proteins can be any suitable regulatory protein, either an activator or a repressor. Suitable transcriptional activators are inverse tetracycline transactivator (rtTa) or Gene Switch™ hybrid transcriptional regulators. Suitable repressors include Tet-Off forms of rtTA, TetR, or EcR. Transcriptional regulatory proteins can be modified or derived as needed.

[0132] Therefore, in one embodiment, the transcriptional regulatory protein is selected from any of the following: reverse tetracycline transactivator (rtTa) protein, tetracycline repressor (TetR), VgEcR synthesis receptor, cumate repressor (CymR), or a hybrid transcriptional regulatory protein comprising a DNA-binding domain from yeast GAL4 protein, a truncated ligand-binding domain from human progesterone receptor, and an activation domain from human NF-κB. In a specific embodiment, the transcriptional regulatory protein is rtTA, the activity of which is controlled by tetracycline or its derivatives such as doxycycline. According to this specific embodiment, the inducible promoter may include a tetracycline response element (TRE).

[0133] In one embodiment, transcription of the sequence inserted at the first GSH site is controlled by one or more constitutive promoters, while transcription of the sequence inserted at the second GSH site is controlled by an inducible promoter. In another embodiment, transcription of the sequences inserted at the first and third GSH sites is controlled by one or more constitutive promoters, while transcription of the sequence inserted at the second GSH site is controlled by an inducible promoter.

[0134] Inducible promoters may contain elements suitable for binding to or interacting with transcriptional regulatory proteins. The interaction between transcriptional regulatory proteins and inducible promoters is preferably controlled by exogenously provided substances.

[0135] The exogenous substance can be any suitable substance that binds to or interacts with transcriptional regulatory proteins. Suitable substances include tetracyclines, tetracycline derivatives (such as doxycycline), pinosterone A, and mifepristone.

[0136] Therefore, inserting a gene encoding a transcription regulatory protein into a first GSH site provides a control mechanism for the expression of an inducible cassette, which is operatively linked to an inducible promoter and inserted into different second GSH sites.

[0137] Preferably, the gene encoding the transcriptional regulatory protein is operatively linked to a constitutive promoter. Alternatively, a first GSH site may be selected that already possesses a constitutive promoter, which can also drive the expression of the transcriptional regulatory protein gene and any associated genetic material.

[0138] Furthermore, transcriptional regulatory factors, along with any additional genetic material, can be provided along with cleavable sequences. These sequences are those that can be recognized by entities capable of specifically cleaving DNA, including restriction sites, which are target sequences of restriction enzymes or sequences recognized by other DNA-cutting entities such as nucleases, recombinases, ribozymes, or artificial constructs. At least one cleavable sequence may be included, but two or more are preferred. These cleavable sequences can be located at any suitable point in the insert sequence, such that selected portions or the entire insert sequence can be selectively removed from the GSH site. Therefore, the method can be extended to remove and / or replace the insert sequence or a portion thereof from the GSH. Thus, the cleavable site can be side-mounted to a portion / entire portion of the insert sequence that may need to be removed. This method can be used to remove transcriptional regulatory factors and / or other genetic material. The portion of the insert sequence to be removed can be any portion of the insert—up to 99%—i.e., 1-99%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or less than 10%.

[0139] Preferably, the portion of the insert sequence adjacent to the cleavable site includes a constitutive promoter. Alternatively, the portion of the insert sequence adjacent to the cleavable site may not include a constitutive promoter.

[0140] The preferred cleavable sequence is the loxP site of the Cre recombinase because it allows direct replacement of the removed insert sequence. Alternatively or additionally, the cleavable sequence is the rox site of the Dre recombinase.

[0141] Preferably, the insertion at the first GSH site occurs at two loci in the genome, so each allele is modified by the insertion. This allows for greater expression of genes encoding transcriptional regulatory factors and any related genetic material.

[0142] Induction box

[0143] The inducible cassette includes the desired genetic sequence, preferably the DNA sequence to be transferred into the cell. In the method of the present invention, introducing the inducible cassette into the genome has the potential to alter the cell phenotype by activating endogenous genes.

[0144] Specifically, the inducible cassette contains the genetic sequence of a transgene encoding one or more master regulators. A "master regulator" is an expressed gene that influences the expression of a cell lineage. A master regulator network may be needed to determine the cell lineage. As used herein, a master regulator expressed at the beginning of a developmental lineage or cell type participates in the specialization of that lineage by directly regulating or through a cascade of gene expression changes in multiple downstream genes. If a master regulator is expressed, it can reassign the fate of cells destined to form other lineages. Examples of master regulators include transcription factors, transcriptional regulators, cytokine receptors, or signaling molecules.

[0145] In other embodiments, the inducible cassette contains a genetic sequence encoding a transcription factor. As used herein, "transcription factor" refers to a protein involved in gene regulation in both prokaryotes and eukaryotes. In one embodiment, a transcription factor may have a positive effect on gene expression and is therefore referred to as an "activator" or "transcription activator." In another embodiment, a transcription factor may have a negative effect on gene expression and is therefore referred to as a "repressor" or "transcription repressor." Activator and repressor are common terms, and their functions can be discerned by those skilled in the art.

[0146] In other embodiments, the inducible cassette contains a genetic sequence encoding a lineage-specific transcription factor. As used herein, a "lineage-specific transcription factor" refers to a protein that specifically or necessarily participates in determining the identity of a particular cell type, i.e., lineage. The specific identity of the lineage-specific transcription factor to be encoded will be understood to vary according to the desired lineage of the somatic cell.

[0147] In one implementation, transcription of the genetic sequence at the second GSH site (e.g., a lineage-specific transcription factor) results in the engineered iPSC being positively programmed into somatic cells.

[0148] The second GSH site can be any suitable GSH site. Preferably, the second GSH site is not linked to an endogenous promoter, so that the expression of the inserted inducible cassette is controlled solely by transcriptional regulatory proteins.

[0149] Differentiation methods

[0150] According to the method described in this paper, engineered iPSCs are induced to differentiate into somatic cells.

[0151] In one implementation, the method of inducing differentiation includes forward programming. Forward programming includes inducing the expression of one or more lineage-specific transcription factors. The generation of somatic cells using forward programming can be referred to as “cell reprogramming,” “forward reprogramming,” “direct programming,” or “direct differentiation,” i.e., the differentiation of (pluripotent) stem cells into somatic cells. Furthermore, “cell reprogramming” can be used as a general term to refer to the differentiation of source cells into target somatic cells using transcription factors.

[0152] In one implementation, forward programming includes increasing the expression of one or more lineage-specific transcription factors in iPSCs and culturing the cells under conditions suitable for forward programming the cells into somatic cells.

[0153] Forward programming can also be achieved by increasing the expression of one or more endogenous lineage-specific transcription factor genes in the iPSC, for example, using CRISPRa. Therefore, in some embodiments, the expression of one or more endogenous lineage-specific transcription factor genes is increased by targeting a transcriptional activating protein to one or more TSSs of the endogenous lineage-specific transcription factor gene by one or more gRNA sequences complementary to the TSS, for example by binding at least one transcriptional activating protein to an aptamer sequence in the gRNA, or by targeting the TSS with a non-catalytically active CRISPR enzyme, for example because at least one transcriptional activating protein is fused to a non-catalytically active CRISPR enzyme. Thus, in one embodiment, the gRNA sequence is complementary to the TSS of the endogenous lineage-specific transcription factor gene.

[0154] In one implementation, the method for inducing differentiation includes directed differentiation. Directed differentiation involves culturing iPSCs under conditions required for inducing differentiation into somatic cells.

[0155] The term "culture" as used in this article includes adding cells to a culture medium containing growth factors and / or essential nutrients. It should be understood that these culture conditions can be adjusted depending on the cells or cell population to be generated.

[0156] In one embodiment, engineered iPSCs are frozen and then thawed before differentiation. A distinguishing feature of the invention is the cryopreservation of pre-differentiated cells carrying CRISPR-related proteins. In one embodiment, differentiation is initiated, and the pre-differentiated cells, i.e., cells that have already lost their pluripotency, are frozen and then thawed before differentiation. Cryopreservation is critical for practical applications and scaling in production processes, as the development of production lines requires the use of cryopreserved cells.

[0157] Cells & Cell Compositions

[0158] The methods described in this article involve differentiating iPSCs into somatic cells. iPSCs (induced pluripotent stem cells) are cells that are reprogrammed into an embryonic stem cell-like state through induction of the expression of genes and factors essential for maintaining embryonic stem cell characteristics. A 2006 study demonstrated that overexpression of four specific transcription factors can convert adult cells into pluripotent stem cells. Certain members of the Oct-3 / 4 and Sox gene families have been identified as potential key transcriptional regulators involved in the induction process. Other genes, including certain members of the Klf, Myc, Nanog, and Lin28 families, can increase induction efficiency. Examples of genes that can be used as reprogramming factors to generate iPSCs include Oct3 / 4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, β-catenin, Lin28b, Sall4, Esrrb, Tbx3, and Glis1, GATA3, GATA6. These reprogramming factors can be used alone or in combination of two or more of them. In particular, reprogramming factors may include at least Yamanaka factors, namely Oct3 / 4, Sox2, Klf4, and c-Myc. The term "pluripotency" as used herein refers to the cell's potential to differentiate into all cell types / lineages found in an organism. Pluripotent stem cells are capable of differentiating into fewer cell types than pluripotent cells, such as only those closely related cell lineages. Low-potential stem cells (iPSCs) can only differentiate into a few cell types, such as lymphoid or bone marrow-like stem cells. Unipotent cells can only produce one cell type and are therefore lineage-specific, but possess the ability to self-renew, which distinguishes them from non-stem cells (e.g., progenitor cells that cannot self-renew). iPSCs are of particular interest in this invention. Therefore, preferably, the cells used in the methods of this invention do not require the destruction of an embryo, such as a human embryo. In some embodiments, the cells are not derived from human or animal embryos; that is, this invention does not extend to any method involving the destruction of human or animal embryos.

