Acyltransferases and their use in the biosynthesis of phenylalcanoamide compounds

Abstract

The present application relates to a kind of acyltransferase and its application in the preparation of phenylpropionyl fatty amine compound, the acyltransferase is selected from LbSCT1 And / or LbSCT2, the amino acid sequence of the LbSCT1 As shown in SEQ ID NO:1, the amino acid sequence of the LbSCT2 As shown in SEQ ID NO:2.The present application is screened by acyltransferase in wolfberry, two acyltransferases are successfully identified, both can catalyze coffee acyl-coenzyme A, dihydrocaffeoyl-coenzyme A, p-coumaroyl-coenzyme A, feruloyl-coenzyme A and other phenylpropionyl group and adipylamine, spermine etc.Fatty amine connection, thus establish a kind of efficient with wolfberry spermidine methyl, ethyl, propyl, butyl (Lycibarbarspermidine I-IV) And Kukoamine B as representative phenylpropionyl fatty amine synthesis method, effectively solve the current dihydrocaffeoyl group containing phenylpropionyl fatty amine biosynthesis limited technical bottleneck.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to an acyltransferase and its application in the biosynthesis of phenylpropionyl fatty amine compounds. Background Technology

[0002] Phenylacetyl fatty acid is a traditional Chinese medicine derived from wolfberry (goji berries). Lycium barbarumThis class of compounds contains a primary active ingredient. The core structure of these compounds consists of a fatty amine core linked to one or two phenylpropionyl groups via amide bonds. The fatty amine core is primarily spermidine, but also includes structural analogs such as spermine, putrescine, and guanidine. Diphenylpropionyl spermidine is the main form of phenylpropionyl fatty amine, accounting for over 1% of the content in wolfberry fruit, and is named Lycibarbarspermidines. Lycibarbarspermidines exhibit complex and diverse structures. Their spermidine core is asymmetrical, with the same or different phenylpropionyl groups attached to the N1 and N10 positions. Glycosylation further enriches their structural diversity. Studies have shown that Lycibarbarspermidines exhibit significant biological activity in the nervous and metabolic systems, consistent with the traditional medicinal effects of wolfberry. Furthermore, this class of components has been identified as a geographical indication component of Ningxia wolfberry, confirming its status as a key pharmacologically active substance in wolfberry, and possessing broad development and application prospects. (See non-patent literature: Zhou et al., Lycibarbarspermidines AO, New Dicaffeoylspermidine Derivatives fromWolfberry, with Activities against Alzheimer's Disease and Oxidation. J. Agric. Food Chem., 2016, 64, 2223-2237; Zhang et al., Lycibarbarspermidine L from Goji Berry Promotes Intestinal Restoration in an Antibiotic-Induced Rat Modelthrough Targeting uc.141A. J. Agric. Food Chem., 2025, 73, 12723-12733; Sun et al., Biosynthetic rule-guided theoretical chemical space mapping strategy for enhanced analysis of plant metabolomes: application to the geographical profiling of goji berry. Sci. Bull., 2025, 70, 3748-3752).