[0159] In one implementation, the iPSCs are derived from a mammal. In other implementations, the mammal is a human. Therefore, in this particular implementation, the iPSCs are derived from a human, and are thus human stem cells. In alternative implementations, the iPSCs are derived from marsupial, non-human primate, camel, or livestock cells. Livestock include, for example, pigs, cattle, horses, buffalo, bison, goats, sheep, deer, reindeer, donkeys, Javanese bison, yaks, chickens, ducks, and turkeys.

[0160] In other alternative embodiments, the mammal is a mouse, and the iPSCs are optionally mouse stem cells. Methods for preparing induced pluripotent stem cells from mice are known in the art. Inducing iPSCs typically requires expression or contact with at least one member of the Sox family and at least one member of the Oct family. Sox and Oct are considered central to the transcriptional regulatory hierarchy that designates the identity of ES cells. For example, Sox may be Sox-1, Sox-2, Sox-3, Sox-15, or Sox-18; Oct may be Oct-4. Other factors may increase reprogramming efficiency, such as Nanog, Lin28, Klf4, or c-Myc; a specific reprogramming factor set may be a set containing Sox-2, Oct-4, Nanog, and optionally Lin-28; or a set containing Sox-2, Oct4, Klf, and optionally c-Myc. In one approach, iPSCs can be generated by transfecting cells with the transcription factors Oct4, Sox2, c-Myc, and Klf4 using viral transduction.

[0161] In one implementation, the iPSCs are derived from the patient's somatic or germ cells, such as those of a patient awaiting treatment or a subject requiring treatment. This application of autologous homologous cells eliminates the need for cell-recipient matching. Alternatively, commercially available iPSCs may be used, such as those available from WICELL (WiCell Research Institute, Inc., Wisconsin, US). Alternatively, the cells may be tissue-specific stem cells, which may also be autologous or donated.

[0162] As used herein, the term "somatic cell" includes any type (i.e., lineage) of cells constituting an organism, excluding germ cells and undifferentiated stem cells. The methods of the present invention may include differentiating iPSCs into early or late somatic cells. Therefore, somatic cells may include, for example, but not limited to, neurons, glial cells, leukocytes (e.g., white blood cells), liver cells (e.g., hepatocytes), muscle cells (e.g., myocytes), or fibroblasts. In one embodiment, the somatic cell may be an adult cell or a cell derived from an adult that exhibits one or more detectable characteristics of adult or non-embryonic cells.

[0163] The somatic cells differentiated from iPSCs mentioned in this article refer to cells that contain the somatic cell phenotype and / or characteristics (e.g., surface phenotypes and / or functional characteristics associated with a particular lineage).

[0164] This method can generate cells (i.e., differentiated cells) exhibiting at least one characteristic of target cells. One or more characteristics can be used to select somatic cells generated by the method of the present invention.

[0165] Features include, but are not limited to, the expression of cellular markers, the detection or quantification of enzyme activity, and the characterization of morphological features and intercellular signals. Functional assays may also be used, for example, to assess the biological function of target cells.

[0166] The method may include determining differentiated cells obtained by the methods described herein and identifying a set of transcription genes; comparing the set of transcription genes of the differentiated cells with one or more reference sets of transcription genes from one or more reference somatic cells; and identifying a match between the differentiated cells and the reference somatic cells.

[0167] In one embodiment, the method includes the following steps: identifying differentiated cells as a type of somatic cell by measuring the morphological characteristics of the differentiated cells and matching the morphological characteristics with those of a reference tissue or cell.

[0168] In one embodiment, the method includes the steps of: identifying differentiated cells as a type of somatic cell by measuring the expression of protein markers in differentiated cells and matching the protein marker expression with the expression of protein markers in reference somatic cells.

[0169] In one implementation, the method includes the step of identifying differentiated cells as somatic cell types by measuring function and matching said function with the function of reference somatic cells.

[0170] In one embodiment, differentiated cells obtained by the method of the present invention can express a target cell phenotype. This phenotype can be defined by the expression (+) or non-expression (-) of one or more markers. Differentiated cells may also be negative for pluripotency markers (i.e., the differentiated cells are non-pluripotent).

[0171] Alternatively, certain differentiated cells can be sorted from other differentiated cells and from cells based on the expression of their lineage-specific cell surface antigens. Another approach is to assess expression at the RNA level, such as by RT-qPCR or by single-cell RNA sequencing, without any sorting or pre-selection steps. Such techniques are known in the art.

[0172] In one embodiment, the somatic cells are selected from: neurons (e.g., GABAergic neurons, sensory neurons, glutamatergic neurons, or motor neurons), glial cells (e.g., microglia, oligodendrocytes (or oligodendrocyte-like cells), or astrocytes), or muscle cells (e.g., skeletal muscle cells). In other embodiments, the somatic cells are neurons, such as glutamatergic neurons, or glial cells, such as microglia.

[0173] In one embodiment, iPSCs can differentiate into neurons, such as glutamatergic neurons. Neurons can be defined by their morphology and / or function (e.g., neurotransmitters, polarity, and signal orientation). In other embodiments, the neurons are glutamatergic neurons. Such neurons are characterized by the expression of the glutamate transporter genes VGLUT1 and VGLUT2.

[0174] Neurons can induce the generation of one or more neuron-specific transcription factor genes. Examples of such genes include endogenous... NEUROG2 (Neuron-2 or NGN2) gene and NEUROD1 (Neuron differentiation 1) gene. Therefore, in one embodiment, the method includes inducing... NGN2 Genes are used to induce engineered iPSCs to differentiate into neurons (such as glutamatergic neurons). This induction can be achieved through directed differentiation methods or forward programming (e.g., where an inducible cassette inserted at the second GSH site contains encoding...). NGN2 (The genetic sequence) is used.

[0175] In one implementation, iPSCs can differentiate into glial cells, such as microglia.

[0176] In some aspects of the invention, cells obtained by the methods described herein are provided. In particular, somatic cells obtained by the methods described herein are provided. Thus, in some aspects of the invention, cells (e.g., somatic cells) obtained by a method of forward programming iPSCs are provided, the method comprising targeted insertion of three different GSH sites as described herein.

[0177] Therefore, in other aspects of the invention, a cell having a modified genome is provided, said modified genome comprising: (i) The inserted genetic sequence that encodes a transcriptional regulatory protein at the first GSH site; (ii) an inserted inducible cassette containing a genetic sequence operatively linked to an inducible promoter at a second GSH site, wherein the inducible promoter is regulated by a transcriptional regulatory protein; and (iii) An inserted genetic sequence operatively linked to a promoter, which encodes a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof; The first and second GSH sites are different, and The genetic sequence encoding the CRISPR enzyme, the non-catalytically active CRISPR enzyme, or a derivative thereof is inserted at a site different from the first GSH site and the second GSH site.

[0178] In one embodiment, an inserted genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof is inserted at a third GSH site, wherein the third GSH site is different from the first GSH site and the second GSH site.

[0179] In one implementation, the cell stably or inducedly expresses a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof.

[0180] As described herein, in a preferred embodiment, the cell is an iPSC, particularly a human iPSC. In this embodiment, the cell does not contain a gRNA sequence. The cells of the present invention do not contain guide RNA during the pluripotent phase.

[0181] In an alternative embodiment, the cell is a somatic cell differentiated from an iPSC, particularly a human cell. In this embodiment, the cell additionally contains an inserted genetic sequence encoding a gRNA sequence operatively linked to a constitutive promoter.

[0182] In other aspects of the invention, an engineered iPSC is provided comprising a genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof, the genetic sequence being operatively linked to a promoter and optionally a reporter gene and a self-cleaving peptide, wherein the genetic sequence is inserted at a GSH site, and wherein the GSH site does not contain any other exogenous coding sequence.

[0183] In one implementation, the promoter is either constitutive or inductive.

[0184] In one embodiment, the cells, or cells obtained by the methods described herein, are provided as a pharmaceutical composition.

[0185] Pharmaceutical compositions may include cells as described herein in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include: buffers such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates such as glucose, mannose, sucrose, or dextran, mannitol; proteins; peptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Cryopreservation solutions that can be used for the pharmaceutical compositions of the present invention include, for example, DMSO.

[0186] For manufacture, dispensing and use, the cells described herein may be provided in the form of cell cultures or suspensions in isotonic excipients or culture media, optionally frozen for ease of transport or storage.

[0187] It is readily understood that the methods described above, or any / all steps thereof, can be performed in vivo, in vitro, or outside the body. In a specific embodiment, the methods described above, or any / all steps thereof, are performed in vitro, for example, in vitro.

[0188] Uses, therapeutic uses & treatment methods

[0189] Cells generated according to any of the methods described herein can be applied to basic and medical research, diagnostic and therapeutic methods. Cells can be used to study cell development in vitro, provide new drug testing systems, develop screening methods, examine treatment protocols in detail, and provide diagnostic tests. Introducing CRISPR-related proteins can achieve single-gene knockout, inhibition, or activation (e.g., using CRISPRi or CRISPRa methods respectively), and can be extended to high-throughput pooled or array-based CRISPR screening for applications in functional genomics, disease model building, drug target identification, and basic human biology research. Various methods can also be combined, for example, for validation purposes: for instance, CRISPR activation experiments can be used to validate the results of CRISPR knockout or inhibition screening, and vice versa, where activation will produce reciprocal results compared to inhibition or knockout, thereby increasing confidence in any identified target. These uses constitute part of the invention. Alternatively, cells can be transplanted into human or animal patients for diagnostic or therapeutic purposes. The invention also includes the use of the cells in therapy.

[0190] Therefore, according to one aspect of the invention, cells as defined herein are provided for therapeutic purposes.

[0191] According to another aspect of the invention, the cells defined herein are used to treat cancer, neurological disorders, inflammatory diseases, autoimmune diseases, and / or chronic infectious diseases.

[0192] According to another aspect of the invention, the cells defined herein are used for in vitro diagnostics.

[0193] According to another aspect of the invention, the cells defined herein are used for drug screening, drug target identification, or drug target validation.

[0194] According to another aspect of the invention, the cells defined herein are used for functional genomic screening. In particular, the cells defined herein can be used for CRISPR screening and, for example, for identifying genotype-phenotype relationships in somatic cells derived from iPSCs.

[0195] Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by one skilled in the art to which this invention pertains. The term "about" as used herein includes a range of up to 10% higher and down to 10% lower (inclusive) than the specified value, and where appropriate, a range of up to 5% higher and down to 5% lower (inclusive), particularly referring to the specified value itself. As used herein, the term "between" includes values ​​at specified boundaries.

[0196] It should be understood that all embodiments described herein are applicable to all aspects of the invention, and vice versa; and such combinations will be apparent from the description provided herein and to those skilled in the art.

[0197] Other features and advantages of the invention will be apparent from the description provided herein. However, it should be understood that while the specification and specific embodiments point to preferred embodiments of the invention, they are given by way of illustration only, as various changes and modifications will be apparent to those skilled in the art.

[0198] The present invention will now be described through the following non-limiting embodiments: Example

[0199] Example 1: Genetic engineering strategy for Cas9 expressing glutamatergic neurons

[0200] method

[0201] The aim of this experiment was to generate iPSC cell lines for two purposes: (i) those that could be positively programmed via overexpression of transcription factors (e.g., NEUROG2 (NGN2) in glutamatergic neurons), and (ii) those that constitutively expressed the Cas9 protein, enabling gene editing in positively programmed / differentiated cells. Additionally, three transgenes were integrated into genomic safe harbor sites (GSHs) via genome engineering (see [link to study]). Figure 1 First, a reverse Tet transactivation protein (rtTA) cassette driven by a CAG promoter controlled by doxycycline for the second recombinant transgene was integrated into the ROSA26 locus. Second, transcription factors controlled by doxycycline-responsive promoters (e.g., NGN2) were integrated into the AAVS1 locus. Finally, a full-length Cas9 protein driven by the CAG promoter was integrated into the CLYBL locus, upstream of the P2A ribosomal jumping sequence and the fluorescent protein, to verify the integration.

[0202] Experiment Overview

[0203] The iPSC cell lines were kept in culture. Safe Harbor loci were then edited. All three loci were edited using CRISPR / Cas9 technology. sgRNAs with DNA double-strand breaks were selected and introduced near the chosen insertion sites. Cells were nuclear transfected with two plasmids—one expressing Cas9 and the corresponding sgRNA, and the other containing the insert sequence with a side homologous arm. The PAM sequence was mutated to prevent Cas9 re-cleavage.

[0204] Select cells carrying the correct integration (e.g., using antibiotic resistance markers and corresponding antibiotics). Once selection has reached sufficient efficiency, the cells dissociate into single cells. To obtain monoclonal cell lines, cells are seeded at low density to allow colonies derived from single cells to grow.

[0205] Two rounds of genotyping were performed on the engineered lines using PCR. The first round of genotyping was performed on the crude lysates. Once clones with correct integration were identified, cells were amplified, and genomic DNA was isolated for the second round of genotyping. PCR was performed to confirm correct integration of the 5' and 3' homologous arms and the inserted sequence. Additionally, PCR was performed to confirm whether the clones were heterozygous or homozygous for the expected integration.

[0206] result

[0207] The final iPSC cell line has been engineered to incorporate a dual safe harbor system, allowing for transcription factor overexpression. It contains transcription factors essential for positive programming into glutamatergic neurons. Additionally, the cell line constitutively expresses the Cas9 protein, facilitating further genomic manipulation.

[0208] Example 2: Benchmarking of Cas9 expression and activity in the iPSC stage

[0209] method

[0210] To measure Cas9 activity in iPSCs, a guide RNA targeting the β2-microglobulin (B2M) gene (GGCCGAGATGTCTCGCTCCG, SEQ ID NO: 2) was cloned into a lentiviral vector; this gene is expressed in all nucleated cells. The vector used encodes a puromycin resistance cassette for selecting cells with successful genome integration. Additionally, the vector contains GFP to assess the multiplicity of infection. The lentiviral vector was used to transduce iPSCs carrying rtTA transactivator protein, constitutive full-length Cas9, and transcription factor NGN2, which is essential for forward programming under the control of the Tet response promoter.

[0211] Experiment Overview

[0212] Prior to lentiviral transduction, iPSCs were amplified on standard tissue culture plates. Cells were transduced using a lentiviral vector targeting B2M. After transduction, cells were cultured for three days as described above, harvested, and stained to express B2M (ThermoFisher, MA5-18119) to verify the presence of insertions and deletions, thereby disrupting the open reading frame of B2M.

[0213] result

[0214] Figure 2 This demonstrates a loss of B2M protein expression after delivery of the specific sgRNA compared to the untransduced and unstained controls. The loss was quite significant and was observed in most cells that received the B2M-specific guide RNA (86% of B2M-negative cells; gated on GFP-positive cells). This confirms that Cas9 is active and that the activity was uniform in individual cells in the experiments.

[0215] Example 3: Comparison of glutamatergic neurons and glutamatergic neurons using immunofluorescence staining of neuronal markers. Neuron CRISPR-Ready

[0216] method

[0217] To investigate potential changes in protein expression profiles between “glutamatergic neurons” and “CRISPR-Ready glutamatergic neurons,” immunofluorescence was used, focusing on three key neuronal biomarkers: TUBB3, MAP2, and VGLUT2. Analysis was performed on day 11 post-resuscitation.

[0218] Experiment Overview

[0219] Cells were seeded (day 4) and cultured in medium to support differentiation into glutamatergic neurons. During their reprogramming, the cells underwent several changes in the culture medium. On day 0, the cells were cryopreserved. After thawing, the cells were cultured until day 11 for immunofluorescence staining.

[0220] Cells were fixed in DPBS (ThermoFisher, 14190144) with 4% paraformaldehyde (ThermoFisher, 11586711). After fixation, a blocking solution containing donkey serum (Sigma-Aldrich, D9663) or goat serum (Sigma-Aldrich, G9023) was applied. Cells were then labeled with primary antibodies: VGLUT2 (Millipore, MAB5504), MAP2 (Abcam, ab5392), or TUBB3 (Biolegend, 801202H). After primary labeling, secondary antibody labeling was performed using a combination of DAPI (Biotechne, 5748 / 10) with donkey anti-mouse Alexa Fluor 488 (ThermoFisher, A-21202) or goat anti-chicken Alexa Fluor 647 (ThermoFisher, A-21449). After labeling, the cells were washed and imaged at 10x magnification using a Leica DMi8 fluorescence microscope.

[0221] result

[0222] A thorough analysis of the protein expression profiles of glutamatergic neurons and glutamatergic neuron CRISPR-Ready cells on day 11 post-resuscitation revealed no significant differences in the expression of neuronal markers TUBB3, MAP2, and VGLUT2. Both cell lines exhibited comparable staining intensity and patterns in immunofluorescence assays, indicating that stable Cas9 expression does not affect the cells' ability to differentiate into glutamatergic neurons (see [link to relevant documentation]). Figure 3 ).

[0223] Example 4: Comparison of glutamatergic neurons and CRISPR-mediated glutamatergic neurons using extensive RNA sequencing Ready to assess transcriptomic differences

[0224] method

[0225] To ensure that Cas9 expression did not cause differences between “glutamatergic neurons” and “glutamatergic neuron CRISPR-Ready”, a comparative analysis was performed. Using extensive RNA sequencing, this study aimed to identify any global transcriptomic level changes between the two cell lines. Assessments were conducted at the iPSC stage and on days 4 and 18 post-resuscitation.

[0226] Experiment Overview

[0227] To obtain glutamatergic neurons, cells were cultured as in Example 3, but continuous culture was used in this experiment.

[0228] For each time point, experiments were performed in triplicate to ensure reproducibility and accuracy. Total mRNA from these samples was isolated and libraries were prepared. Bioinformatics analysis involved aligning sequence reads to a reference genome, quantifying gene expression, and normalizing the data. Statistical models were then used to identify differentially expressed genes among the samples, providing insights into potential changes in the transcriptomic profile.

[0229] result

[0230] Comprehensive transcriptomic analysis was performed using extensive RNA sequencing data to assess potential transcriptomic differences between Cas9-expressing and Cas9-non-expressing cells. Principal component analysis (PCA), a statistical method widely used to highlight variations and generate strong patterns in datasets, was used to elucidate multidimensional transcriptomic differences. Results showed that at each time point of analysis, CRISPR-Ready glutamatergic neurons clustered tightly with glutamatergic neurons, indicating similar transcriptomic profiles between the two cell types (see [link to analysis]). Figure 4 This consistency in global gene expression was evident at all three time points.

[0231] Example 5: Western blot analysis of Cas9 expression over time in CRISPR-Ready glutamatergic neurons

[0232] method

[0233] Western blot analysis was used to assess Cas9 expression in glutamatergic neurons during forward programming and maturation.

[0234] Experiment Overview

[0235] To obtain glutamatergic neurons, cells were cultured as in Example 3, but continuous culture was used in this experiment.

[0236] Western blot analysis was used to assess changes in Cas9 expression over time. Cells were first harvested, washed in ice-cold PBS (Gibco, 20012027), and lysed using RIPA buffer supplemented with protease inhibitors. After centrifugation to remove cell debris, protein concentration in the supernatant was determined using a BCA assay. Proteins were then subjected to SDS-PAGE and transferred to a methanol-activated PVDF membrane. The membrane was blocked and incubated with a primary antibody specifically targeting Cas9. Actin was used as a loading control to ensure consistent loading volume and validate results. After incubation with the primary antibody, the membrane was probed with an HRP-conjugated secondary antibody. Cas9 expression was observed using the Amersham™ ECL™ Prime Western blot system.