[0003] Although the catalytic mechanism underlying the diversity of spermidine glycosylation in Lycium barbarum has been elucidated, the enzymatic basis for the biosynthetic structure of its diphenylpropionyl spermidine core remains undiscovered. The phenylpropionyl groups in the core structure are predominantly caffeoyl and dihydrocaffeoyl, and also include cis-caffeoyl, ferulicoyl, and p-coumaryl units. Notably, three of the four representative diphenylpropionyl spermidine core structures contain a dihydrocaffeoyl group, while the acyltransferase responsible for the dihydrocaffeoyl group linkage has not yet been identified. The four representative diphenylpropionyl spermidine core structures are named Lycibarbarspermidine I, LS-I, LS-I, and Lycibarbarspermidine II. N 1 -caffeoyl- N 10 - Dihydrocaffeoyl spermidine; Lycibarbarspermidine II (LS-II) is N 1 , N 10 -Di(dihydrocaffeoyl)spermidine; Lycibarbarspermidine III (LS-III) is N 1 , N 10 -Di(caffeoyl)spermidine; Lycibarbarspermidine IV (LS-IV) is N 1 -Dihydrocaffeoyl- N 10- Caffeoyl spermidine. The aforementioned representative core structure of diphenylpropionyl spermidine provides ideal material for elucidating the asymmetric binding modes of caffeoyl and dihydrocaffeoyl groups with spermidine, thereby comprehensively revealing the complete biosynthetic pathway of Lycium barbarum spermidine compounds. Furthermore, Lycium barbarum root bark extract, a major active ingredient in the traditional Chinese medicine Lycium chinense root bark, is a representative dihydrocaffeoyl spermidine derivative with a structure highly similar to Lycium barbarum spermidine extract, suggesting a similar but unknown biosynthetic pathway. Therefore, there is an urgent need in this field to elucidate the acyltransferases responsible for the dihydrocaffeoyl group linkage and to reveal the biosynthetic mechanism of phenylpropionyl fatty amines, represented by Lycium barbarum spermidine. Researchers have identified and discovered two acyltransferases, LbSCT1 and LbSCT2, derived from Lycium barbarum. Both can catalyze the linkage of phenylpropionyl-CoA units such as caffeoyl-CoA, dihydrocaffeoyl-CoA, p-coumaroyl-CoA, and ferulic acid-CoA with fatty amine units such as spermidine and spermine. In this invention, LbSCT2 catalyzes a monoacylation reaction to form monophenylpropionyl fatty amines, while LbSCT1 catalyzes a diacylation reaction to form diphenylpropionyl fatty amines. This invention provides a novel enzymatic tool for the biosynthesis of phenylpropionyl fatty amines and establishes an efficient biocatalytic synthesis method for phenylpropionyl fatty amines represented by Lycium barbarum spermidine A, B, C, and D, laying the foundation for the research, development, and translational application of innovative traditional Chinese medicine drugs.

[0004] The specific structural formulas of lycine A, B, C, and D are as follows: .

[0005] The specific structural formula of Lycium bark extract is as follows: Summary of the Invention The purpose of this invention is to provide an acyltransferase and its application in the biosynthesis of phenylpropionyl fatty amine compounds. To this end, the invention adopts the following technical solution.

[0006] A first aspect of the present invention is to provide an acyltransferase selected from LbSCT1 and / or LbSCT2, wherein the amino acid sequence of LbSCT1 is shown in SEQ ID NO: 1 and the amino acid sequence of LbSCT2 is shown in SEQ ID NO: 2.

[0007] The second aspect of this invention also relates to the application of the above-mentioned acyltransferase in the preparation of phenylpropionyl fatty amine compounds, wherein the phenylpropionyl fatty amine compounds are selected from Lycium barbarum spermidine A, B, C, D, Lycium barbarum B, and N 1 , N 10 -Di(p-coumaryl)semine, N 1 ,N 10 -Di(feruloyl)semine, N 1 -Caffeoylspermethylene, N 10 -Caffeoylspermethylene, N 1 -Dihydrocaffeoylsemine N 10 -Dihydrocaffeoylsemine N 1 -p-Coumaroylspermine, N 10 -p-Coumaroylspermine, N 1 -ferulinospermidine or N 10 -Feruloylsemine.

[0008] A third aspect of this invention provides a method for synthesizing spermidine alpha from Lycium barbarum, which uses caffeoyl-CoA, dihydrocaffeoyl-CoA, and spermidine as substrates, and generates spermidine alpha from Lycium barbarum through a combination of LbSCT1 and LbSCT2 catalysis. The molar ratio of LbSCT1, LbSCT2, caffeoyl-CoA, dihydrocaffeoyl-CoA, and spermidine is 1:0.5-2:2-10:2-10:2-10; the catalytic time of LbSCT1 and LbSCT2 is 1-12 h, preferably 3 h.