[0237] result

[0238] Western blot analysis showed that Cas9 expression decreased over time at the detection time point (see [link]). Figure 5 The differentiation process consists of two stages: pre-differentiation and stabilization / maturation. D0 represents the day of cryopreservation. Days with a negative sign indicate the differentiation period before cryopreservation. Days without a negative sign indicate the time after thawing.

[0239] By day 6, no Cas9 expression was detected. This transient nature of observed Cas9 expression underscores the importance of timing in genome editing experiments. Considering these findings, the optimal time window for introducing the guide RNA is between 24 and 72 hours post-cell resuscitation. Utilizing this window ensures the precise formation of the Cas9-guide RNA complex, thereby facilitating the introduction of precise double-strand breaks.

[0240] Example 6: Amplicon sequencing analysis of indels formed in the SOX11 gene

[0241] method

[0242] To assess the functionality of Cas9 in forward-programmed cells, amplicon sequencing was used to examine the knockout efficiency of the SOX11 gene at the DNA level. The aim was to establish and optimize two different guided delivery methods: a lipid-based approach using RNAiMAX and a lentiviral delivery system.

[0243] Experiment Overview

[0244] Guide RNA was introduced into cells using RNAiMAX and lentivirus on days 1 and 3 post-resuscitation. The guide RNA sequence targeting SOX11 was: GAGAAGATCCCGTTCATCC (SEQ ID NO: 3). The guide RNA sequence non-targeting control was: GCTACCCGCGCGAGAATTGC (SEQ ID NO: 4).

[0245] Lipid-based delivery: The guide RNA delivery protocol was adapted according to the manufacturer's instructions provided with Lipofectamine® RNAiMAX Reagent (ThermoFisher, 13778075). This protocol was designed to be flexible to accommodate varying applications. For transfection, microcentrifuge tubes labeled A, B, and C were set up. Tube A contained DMEM / F-12 medium combined with sgRNA, while tube B contained a mixture of DMEM / F-12 medium and RNAiMAX reagent. The contents of tubes A and B were combined into tube C, thoroughly mixed by vortexing, and incubated at room temperature for 5 minutes. The sgRNA-RNAiMAX mixture obtained from tube C was then evenly distributed dropwise into the desired wells or dishes. Depending on the well size, the final concentration of sgRNA at the time of cell introduction was 2 pmol for a 96-well plate, 10 pmol for a 24-well plate, and 50 pmol for a 6-well plate. The plates were then returned to the incubator for 24 hours, and the medium was refreshed based on the transfection time.

[0246] Lentiviral delivery: Strictly following the manufacturer's instructions, precipitate the lentivirus-containing supernatant using PEG-it™ Viral Precipitation Solution (System Biosciences, LV810A-1). Assess transduction efficiency using lentivirus at 24-hour and 72-hour intervals after cell resuscitation. Calculate the required viral volume per well or dish for the transduction process. Then, uniformly add the diluted lentivirus dropwise to the designated wells or dishes, ensuring even distribution with gentle agitation. The plates are then returned to the incubator for 24 hours. After this period, completely replace the culture medium based on the specific transduction time. Then continue with routine cell culture maintenance, applying the selected readout method at appropriate times.

[0247] Five days after guide delivery, genomic DNA was extracted from treated cells. Target regions within the SOX11 gene were amplified (primer 1: ACCCAGACTGGTGCAAGA (SEQ ID NO: 5); primer 2: GCTTTCTCTGGGCTCTG (SEQ ID NO: 6), indexed, and analyzed using next-generation sequencing (NGS) to measure indel formation. Non-targeted guides were used as experimental controls. For bioinformatics analysis, raw sequencing reads were quality checked and filtered. Reads were mapped to SOX11 gene regions using a reference alignment. Indel events at the target sites were identified and quantified. The frequency of insertions and deletions in samples treated with the targeted guide was compared to controls to assess the specificity and efficiency of the editing introduced by the guide RNA.

[0248] result

[0249] Analysis of NGS data revealed a significant percentage of indel formation within the target region of the SOX11 gene (see [link]). Figure 6 The efficiency of indel formation varies based on the guide delivery method and the timing of introduction. Specifically, indel formation ranges from 67% to 87%, depending on conditions. Non-targeted guides serve as controls, confirming the specificity and efficiency of editing introduced by targeted guide RNA.

[0250] Example 7: Immunofluorescence staining analysis of SOX11 expression after lipid-based guide RNA delivery.

[0251] method

[0252] After confirming Cas9 functionality at the DNA level, the knockout efficiency of SOX11 was further evaluated at the protein level using immunofluorescence staining. Image analysis was used to directly assess the impact of genome editing following lipid-based guide RNA delivery on SOX11 protein expression.

[0253] Experiment Overview

[0254] As described in Example 6, gRNA was delivered to revive cells. On day 11 post-revival, cells were used for immunofluorescence staining. To prevent cell detachment, cells were first fixed by replacing half the volume of culture medium with 8% paraformaldehyde (PFA) from ThermoFisher (catalog number: 11586711), followed by a second fixation with only 4% PFA. After multiple washes with PBS (Gibco, 20012027), cells were incubated overnight at 4°C with primary antibody (SOX11 monoclonal antibody from ThermoFisher, 14-9773-82). After washing, cells were incubated with secondary antibody and DAPI (Biotechne, 5748 / 10) for one hour. After a series of washes with 0.1% Triton-X (Sigma, T8787), cells were stored in PBS until subsequent analysis. An advanced image analysis workflow was used to assess knockout efficiency. This workflow integrates deep learning methods specifically tailored for precise nucleus identification. Using this method, the intensity and distribution of DAPI and SOX11 signals, which indicate the cell nucleus, were meticulously quantified. Based on the correlation between DAPI and SOX11 signals, the obtained data provide an accurate measurement of SOX11 knockout efficiency at the protein level.

[0255] result

[0256] On days 1 and 3, guide RNA was delivered to cells using RNAiMAX. By day 11, SOX11 expression was detected by immunofluorescence staining. Cell nuclei were labeled with DAPI staining, and a non-targeted guide RNA was used as a control. Image analysis showed that significant knockout of the SOX11 protein occurred after the introduction of the SOX11-specific gRNA (see [link to image]). Figure 7 ).

[0257] Example 8: Immunofluorescence staining analysis of SOX11 expression after lentiviral guide RNA delivery.

[0258] method

[0259] After confirming Cas9 functionality at the DNA level, the knockout efficiency of SOX11 was further evaluated at the protein level using immunofluorescence staining. Image analysis was used to directly assess the impact of genome editing following lentiviral guide RNA delivery on SOX11 protein expression.

[0260] Experiment Overview

[0261] An overview of the experiment is described in Example 7. Guide RNA was delivered via lentiviral transduction as described in Example 6.

[0262] result

[0263] Guide RNA was delivered to cells via lentiviral transduction on days 1 and 3. SOX11 expression was detected by immunofluorescence staining by day 11. Cell nuclei were labeled with DAPI staining, and a non-targeted guide RNA was used as a control. Image analysis showed that significant knockout of SOX11 protein occurred after the introduction of the SOX11-specific gRNA (see [link to image]). Figure 8 ).

[0264] Example 9: UMAP visualization of pooled scCRISPR screenings shows the interactions between specific gene knockouts. Transcriptome similarity.

[0265] method

[0266] The main objective of this experiment is to demonstrate the use of the “Glutamate Neuron CRISPR-Ready” technology for pooled single-cell CRISPR (scCRISPR) screening on a set of 100 genes associated with neurodegenerative diseases.

[0267] Experiment Overview

[0268] A plasmid library encoding CRISPR guide RNAs of 100 genes associated with neurodegenerative diseases: For each gene, four guide RNAs were designed and synthesized, including a non-targeted RNA and a gene desert control. The guide RNAs were cloned into lentiviral vectors in a pooled manner. The vectors used encoded puromycin resistance cassettes for selecting cells with successful genome integration. Additionally, the vectors contained GFP for assessing the multiplicity of infection. Library quality was evaluated using next-generation sequencing. Cell culture scale and transduction parameters were optimized to ensure adequate coverage.

[0269] Filtering Overview: As described in Example 6, glutamatergic neurons were revived prior to transduction. After transduction on day 3, cells were cultured, and successful genome integration was selected by adding puromycin to the culture medium. Following selection, cells were harvested and single cells were dissociated. Dissociated single cells were processed on a 10X Genomics Chromium machine.

[0270] Single-cell transcriptome analysis and sgRNA capture: Following the manufacturer's instructions, glutamatergic neurons were analyzed by scRNA-seq using the 10X Genomics Chromium Single Cell 5' Kit v2. Guide RNA was captured by incorporating guide-capture oligonucleotides, as described in the literature (Replogle et al., Nature Biotechnology 2020). 10233 cells were recovered from the 10X Genomics Chromium X machine. After the cDNA amplification step, gene expression and guide RNA libraries were generated and sequenced on a NovaSeq sequencer.

[0271] Data Analysis: We further analyzed single-cell gene expression data processed by the STARsolo tool (Kaminow et al., bioRxiv, 2021) in Seurat v4 (Hao et al., Cell, 2021) and visualized them on a uniform manifold approximation and projection (UMAP) plot (Becht, Nature Biotech, 2019).

[0272] result

[0273] Single-cell transcriptomic analysis of gene knockout in forward-programmed glutamatergic neurons revealed distinct transcriptomic phenotypes resulting from the disruption of disease-related genes. Notably, cells with knockouts of AARS1, CARS1, HARS1, and GARS1 clustered together, confirming that these genes were effectively perturbed (see [link to original text]). Figure 9These aminoacyl-tRNA synthases (aaRS) play a crucial role in the initial stages of protein biosynthesis, facilitating the precise loading of transfer RNA (tRNA) with its corresponding amino acids. In addition to their critical role in protein synthesis, these enzymes also contribute to protein quality control and proper protein folding within the endoplasmic reticulum (ER). Notably, loss-of-function mutations in these genes have been reported in patients with Charcot-Marie-Tooth disease, highlighting their clinical relevance and suggesting their role in the pathogenesis of this neurodegenerative disorder. These findings not only elucidate cellular processes and their relevance to Charcot-Marie-Tooth disease but also demonstrate the potential for meaningful biological discoveries using these cellular methods.