[0009] In another method for synthesizing lycine methyl lysine, it uses... N 10 -Dihydrocaffeoyl spermidine and caffeoyl coenzyme A are used as substrates, and LbSCT1 catalyzes the formation of lycopene spermidine A. The LbSCT1, N 10 The molar ratio of dihydrocaffeoylspermine to caffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0010] In another method for synthesizing lycine spermidine methyl ester, it uses... N 1 -Caffeoyl spermidine and dihydrocaffeoyl coenzyme A are used as substrates, and LbSCT1 catalyzes the formation of lycopene spermidine A. The LbSCT1, N 1 The molar ratio of caffeoyl spermidine to dihydrocaffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0011] The fourth aspect of the present invention provides a method for synthesizing lycopene spermidine B, which uses caffeoyl-CoA, dihydrocaffeoyl-CoA and spermidine as substrates, and generates lycopene spermidine B by a combination of LbSCT1 and LbSCT2 catalysis; wherein the molar ratio of LbSCT1, LbSCT2, caffeoyl-CoA, dihydrocaffeoyl-CoA and spermidine is 1:0.5-2:2-10:2-10:2-10; and the catalytic time of LbSCT1 and LbSCT2 is 1-12 h, preferably 3 h.

[0012] In another method for synthesizing lycine ethylspermide, it is used as... N 10 -Dihydrocaffeoyl spermidine and dihydrocaffeoyl coenzyme A are used as substrates, and LbSCT1 catalyzes the formation of lycopene spermidine B. The LbSCT1, N 10 The molar ratio of dihydrocaffeoyl spermidine to dihydrocaffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0013] In another method for synthesizing lycine spermidine, it uses... N 1 -Dihydrocaffeoyl spermidine and dihydrocaffeoyl coenzyme A are used as substrates, and LbSCT1 catalyzes the formation of lycopene spermidine B. The LbSCT1, N 1 The molar ratio of dihydrocaffeoyl spermidine to dihydrocaffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0014] In another method for synthesizing lycopene spermidine B, spermidine and dihydrocaffeoyl-CoA are used as substrates, and lycopene spermidine B is generated by LbSCT1 catalysis. The molar ratio of LbSCT1, spermidine, and dihydrocaffeoyl-CoA is 1:2-5:4-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0015] The fourth aspect of this invention is to provide a method for synthesizing lycopene spermidine propionate, which uses caffeoyl-CoA, dihydrocaffeoyl-CoA and spermidine as substrates, and generates lycopene spermidine propionate by a combination of LbSCT1 and LbSCT2 catalysis; wherein the molar ratio of LbSCT1, LbSCT2, caffeoyl-CoA, dihydrocaffeoyl-CoA and spermidine is 1:0.5-2:2-10:2-10:2-10; and the catalytic time of LbSCT1 and LbSCT2 is 1-12 h, preferably 3 h.

[0016] In another method for synthesizing lycine spermidine propionate, it uses... N10 -Caffeoyl spermidine and caffeoyl coenzyme A are used as substrates, and LbSCT1 catalyzes the formation of lycopene spermidine propionate. The LbSCT1, N 10 The molar ratio of caffeoyl spermidine to caffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0017] In another method for synthesizing lycine spermidine propionate, it uses... N 1 -Caffeoyl spermidine and caffeoyl coenzyme A are used as substrates, and LbSCT1 catalyzes the formation of lycopene spermidine propionate. The LbSCT1, N 1 The molar ratio of caffeoyl spermidine to caffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0018] In another method for synthesizing lycopene spermidine, spermidine and caffeoyl-CoA are used as substrates, and lycopene is generated by LbSCT1 catalysis. The molar ratio of LbSCT1, spermidine, and caffeoyl-CoA is 1:2-5:4-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0019] The fifth aspect of this invention provides a method for synthesizing lycopene spermidine, which uses caffeoyl-CoA, dihydrocaffeoyl-CoA, and spermidine as substrates, and generates lycopene spermidine via a combination of LbSCT1 and LbSCT2 catalysis. The molar ratio of LbSCT1, LbSCT2, caffeoyl-CoA, dihydrocaffeoyl-CoA, and spermidine is 1:0.5-2:2-10:2-10:2-10; the catalytic time of LbSCT1 and LbSCT2 is 1-12 h, preferably 3 h.

[0020] In another method for synthesizing lycine spermidine, it uses... N 10 -Caffeoyl spermidine and dihydrocaffeoyl coenzyme A are used as substrates, and LbSCT1 catalyzes the formation of lycopene spermidine butyrate. The LbSCT1, N 10 The molar ratio of caffeoyl spermidine to dihydrocaffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0021] In another method for synthesizing lycine spermidine, it uses... N 1-Dihydrocaffeoyl spermidine and caffeoyl coenzyme A are used as substrates, and LbSCT1 catalyzes the formation of lycopene spermidine butyrin. The LbSCT1, N 1 The molar ratio of dihydrocaffeoylspermine to caffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0022] The sixth aspect of the present invention is to provide a method for synthesizing Lycium chinense root extract, which uses spermidine and dihydrocaffeoyl-CoA as substrates and generates Lycium chinense root extract via LbSCT1 catalysis. The molar ratio of LbSCT1, spermidine, and dihydrocaffeoyl-CoA is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0023] The seventh aspect of the present invention is to provide N 1 , N 10 A method for synthesizing bis(p-coumaryl)spermine, which uses spermine and p-coumaryl-CoA as substrates, and is catalyzed by LbSCT1 to produce N 1 , N 10 -Di(p-coumaryl)spermine. The molar ratio of LbSCT1, spermine, and p-coumaryl-CoA is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0024] The eighth aspect of the present invention is to provide N 1 , N 10 The synthetic method of bis(feruloyl)spermine uses spermine and feruloyl-CoA as substrates, and is catalyzed by LbSCT1 to produce N 1 , N 10 -Di(feruloyl)spermine. The molar ratio of LbSCT1, spermine, and feruloyl-CoA is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0025] The ninth aspect of the present invention is to provide N 1 The synthesis method of -caffeoyl spermidine uses spermidine and caffeoyl coenzyme A as substrates, and is catalyzed by LbSCT2 to produce N 1- Caffeoyl spermidine. The molar ratio of LbSCT2, spermidine, and caffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0026] The tenth aspect of the present invention is to provide N 10 The synthesis method of -caffeoyl spermidine uses spermidine and caffeoyl coenzyme A as substrates, and is catalyzed by LbSCT2 to produce N 10 - Caffeoyl spermidine. The molar ratio of LbSCT2, spermidine, and caffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0027] The eleventh aspect of the present invention is to provide N 1 The synthesis method of -dihydrocaffeoyl spermidine uses spermidine and dihydrocaffeoyl coenzyme A as substrates, and is catalyzed by LbSCT2 to produce N 1 - Dihydrocaffeoyl spermidine. The molar ratio of LbSCT2, spermidine, and dihydrocaffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0028] The twelfth aspect of the present invention is to provide N 10 The synthesis method of -dihydrocaffeoyl spermidine uses spermidine and dihydrocaffeoyl coenzyme A as substrates, and is catalyzed by LbSCT2 to produce N 10 - Dihydrocaffeoyl spermidine. The molar ratio of LbSCT2, spermidine, and dihydrocaffeoyl coenzyme A is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0029] The thirteenth aspect of the present invention is to provide N 1 - A method for synthesizing p-coumaryl spermidine, which uses spermidine and p-coumaryl coenzyme A as substrates, and is catalyzed by LbSCT2 to produce N 1 - p-Coumaroylspermine. The molar ratio of LbSCT2, spermine, and p-coumaroyl-CoA is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0030] The fourteenth aspect of the present invention is to provide N 10- A method for synthesizing p-coumaryl spermidine, which uses spermidine and p-coumaryl coenzyme A as substrates, and is catalyzed by LbSCT2 to produce N 10 - p-Coumaroylspermine. The molar ratio of LbSCT2, spermine, and p-coumaroyl-CoA is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0031] The fifteenth aspect of the present invention is to provide N 1 The synthesis of -feruloyl spermidine involves using spermidine and feruloyl-CoA as substrates, catalyzed by LbSCT2 to produce N 1 - Ferulaylspermine. The molar ratio of LbSCT2, spermine, and feruloyl-CoA is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0032] The sixteenth aspect of the present invention is to provide N 10 The synthesis of -feruloyl spermidine involves using spermidine and feruloyl-CoA as substrates, catalyzed by LbSCT2 to produce N 10 - Ferulaylspermine. The molar ratio of LbSCT2, spermine, and feruloyl-CoA is 1:2-10:2-10; the catalytic time of LbSCT1 is 1-12 h, preferably 3 h.