[0274] Example 10: Genetic Engineering Strategy for Microglia Expressing Cas9

[0275] method

[0276] The aim of this experiment was to generate iPSC cell lines for two purposes: (i) those that could be positively programmed via overexpression of transcription factors (e.g., SPI1-CEBPB for microglia), and (ii) those that constitutively expressed the Cas9 protein to enable gene editing in positively programmed / differentiated cells. Additionally, three transgenes were integrated into genomic safe harbor sites (GSHs) through genome engineering. First, a reverse Tet transactivation protein (rtTA) cassette driven by a doxycycline-controlled transactivator of the CAG promoter, used for the second recombinant transgene, was integrated into the ROSA26 locus. Second, a transcription factor controlled by a doxycycline-responsive promoter was integrated into the AAVS1 locus. Finally, a full-length Cas9 protein driven by the CAG promoter was integrated into the CLYBL locus, upstream of the P2A ribosomal jumping sequence and a fluorescent protein, to validate the integration.

[0277] Experiment Overview

[0278] The iPSC cell lines were kept in culture. Safe Harbor loci were then edited. All three loci were edited using CRISPR / Cas9 technology. sgRNAs with DNA double-strand breaks were selected and introduced near the chosen insertion sites. Cells were nuclear transfected with two plasmids—one expressing Cas9 and the corresponding sgRNA, and the other containing the insert sequence with a side homologous arm. The PAM sequence was mutated to prevent Cas9 re-cleavage.

[0279] Select cells carrying the correct integration (e.g., using antibiotic resistance markers and corresponding antibiotics). Once selection has reached sufficient efficiency, the cells dissociate into single cells. To obtain monoclonal cell lines, cells are seeded at low density to allow colonies derived from single cells to grow.

[0280] Two rounds of genotyping were performed on the engineered lines using PCR. The first round of genotyping was performed on the crude lysates. Once clones with correct integration were identified, cells were amplified, and genomic DNA was isolated for the second round of genotyping. PCR was performed to confirm correct integration of the 5' and 3' homologous arms and the inserted sequence. Additionally, PCR was performed to confirm whether the clones were heterozygous or homozygous for the expected integration.

[0281] result

[0282] The final iPSC cell line has been engineered to incorporate a dual safe harbor system, allowing for transcription factor overexpression. It contains transcription factors essential for positive programming into microglia. Additionally, the cell line constitutively expresses the Cas9 protein, facilitating further genomic manipulation.

[0283] Example 11: Comparison of transcriptome profiles between microglia and microglia CRISPR-Ready.

[0284] method

[0285] To ensure that Cas9 expression did not cause differences between microglia and microglia CRISPR-Ready cells, a comparative analysis was performed. Using extensive RNA sequencing, this study aimed to identify any global transcriptomic level changes between the two cell lines. Evaluations were conducted at the iPSC stage and on day 10 (before cryopreservation) and day 20 (day 10 after cryopreservation).

[0286] Experiment Overview

[0287] After thawing, the cells were cultured in a medium to support differentiation into microglia. During their reprogramming, the cells underwent several changes in the culture medium.

[0288] For each time point, experiments were performed in triplicate to ensure reproducibility and accuracy. Total mRNA from these samples was isolated and libraries were prepared. Bioinformatics analysis involved aligning sequence reads to a reference genome, quantifying gene expression, and normalizing the data. Statistical models were then used to identify differentially expressed genes among the samples, providing insights into potential changes in the transcriptomic profile.

[0289] result

[0290] Comprehensive transcriptomic analysis was performed using extensive RNA sequencing data to assess potential transcriptomic differences between Cas9-expressing and Cas9-non-expressing cells. Principal component analysis (PCA), a statistical method widely used to highlight variations and generate strong patterns in datasets, was used to elucidate multidimensional transcriptomic differences. Results showed that at each time point of analysis, CRISPR-Ready microglia clustered tightly within microglia, indicating similar transcriptomic profiles between the two cell types (see [link to analysis]). Figure 10 This consistency in global gene expression was evident at all three time points.

[0291] Example 12: Cells secreted between microglia and CRISPR-Ready microglia after LPS stimulation Comparison of factor spectra.

[0292] method

[0293] To ensure that Cas9 expression did not cause differences in the CRISPR-Ready activation state between microglia and microglia, comparative analysis was performed using the Proteome Profiler Human Cytokine Array Kit (R&D Systems, ARY005B).

[0294] Experiment Overview

[0295] Cells were cultured following the steps outlined in Example 11. On day 9 post-resuscitation, cells were treated with 100 ng / ml lipopolysaccharide (LPS) (R&D Systems, LPS25). After a 24-hour incubation period, the supernatant was collected, and cytokine release was analyzed using the Proteome Profiler Human Cytokine Array Kit (ARY005B, R&D Systems).

[0296] result

[0297] The results showed no discernible difference in cytokine secretion between microglia and microglia CRISPR-ready cells (see [link to study]). Figure 11 Both cell types showed significant activation in response to LPS stimulation, suggesting that the cytokine secretion profiles were similar in both cases.

[0298] Example 13: Benchmark test of Cas9 expression and activity in forward-programmed microglia

[0299] method

[0300] To measure Cas9 activity in D9 microglia (after cryopreservation), a guide RNA targeting the β2-microglobulin (B2M) gene (GGCCGAGATGTCTCGCTCCG, SEQ ID NO: 2) was cloned into a lentiviral vector; this gene is expressed in all nucleated cells. The vector used encodes a puromycin resistance cassette for selecting cells with successful genome integration. Additionally, the vector contains GFP to assess the multiplicity of infection. The lentiviral vector was used to transduce cells carrying a combination of rtTA transactivator protein, constitutive full-length Cas9, and transcription factors essential for forward programming under the control of the Tet response promoter.

[0301] Experiment Overview

[0302] Cells were cultured following the steps outlined in Example 11. On day 9 post-resuscitation, cells were transduced with a lentiviral vector targeting B2M. After transduction, cells were cultured for 5 days as described above, harvested, and stained to express B2M to verify the presence of insertions and deletions, thereby disrupting the open reading frame of B2M. Additionally, cells were stained with CD11b, a marker for microglia.

[0303] result

[0304] Figure 12 The study showed a loss of B2M protein expression after delivery of the specific sgRNA compared to the non-targeted control. The loss was quite significant and was observed in most cells that received the B2M-specific guide RNA (86.4% of B2M-negative cells; gated on GFP-positive cells). This confirms that Cas9 is active and that the activity was homogeneous in individual cells throughout the experiment. Cells remained CD11b positive after lentiviral transduction.

[0305] Example 14: Benchmark test of Cas9 expression and activity over time in forward-programmed microglia

[0306] method

[0307] To measure Cas9 activity in microglia at D1, D6, D9, and D18 (after cryopreservation), a guide RNA targeting the β2-microglobulin (B2M) gene (GGCCGAGATGTCTCGCTCCG, SEQ ID NO: 2) was cloned into a lentiviral vector; this gene is expressed in all nucleated cells. The vector used encodes a puromycin resistance cassette for selecting cells with successful genome integration. Additionally, the vector contains GFP to assess the multiplicity of infection. The lentiviral vector was used to transduce cells carrying a combination of rtTA transactivator protein, constitutive full-length Cas9, and transcription factors essential for forward programming under the control of the Tet response promoter.

[0308] Experiment Overview

[0309] Cells were cultured following the steps outlined in Example 11. Cells were transduced with a B2M-targeting lentiviral vector on days 1, 6, 9, and 18 post-resuscitation. Following transduction, cells were cultured for 5 days as described above, harvested, and stained to express B2M (ThermoFisher, MA5-18119) to verify the presence of insertions and deletions, thereby disrupting the open reading frame of B2M. Additionally, cells were stained with CD11b, a marker for microglia.

[0310] result

[0311] Flow cytometry analysis showed that B2M protein levels were significantly reduced after delivery of B2M sgRNA (see [link to relevant documentation]). Figure 13 This reduction was consistent in most cells receiving B2M-specific guide RNA (gated on GFP-positive cells; Day 1: 86.9%, Day 6: 84.8%, Day 9: 86.4%, Day 18: 78.4%), indicating that Cas9 is active and remains expressed over time. Importantly, this example highlights that Cas9 can tolerate silencing, a common problem. Cells transduced with gRNA remained CD11b positive.

[0312] Example 15: scCRISPR screening of microglial activation regulators after LPS stimulation

[0313] method

[0314] The main objective of this experiment is to demonstrate the use of “microglia CRISPR-Ready” cells for single-cell CRISPR (scCRISPR) screening on a pool of 110 genes associated with neurodegenerative diseases and microglia activation status.

[0315] Experiment Overview

[0316] A plasmid library encoding CRISPR guide RNAs of 110 genes associated with neurodegenerative diseases and microglial activation state: For each gene, four guide RNAs were designed and synthesized, including a non-targeted RNA and a gene desert control. The guide RNAs were cloned into lentiviral vectors in a pooled manner. The vectors used encoded puromycin resistance cassettes for selecting cells with successful genome integration. Additionally, the vectors contained GFP for assessing the multiplicity of infection. Library quality was evaluated using next-generation sequencing. Cell culture scale and transduction parameters were optimized to ensure adequate coverage.

[0317] Filtering Overview: As described in Example 11, microglia were revived prior to transduction. On day 9, after transduction, half of the cell plate was stimulated with LPS (100 ng / ml), while the other half remained untreated. After 24 hours, the cells were dissociated, and GFP cells were sorted using a cell sorter. The sorted single cells were processed on a 10X Genomics Chromium machine.