[0033] This invention successfully identified two acyltransferases by screening acyltransferases in wolfberry. Both acyltransferases can catalyze the linkage of phenylpropionyl groups such as caffeoyl-CoA, dihydrocaffeoyl-CoA, p-coumaroyl-CoA, and ferulicoyl-CoA to fatty amines such as spermidine and spermine. This establishes a highly efficient method for synthesizing phenylpropionyl fatty amines represented by lycibarbarspermidine I-IV and kukoamine B, effectively overcoming the current technical bottleneck limiting the biosynthesis of phenylpropionyl fatty amines containing dihydrocaffeoyl groups. The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0035] Figure 1 A represents the protein purification results of LbSCT1 and LbSCT2; Figure 1 B shows a schematic diagram of the catalytic functions of the corresponding LbSCT1 and LbSCT2 enzymes; Figure 1 C. Liquid phase diagram ii shows the reaction results after LbSCT1 catalyzes the substrate for 3 h, and iii shows the reaction results after LbSCT2 continues to catalyze the substrate for 3 h. Figure 1 Liquid phase diagram ii shows the reaction results after LbSCT1 catalyzes the substrate for 3 h, and iii shows the reaction results after LbSCT2 continues to catalyze the substrate for 3 h.

[0036] Figure 2 Liquid phase diagram ii shows the LbSCT1 catalysis. N 1 HPLC chromatogram of the formation of lycopene spermidine (8) and caffeoyl coenzyme A (2) into lycopene spermidine propionate; Figure iii shows the LbSCT1 catalysis. N 10 HPLC chromatogram of caffeoyl spermidine (9) and 2 to generate lycium barbarum spermidine propionate; Figure 2 Liquid phase diagram ii shows the LbSCT1 catalysis. N 1 HPLC chromatogram of the formation of lycopene spermidine (8) and dihydrocopene coenzyme A (3) from lycopene spermidine A; Figure iii shows the LbSCT1 catalytic reaction. N 10 HPLC chromatogram of the formation of lycaffeoyl spermidine (9) and 3 into lycopene spermidine butylin; Figure 2 Liquid phase diagram ii shows the LbSCT1 catalysis. N 10 HPLC chromatogram of the formation of lycopene spermidine A from dihydrocaffeoyl spermidine (11) and caffeoyl coenzyme A (2); Figure iii shows the LbSCT1 catalytic reaction. N 1 HPLC chromatogram of dihydrocaffeoyl spermidine (10) and 2 to generate lycium barbarum spermidine butylamine; Figure 2 Liquid phase diagram ii shows the LbSCT1 catalysis. N 10 HPLC chromatogram of the formation of lycopene spermidine (11) and dihydrocaffeoyl coenzyme A (3) into lycopene spermidine B; Figure iii shows the LbSCT1 catalytic reaction. N 1 HPLC chromatogram of dihydrocaffeoyl spermidine (10) and 3 to generate lycium barbarum spermidine B; Figure 2 EH shows a schematic diagram of the corresponding LbSCT1 acylation function.