[0318] Single-cell transcriptome analysis and sgRNA capture: Microglia were analyzed using targeted sequencing reads. scRNA-seq was performed using the 10XGenomics Chromium Single Cell 3' Kit v2, following the manufacturer's instructions. Approximately 30,000 cells were recovered from the 10xGenomics Chromium X machine under each condition (+ / - LPS). Primer sets designed to capture activation signatures identified using large-scale RNA-seq were compiled and used for library preparation (Schraivogel et al., Nature Methods 2020). Following the cDNA amplification step, gene expression and guide RNA libraries were generated and sequenced on a NovaSeq sequencer.

[0319] Data Analysis: We further analyzed single-cell gene expression data processed by the STARsolo tool (Kaminow et al., bioRxiv, 2021) in Seurat v4 (Hao et al., Cell, 2021) and visualized them on a cosine similarity plot.

[0320] result

[0321] Figure 14The figure shows a heatmap highlighting genes identified as activation features in this study. These genes were identified by analyzing extensive RNA-seq data from LPS-treated (+LPS) and untreated (-LPS) cells, with genes arranged along the y-axis. To assess the similarity between the different conditions, cosine similarity analysis was used, utilizing non-targeted guides from LPS-treated (+LPS) and untreated (-LPS) conditions. Knockout mutations under LPS-treated conditions were plotted on the x-axis, showing that cells exhibited a higher similarity to untreated conditions without LPS, particularly those with non-targeted guides.

[0322] Notably, certain genes within the heatmap are shown in gray shading, indicating their association with the Toll-like receptor 4 (TLR4) pathway. This pathway is known to play a crucial role in microglial activation induced in response to LPS treatment. In summary, Figure 14 It provides an intuitive representation of genes containing activation signatures and their responses to LPS treatment, elucidated through cosine similarity analysis. Furthermore, it highlights the importance of genes linked to the TLR4 pathway in the context of LPS-triggered microglial activation, confirming the utility of CRISPR-ready cells employed in scCRISPR screening for generating biologically meaningful data.

[0323] Example 16: Genetic engineering strategy for glutamatergic neurons expressing dCas9-VPR

[0324] method

[0325] The aim of this experiment was to generate iPSC cell lines for two purposes: (i) those that could be positively programmed via overexpression of transcription factors (e.g., NEUROG2 (NGN2) in glutamatergic neurons), and (ii) those that constitutively expressed the dCas9-VPR protein to enable gene activation (CRISPRa) in positively programmed / differentiated cells. Additionally, three transgenes were integrated into genomic safe harbor sites (GSH) via genome engineering (see [link to study]). Figure 15 First, a reverse Tet transactivation protein (rtTA) cassette driven by a CAG promoter, which controls doxycycline transactivation for the second recombinant transgene, was integrated into the ROSA26 locus. Second, transcription factors controlled by doxycycline-responsive promoters (e.g., NGN2) were integrated into the AAVS1 locus. Finally, a CAG promoter-driven dCas9-VPR protein was integrated into the CLYBL locus.

[0326] Experiment Overview

[0327] The iPSC cell lines were kept in culture. Safe harbor loci were then edited. All three loci were edited using CRISPR / Cas9 technology. sgRNAs introducing DNA double-strand breaks near the selected insertion sites were selected. Cells were nuclear transfected with two plasmids—one expressing Cas9 and the corresponding sgRNA, and the other containing the insert sequence with side homologous arms. The PAM sequence was mutated to prevent Cas9 re-cleavage. Cells carrying correct integration were selected (e.g., using antibiotic resistance markers with the corresponding antibiotic). Once selection reached sufficient efficiency, cells were dissociated into single cells. To obtain monoclonal cell lines, cells were seeded at low density to allow colonies derived from single cells to grow. The engineered lines were genotyped twice by PCR. The first round of genotyping was performed on the crude lysates. Once clones with correct integration were identified, cells were amplified, and genomic DNA was isolated for the second round of genotyping. PCR was performed for correct integration of the 5' and 3' homologous arms and the insert sequence. In addition, PCR was performed to confirm whether the clone was heterozygous or homozygous for the expected integration.

[0328] result

[0329] The final iPSC cell line has been engineered to incorporate a dual safe harbor system, allowing for transcription factor overexpression. It contains transcription factors essential for positive programming into glutamatergic neurons. Additionally, this cell line constitutively expresses the dCas9-VPR protein, which facilitates CRISPR activation experiments.

[0330] Example 17: Benchmarking of dCas9-VPR expression and activity in the iPSC phase

[0331] To measure Cas9 activity in iPSCs, a guide RNA targeting the CD274 gene (GTCAGGAAAGTCCAACGCC, SEQ ID NO: 7) was cloned into a lentiviral vector; this gene is slowly expressed in iPSCs and ioglutamatergic neurons. The vector used encodes a puromycin resistance cassette for selecting cells with successful genome integration. Additionally, the vector contains GFP to assess the multiplicity of infection. The lentiviral vector was used to transduce iPSCs carrying rtTA transactivator protein, constitutive dCas9-VPR, and transcription factor NGN2, which is essential for forward programming under the control of the Tet response promoter.

[0332] Experiment Overview

[0333] iPSCs were amplified on standard tissue culture plates prior to lentiviral transduction. Cells were transduced using a lentiviral vector targeting CD274. After transduction, cells were cultured for three days as described above, harvested, and the expressed CD274 (BD Bioscience, 563741) was stained to verify CD274 activation.

[0334] result

[0335] Figure 16 This study demonstrated activation of CD274 protein expression following delivery of the specific sgRNA, compared to non-transduced, unstained, and non-targeted controls. Activation was observed in most cells receiving the CD274-specific guide RNA (98.96% of cells showed activation; gating was observed on GFP-positive cells). This confirms that the dCas9-VPR is functional.

[0336] Example 18: Benchmark test of dCas9-VPR functionality in ioglutamatergic neurons

[0337] method

[0338] After confirming the functionality of dCas9-VPR in the iPSC stage, the gene activation efficiency of CD274 was further evaluated in differentiated cells. Flow-based analysis was used to directly assess the impact of lentiviral guide RNA delivery on the gene activation of CD274 protein expression.

[0339] Experiment Overview

[0340] Lentiviral guide RNA delivery: Following the manufacturer's instructions precisely, the supernatant containing lentivirus was precipitated using PEG-it™ Viral Precipitation Solution (System Biosciences, LV810A-1). Transduction efficiency using lentivirus was assessed on days 1, 3, and 11 post-cell resuscitation. Diluted lentivirus was added dropwise to designated wells or dishes, ensuring uniform distribution with gentle agitation. The plates were then returned to the incubator for 24 hours. After this period, the culture medium was completely replaced based on the specific transduction time. Routine cell culture maintenance continued, and the selected reading method was applied at the corresponding time points. Three days post-guide RNA delivery, CD274 activation was assessed using flow cytometry-based readings. For this purpose, cells were dissociated and stained with CD274 antibody. CD274 signal was measured using an FACS instrument after incubation and washing steps. Untransduced and unstained cells, as well as cells with non-targeted guide RNA, served as controls.

[0341] result

[0342] Guide RNA was delivered to cells using lentiviral transduction on days 1, 3, and 11. CD274 expression was examined three days after guide RNA delivery using flow cytometry-based readings. Figure 17 This study demonstrates the activation of CD274 protein expression following delivery of the specific guide RNA, compared to non-transduced, unstained, and non-targeted controls. Activation was observed in most cells receiving the CD274-specific guide RNA (mean fluorescence intensity (MFI) increased by 5.4X on day 1; by 4.4X on day 3; and by 3.7X on day 11; gated on GFP-positive cells). This confirms the role of dCas9-VPR in positively programmed cells.

[0343] Example 19: Genetic engineering strategy for glutamatergic neurons expressing dCas9-ZIM3

[0344] method

[0345] The aim of this experiment was to generate iPSC cell lines for two purposes: (i) positively programmed via overexpression of transcription factors (e.g., NEUROG2 (NGN2) of glutamatergic neurons), and (ii) constitutively expressed dCas9-ZIM3 protein to enable gene repression (CRISPRi) in positively programmed / differentiated cells. Additionally, three transgenes were integrated into genomic safe harbor sites (GSH) via genome engineering (see [link to study]). Figure 18 First, a reverse Tet transactivation protein (rtTA) cassette driven by a CAG promoter, which controls doxycycline transactivation for the second recombinant transgene, was integrated into the ROSA26 locus. Second, transcription factors controlled by doxycycline-responsive promoters (e.g., NGN2) were integrated into the AAVS1 locus. Finally, a CAG promoter-driven dCas9-ZIM3 protein was integrated into the CLYBL locus.

[0346] Experiment Overview

[0347] The iPSC cell lines were kept in culture. Safe harbor loci were then edited. All three loci were edited using CRISPR / Cas9 technology. sgRNAs introducing DNA double-strand breaks near the selected insertion sites were selected. Cells were nuclear transfected with two plasmids—one expressing Cas9 and the corresponding sgRNA, and the other containing the insert sequence with side homologous arms. The PAM sequence was mutated to prevent Cas9 re-cleavage. Cells carrying correct integration were selected (e.g., using antibiotic resistance markers with the corresponding antibiotic). Once selection reached sufficient efficiency, cells were dissociated into single cells. To obtain monoclonal cell lines, cells were seeded at low density to allow colonies derived from single cells to grow. The engineered lines were genotyped twice by PCR. The first round of genotyping was performed on the crude lysates. Once clones with correct integration were identified, cells were amplified, and genomic DNA was isolated for the second round of genotyping. PCR was performed for correct integration of the 5' and 3' homologous arms and the insert sequence. In addition, PCR was performed to confirm whether the clone was heterozygous or homozygous for the expected integration.

[0348] result

[0349] The final iPSC cell line has been engineered to incorporate a dual safe harbor system, allowing for transcription factor overexpression. It contains transcription factors essential for positive programming into glutamatergic neurons. Additionally, this cell line constitutively expresses the dCas9-ZIM3 protein, facilitating CRISPRi experiments.

[0350] Example 20: Benchmark test of dCas9-ZIM3 function in io glutamatergic neurons

[0351] method

[0352] The efficiency of SOX11 gene repression was assessed in io glutamatergic neurons expressing dCas9-ZIM3 using immunofluorescence staining with SOX11. The effect of CRISPRi on SOX11 protein expression after lentiviral guide RNA delivery was directly evaluated using image analysis.

[0353] Experiment Overview

[0354] Compared to the design guidelines for CRISPR knockout experiments, the design guidelines for CRISPRi guide RNAs are not as well-defined. To address this issue, three different CRISPRi guide RNAs were designed to target the SOX11 gene. After subcloning a single guide RNA into a lentiviral vector, lentiviral particles were generated. The lentiviral supernatant was precipitated using PEG-it™ viral precipitation solution (System Biosciences, LV810A-1) strictly following the manufacturer's instructions. On day 3, the guide RNA was delivered at two different dilutions (1:500 and 1:1000) to revive the cells. By day 8 post-revival, the cells were used for immunofluorescence staining. To prevent cell detachment, the cells were first fixed by replacing half the volume of culture medium with 8% paraformaldehyde (PFA; ThermoFisher, 11586711), followed by a second fixation step using only 4% PFA. After multiple washes with PBS (Gibco, 20012027), cells were incubated overnight at 4°C with primary antibody (SOX11 monoclonal antibody from ThermoFisher, 14-9773-82). Following washing, cells were incubated with secondary antibody and DAPI (Biotechne, 5748 / 10) for one hour. After a series of washes with 0.1% Triton-X (Sigma, T8787), cells were stored in PBS until subsequent analysis. An advanced image analysis pipeline was used to assess knockdown efficiency. This pipeline integrates deep learning methods specifically tailored for precise nucleus identification. Using this method, the intensity and distribution of DAPI and SOX11 signals, which indicate the nucleus, were meticulously quantified. Based on the correlation between DAPI and SOX11 signals, the obtained data provided an accurate measurement of SOX11 knockdown efficiency at the protein level.

[0355] result

[0356] On day 3, three different guide RNAs targeting SOX11 were delivered to cells using lentiviral transduction. Five days after guide RNA delivery, SOX11 expression was examined by immunofluorescence staining. Figure 19 The study showed decreased SOX11 protein expression after delivery of the specific guide RNA compared to the non-transduced (without VR) and non-targeted control (NTV). Inhibition was observed in most cells receiving the SOX11-specific guide RNA. This confirms the functional role of dCas9-ZIM3 in differentiating cells.

[0357] Example 21: Genes expressing Cas9 in io oligodendrocyte-like cells Engineering strategy

[0358] method

[0359] The aim of this experiment was to generate iPSC cell lines for two purposes: (i) those that could be positively programmed via overexpression of transcription factors (e.g., OLIG2 and SOX10 for io oligodendrocyte-like cells), and (ii) those that constitutively expressed the Cas9 protein to enable gene knockout in positively programmed / differentiated cells. Additionally, three transgenes were integrated into genomic safe harbor sites (GSHs) via genome engineering (see [link to study]). Figure 20 First, a reverse Tet transactivation protein (rtTA) cassette driven by a CAG promoter controlled by doxycycline for the second recombinant transgene was integrated into the ROSA26 locus. Second, transcription factors controlled by a doxycycline-responsive promoter (e.g., OLIG2-SOX10) were integrated into the AAVS1 locus. Finally, a CAG promoter-driven Cas9 protein was integrated into the CLYBL locus.

[0360] Experiment Overview

[0361] The iPSC cell lines were kept in culture. Safe harbor loci were then edited. All three loci were edited using CRISPR / Cas9 technology. sgRNAs introducing DNA double-strand breaks near the selected insertion sites were selected. Cells were nuclear transfected with two plasmids—one expressing Cas9 and the corresponding sgRNA, and the other containing the insert sequence with side homologous arms. The PAM sequence was mutated to prevent Cas9 re-cleavage. Cells carrying correct integration were selected (e.g., using antibiotic resistance markers with the corresponding antibiotic). Once selection reached sufficient efficiency, cells were dissociated into single cells. To obtain monoclonal cell lines, cells were seeded at low density to allow colonies derived from single cells to grow. The engineered lines were genotyped twice by PCR. The first round of genotyping was performed on the crude lysates. Once clones with correct integration were identified, cells were amplified, and genomic DNA was isolated for the second round of genotyping. PCR was performed for correct integration of the 5' and 3' homologous arms and the insert sequence. In addition, PCR was performed to confirm whether the clone was heterozygous or homozygous for the expected integration.

[0362] result

[0363] The final iPSC cell line has been engineered to incorporate a dual safe harbor system, allowing for transcription factor overexpression. It contains transcription factors essential for positive programming to oligodendrocyte-like cells. Additionally, the cell line constitutively expresses the Cas9 protein, facilitating further genomic manipulation.

[0364] Example 22: Benchmark test of Cas9 functionality in forward-programmed oligodendrocyte-like cells

[0365] method

[0366] To measure Cas9 activity in D7 oligodendrocyte-like cells (after cryopreservation), a guide RNA targeting the β2-microglobulin (B2M) gene (GGCCGAGATGTCTCGCTCCG, SEQ ID NO: 2) was cloned into a lentiviral vector; this gene is expressed in all nucleated cells. The vector used encodes a puromycin resistance cassette for selecting cells with successful genome integration. Additionally, the vector contains GFP to assess the multiplicity of infection. The lentiviral vector was used to transduce cells carrying a combination of rtTA transactivator protein, constitutive full-length Cas9, and transcription factors essential for forward programming under the control of the Tet response promoter.

[0367] Experiment Overview

[0368] In this experiment, two clones (P1D1 heterozygous and P1F6 homozygous) were tested. After thawing, the cells were cultured in medium to support differentiation into oligodendrocyte-like cells.

[0369] Lentiviral guide RNA delivery: Following the manufacturer's instructions precisely, the supernatant containing lentivirus was precipitated using PEG-it™ Viral Precipitation Solution (System Biosciences, LV810A-1). Transduction efficiency using lentivirus was assessed on day 2 post-cell resuscitation. Diluted lentivirus was added dropwise to the designated wells or dishes, ensuring uniform distribution with gentle agitation. The plates were then returned to the incubator for 24 hours. After this period, the culture medium was completely replaced based on the specific transduction time. Routine cell culture maintenance continued until day 7. Five days post-guide RNA delivery, B2M knockout efficiency was assessed using flow cytometry-based readings. For this purpose, cells were dissociated and stained with B2M antibody. The B2M signal was measured using a FACS instrument after incubation and washing steps. Untransduced and unstained cells, as well as cells with non-targeted guide RNA, served as controls.

[0370] result

[0371] Figure 21The study showed a loss of B2M protein expression after delivery of the specific guide RNA compared to the non-targeted control. The loss was quite significant and was observed in most cells that received the B2M-specific guide RNA (P1D1: 84% B2M-negative cells; P1F6: 91% B2M-negative cells). In these knockout experiments, GFP was used as a surrogate marker for cells that had already received the guide RNA via lentiviral delivery. Nevertheless, some cells showed successful knockout in GFP-negative cases. This suggests that GFP expression may be silenced, possibly due to promoter inactivation or epigenetic silencing, even if the guide RNA remains functional. The results confirmed that Cas9 was active, and the activity was homogeneous in individual cells throughout the experiments.

[0372] Example 23: Benchmark test of Cas9 expression and activity over time in forward-programmed glutamatergic neurons

[0373] method

[0374] Western blot analysis demonstrated a significant decrease in Cas9 expression over time at the detection time point (see Example 5). By day 6, Cas9 expression was undetectable by Western blot analysis. However, subsequent experiments revealed that this observation was due to the sensitivity limitations of Western blot technology. Functional assays showed that Cas9 remained active even at later time points, such as day 11, at which point guide RNA delivery led to high knockout efficiency. These findings suggest that Cas9 expression persists over time at levels below the detection threshold of Western blot, yet remains sufficient for effective genome editing.

[0375] Experiment Overview

[0376] On day 11 post-resuscitation, guide RNA was introduced into cells using RNAiMAX and lentivirus. The guide RNA sequence targeting SOX11 was: GAGAAGATCCCGTTCATCC (SEQ ID NO: 3). The guide RNA sequence non-targeting control was: GCTACCCGCGCGAGAATTGC (SEQ ID NO: 4).

[0377] Lipid-based delivery: The synthetic guide RNA delivery protocol was adapted according to the manufacturer's instructions provided with Lipofectamine® RNAiMAX Reagent (ThermoFisher, 13778075). This protocol was designed to be flexible to accommodate varying applications. For transfection, microcentrifuge tubes labeled A, B, and C were set up. Tube A contained DMEM / F-12 medium combined with sgRNA, while tube B contained a mixture of DMEM / F-12 medium and RNAiMAX reagent. The contents of tubes A and B were combined into tube C, thoroughly mixed by vortexing, and incubated at room temperature for 5 minutes. The sgRNA-RNAiMAX mixture obtained from tube C was then evenly distributed dropwise into the desired wells or dishes. Depending on the well size, the final concentration of sgRNA at the time of cell introduction was 2 pmol for a 96-well plate, 10 pmol for a 24-well plate, and 50 pmol for a 6-well plate. The plates were then returned to the incubator for 24 hours, and the medium was refreshed based on the transfection time.

[0378] Lentiviral delivery: Strictly follow the manufacturer's instructions to precipitate the lentivirus-containing supernatant using PEG-it™ Viral Precipitation Solution (SystemBiosciences, LV810A-1). For transduction, add the diluted lentivirus dropwise to the designated wells or dishes, ensuring uniform distribution with gentle agitation. Then return the plate to the incubator and incubate for 24 hours. After this time, completely replace the culture medium based on the specific transduction time. Then continue with routine cell culture maintenance, applying the selected readout method at the appropriate time.