[0037] Figure 3 HPLC chromatogram A (ii) shows the HPLC detection of the production of spermine A, B, C, and D from spermine A, caffeoyl-CoA (2), and dihydrocaffeoyl-CoA (3) by the combined catalysis of LbSCT1 and LbSCT2. Figure 3 B shows a schematic diagram of the acylation function of the corresponding LbSCT1 and LbSCT2 combination enzymes; Figure 3 C. Liquid phase ii is the HPLC detection chromatogram of the reaction of LbSCT1 with spermine (12) and dihydrocaffeoyl coenzyme A (3) to produce lycium bark extract (13); Figure 3 D shows a schematic diagram of the corresponding LbSCT1 acylation function.

[0038] Figure 4 Figure ii shows the HPLC detection chromatograms of LbSCT1 catalyzing the formation of N1,N10-di(p-coumaroyl)spermine from spermidine (1) and p-coumaroyl-CoA; Figure iii shows the HPLC detection chromatograms of LbSCT2 catalyzing the formation of N1-p-coumaroylspermine and N10-p-coumaroylspermine from spermidine (1) and p-coumaroyl-CoA. Figure 4 Figure ii shows the HPLC detection chromatograms of N1,N10-di(feruloyl)spermidine generated from spermidine (1) and feruloyl-CoA catalyzed by LbSCT1; Figure iii shows the HPLC detection chromatograms of N1-feruloylspermidine and N10-feruloylspermidine generated from spermidine (1) and feruloyl-CoA catalyzed by LbSCT2. Figure 4 C shows a schematic diagram of the corresponding LbSCT1 and LbSCT2 acylation functions; Figure 4 The D mass spectrum is the molecular weight identification mass spectrum of LbSCT1 and LbSCT2 catalyzing spermidine (1) and p-coumaroyl coenzyme A to generate N1-p-coumaroyl spermidine, N10-p-coumaroyl spermidine, and N1,N10-di(p-coumaroyl)spermine. Figure 4 The E mass spectrum is a mass spectrum used by LbSCT1 and LbSCT2 to catalyze the generation of N1-feruloyl spermidine, N10-feruloyl spermidine, and N1,N10-bis(feruloyl)spermine from spermidine (1) and feruloyl-CoA. Detailed Implementation

[0039] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0040] In this invention, unless otherwise specified, all LbSCT1 / 2-catalyzed synthesis methods of Lycium barbarum spermidine A, B, C, D, Lycium barbarum B and other phenylpropionyl fatty amine compounds are carried out in a buffer system, specifically using HEPES buffer (pH=7.5).

[0041] Example 1: Obtaining candidate genes Goji berries ( L. barbarum The samples were collected in August 2019 from Zhongning County, Ningxia Hui Autonomous Region, China. Fruit, leaf, and root bark tissues were collected separately and flash-frozen in liquid nitrogen for later use. RNA extraction and full-length transcriptome sequencing (Iso-seq) were performed by Annoroad Gene Technology (Beijing) Co., Ltd. To obtain more reliable transcriptome data, we chose to test RNA from the three tissues: fruit, leaf, and root. The testing process first involved extracting high-quality RNA and reverse transcribing it into cDNA. Then, the full-length cDNA was sequenced using a Sequel third-generation sequencer to obtain high-quality raw transcriptome sequencing data. The PacBio third-generation sequencing platform sequenced the cDNA library, obtaining raw polymerase reads. The polymerase reads were then filtered to remove low-quality and short-length sequences. Subsequent classification, clustering, and correction were performed to finally obtain high-quality full-length sequences.

[0042] Using acyltransferases with known functions that catalyze the linking of caffeoyl and spermidine as probes, acyltransferases related to the biosynthesis of phenylpropionyl fatty amines were identified through LocalBlast software search and phylogenetic tree gene function analysis. Gene search and comparison were performed using acyltransferases with known functions that catalyze the linking of caffeoyl and spermidine. LbSCT1 (amino acid sequence as shown in SEQ ID NO: 1, nucleic acid sequence as shown in SEQ ID NO: 3) and LbSCT2 (amino acid sequence as shown in SEQ ID NO: 2, nucleic acid sequence as shown in SEQ ID NO: 4) were selected as candidates to verify their corresponding catalytic functions.