[0379] Five days after delivery, cells were used for immunofluorescence staining. To prevent cell detachment, cells were first fixed by replacing half the volume of medium with 8% paraformaldehyde (PFA) from ThermoFisher (catalog number: 11586711), followed by a second fixation with only 4% PFA. After multiple washes with PBS (Gibco, 20012027), cells were incubated overnight at 4°C with primary antibody (SOX11 monoclonal antibody from ThermoFisher, 14-9773-82). After washing, cells were incubated with secondary antibody and DAPI (Biotechne, 5748 / 10) for one hour. After a series of washes with 0.1% Triton-X (Sigma, T8787), cells were stored in PBS until subsequent analysis. An advanced image analysis pipeline was used to assess knockout efficiency. This pipeline integrates deep learning methods specifically tailored for precise nucleus identification. Using this method, the intensity and distribution of DAPI and SOX11 signals, which indicate the cell nucleus, were meticulously quantified. Based on the correlation between DAPI and SOX11 signals, the obtained data provide an accurate measurement of SOX11 knockout efficiency at the protein level.

[0380] result

[0381] On day 11 post-resuscitation, guide RNA was delivered to cells using a lipid-based and lentiviral guided delivery method. On day 16, SOX11 expression was detected by immunofluorescence staining. Cell nuclei were labeled with DAPI staining, and a non-targeted guide RNA was used as a control. Image analysis showed that significant knockout of the SOX11 protein occurred after the introduction of the SOX11-specific gRNA (see [link to image]). Figure 22 ).

Claims

1. A method for regulating the expression of endogenous genes in somatic cells derived from induced pluripotent stem cells (iPSCs), comprising the following steps: (i) Provides an engineered iPSC capable of stably expressing or inducing the expression of a CRISPR enzyme, a non-catalytically active CRISPR enzyme or a derivative thereof; (ii) Inducing engineered iPSCs to differentiate into somatic cells; and (iii) Introducing a guide RNA (gRNA) sequence into the somatic cells obtained in step (ii), wherein the gRNA sequence is complementary to the endogenous gene. This regulates the expression of endogenous genes in differentiated somatic cells.

2. The method according to claim 1, wherein the CRISPR enzyme is Cas9, or the non-catalytically active CRISPR enzyme is non-catalytically active Cas9 (dCas9).

3. The method according to claim 1 or claim 2, wherein the engineered iPSC comprises an inserted genetic sequence operatively linked to a promoter, encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof.

4. The method of any one of claims 1 to 3, wherein the inserted genetic sequence further comprises a reporter gene and optionally comprises a self-cleaving peptide.

5. The method according to any one of claims 1 to 4, wherein the engineered iPSC further comprises: (a) The inserted genetic sequence encodes a transcriptional regulatory protein at the first genomic safe harbor (GSH) site; (b) An inserted inducible cassette containing a genetic sequence operatively linked to an inducible promoter at a second GSH site, wherein the inducible promoter is regulated by a transcriptional regulatory protein. The first and second GSH sites are different.

6. The method of claim 5, wherein the genetic sequence is a transgene of one or more master regulators, optionally a transcription factor.

7. The method according to claim 5 or claim 6, wherein the activity of the transcriptional regulatory protein is controlled by an exogenous substance, or wherein the transcriptional regulatory protein is constitutively expressed.

8. The method according to any one of claims 5 to 7, wherein the engineered iPSC contains a genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof at a third GSH site, wherein the third GSH site is different from the first GSH site and the second GSH site.

9. The method of any one of claims 5-8, wherein the GSH site is selected from: the hROSA26 locus, the AAVS1 locus, CLYBL gene and CCR5 gene.

10. The method according to any one of claims 5 to 9, wherein a genetic sequence encoding a transcription regulatory protein is inserted at a first GSH site on two chromosomes of the cell, wherein an inducible cassette is inserted at a second GSH site on two chromosomes of the cell, and / or wherein a genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof is inserted at a third GSH site on two chromosomes of the cell.

11. The method according to any one of claims 5 to 10, wherein the engineered iPSC comprises additional genetic material inserted at a first GSH site, a second GSH site, and / or a third GSH site, said additional genetic material optionally selected from one or more of the following: reporter genes; suicide genes; and selection markers.

12. The method according to any one of claims 1 to 11, wherein step (ii) comprises forward programming.

13. The method of claim 12, wherein forward programming comprises inducing the expression of one or more lineage-specific transcription factors.

14. The method according to any one of claims 5 to 11, wherein transcription of the genetic sequence at the second GSH site results in the positive programming of engineered iPSCs into somatic cells.

15. The method according to any one of claims 1 to 11, wherein step (ii) comprises directed differentiation.

16. The method of claim 15, wherein directed differentiation comprises culturing iPSCs under conditions required for inducing differentiation into somatic cells.

17. The method according to any one of claims 1 to 16, wherein the gRNA is introduced in step (iii) by viral transduction or lipid-based transfection or electroporation.

18. The method according to any one of claims 1 to 17, wherein the gRNA is introduced in step (iii) within 6 days of differentiation, or within 1 to 3 days after differentiation.

19. The method according to any one of claims 1 to 18, wherein the endogenous gene contains an insertion or deletion after the introduction of the gRNA sequence, thereby disrupting the coding sequence of the endogenous gene.

20. The method according to any one of claims 1 to 18, wherein the endogenous gene is completely or partially deleted after the introduction of the gRNA sequence.

21. The method according to any one of claims 1 to 20, wherein the expression of the endogenous gene is activated.

22. The method of claim 21, wherein one or more transcriptional activating proteins are fused with a non-catalytically active CRISPR enzyme, for example, wherein the non-catalytically active CRISPR enzyme is dCas9-VPR.

23. The method of claim 21, wherein the gRNA sequence is engineered to include a transcription activation domain, said transcription activation domain being capable of recruiting one or more transcription activation proteins to upregulate the expression of endogenous genes.

24. The method according to any one of claims 1 to 20, wherein the expression of endogenous genes is repressed.

25. The method of claim 24, wherein one or more transcriptional repressor proteins are fused with a non-catalytically active CRISPR enzyme, for example, wherein the non-catalytically active CRISPR enzyme is dCas9-KOX1 or dCas9-ZIM3.

26. The method of claim 24, wherein the gRNA sequence is engineered to include a transcriptional repression domain capable of recruiting one or more transcriptional repressor proteins to downregulate the expression of endogenous genes.

27. The method according to any one of claims 1 to 26, wherein the gRNA sequence is complementary to the coding exon of the endogenous gene or the transcription start site (TSS) of the endogenous gene.

28. The method according to any one of claims 1 to 27, wherein two or more gRNA sequences are introduced.

29. The method of claim 28, wherein each gRNA sequence is complementary to an alternative or different endogenous gene, or to one or more alternative sequences of the TSS of an endogenous gene.

30. The method according to any one of claims 1 to 29, wherein the engineered iPSC is frozen before differentiation and subsequently thawed.

31. The method according to any one of claims 1 to 30, wherein differentiation is induced, and the differentiated cells are frozen and subsequently thawed.

32. The method according to any one of claims 1 to 31, wherein the engineered iPSC is a human, marsupial, non-human primate, camel, or livestock cell, particularly a human cell.

33. The method according to any one of claims 1 to 32, wherein the somatic cell is a neuronal cell, such as a glutamatergic neuron, or a glial cell, such as a microglia.

34. A cell having a modified genome, said modified genome comprising: (i) The inserted genetic sequence that encodes a transcriptional regulatory protein at the first GSH site; (ii) an inserted inducible cassette containing a genetic sequence operatively linked to an inducible promoter at a second GSH site, wherein the inducible promoter is regulated by a transcriptional regulatory protein; and (iii) An inserted genetic sequence operatively linked to a promoter, which encodes a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof; The first and second GSH sites are different, and The genetic sequence encoding the CRISPR enzyme, the non-catalytically active CRISPR enzyme, or a derivative thereof is inserted at a site different from the first GSH site and the second GSH site.

35. The cell of claim 34, wherein the inserted genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof is inserted at a third GSH site, wherein the third GSH site is different from the first GSH site and the second GSH site.

36. The cell according to claim 34 or claim 35, wherein the cell stably or inducedly expresses a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof.

37. The cell according to any one of claims 34 to 36, wherein it is an iPSC, particularly a human iPSC.

38. The cell according to any one of claims 34 to 36, wherein it is a somatic cell differentiated from iPSCs, particularly a human cell.

39. The cell of claim 38, wherein the cell further comprises an inserted genetic sequence encoding a gRNA sequence operatively linked to a constitutive promoter.

40. An engineered iPSC comprising a genetic sequence encoding a CRISPR enzyme, a non-catalytically active CRISPR enzyme, or a derivative thereof, said genetic sequence being operatively linked to a promoter and optionally a reporter gene and a self-cleaving peptide, wherein said genetic sequence is inserted at a GSH site, and wherein said GSH site does not contain any other exogenous coding sequence.

41. The engineered iPSC of claim 40, wherein the promoter is constitutive or inductive.

42. A cell obtained by the method of any one of claims 1 to 33.

43. The cell according to any one of claims 34 to 42, for use in treatment.

44. The cell according to any one of claims 34 to 42, for the treatment of cancer, neurological disorders, inflammatory diseases, autoimmune diseases and / or chronic infectious diseases.

45. The cell according to any one of claims 34 to 42, used for in vitro diagnostics.

46. ​​The cell according to any one of claims 34 to 42, used for drug screening, drug target identification, or drug target validation.

47. The cell according to any one of claims 34 to 42, used for functional genomic screening, for example, identifying genotype-phenotype relationships in somatic cells derived from iPSCs.