[0043] SEQ ID NO: 1 >LbSCT1 MDSIHVEILSTKLIKPSSPTPPHLQCYKLSFFDQIANKELVPLVLLYPPCNNNSIKDAEMDERLEQSFSKILTRVHPAAGRYAEDGCSVLCLDQGVPYTKAKVNCKLDNFLEQVARDGHELTVQLWPHDIKDVDDTNLFTAPIFTVQITKFECGAMAVAISISHPVMDGFTTMSSMFEWANACRLGTPIDKINNYLSFNAGDIFPTRDLSRYFKPPIPQEGSKEDKFLSKRFVIKEAAILRLKEKFASFIDSGALDFKPSRVEMISALLWRALIRASEAINGNLRPSMMGFPLNLRSKINLPEINKSVGNLAIDVPVKFIPGETQMELQHLVKLIRDAVTKVVASCSEASPDEIVSHVANLYNESFQAPEWGGNDDVDKFTCSSLCRFPMQDADFGSGKPCLMFFGLKDINMFWLHDTVCRTGVGLQVDLDERHLQLFESDPDLKAFIEHFV SEQ ID NO: 2 >LbSCT2 MKDPTQVKILSKSLIKPSSPTPNHLKNYKLCFFDQVADTVHIPLVLFYPHGNNNSKNEELEESLSRVLTHAYPLAGRFSTEDESTVLCLDQGVTYIKATVNCKLDDFLQQTKEDLDPVLSFWPQGIMDVDETNIFVMPLMVVQVTTFECGGLALGFSCAHPAMDGFTAFTFIYEWAKVCKFGTPCKEINNFMSFNLGTLFPVKDLTAILEPPINEGKRPKSKLVARKFVFEEAAISRLREKFDSEGLSFKPSRVEMITTLLWRSLIRAAGAGNPHLKRSIIAFPFNLRGKVLAFPEIANSFGNLIIEIPIRFEHDDETKMESLHHIVKLIRETVQETTSYCAKSTPDEIASLVVNLYKDSYSGLEWGGNNEVVNFTSSSLCRFPIHKVDFGWGKPSLMHFGSRHSQMFWLYDTECETSIAVQIDLEEKYMNSFVRDQDIMDFAKF SEQ ID NO: 3 >LbSCT1 SEQ ID NO: 4 >LbSCT2 Example 2: Expression of the gene protein for the biosynthesis of phenylpropionyl fatty amine LbSCT1 and LbSCT2 proteins were expressed using Escherichia coli Rosetta (DE3) strain. The specific method is as follows: Production of Escherichia coli Rosetta (DE3) competent cells 1) Take out the BL21 (DE3) / Rosetta (DE3) competent cells from the laboratory stock from the -80 ℃ freezer and thaw them on ice. Perform the operation in a clean bench and inoculate them into antibiotic-free LB solid medium. Incubate them in a biochemical incubator at 37 ℃ for 12 h.

[0044] 2) Pick single clones and put them into antibiotic-free LB liquid medium, and culture at 37°C with shaking for 12 h to obtain seed culture.

[0045] 3) Take 500 μL / 1 mL of seed culture and inoculate it into two bottles of pre-prepared 50 mL SOB medium (containing 10 mM MgSO4 + 10 mM MgCl2), and incubate at 18 ℃ with shaking for about 18 h until the bacterial OD reaches the target value. 600 It is between 0.4 and 0.8.

[0046] 4) Quickly transfer the bacterial culture to a 50 mL centrifuge tube and let it stand on ice for 10 min.

[0047] 5) Collect bacterial cells by centrifugation at 4℃ and 1000×g for 15 min.

[0048] 6) Remove the supernatant in a clean bench, add 17 mL of ice-cold TB solution, gently pipette to suspend the bacterial cells, place on ice for 10 min, then centrifuge at 1000×g for 15 min at 4°C to collect the bacterial cells.

[0049] 7) Remove the supernatant in the clean bench, add 4 mL of ice-cold TB solution, gently pipette to suspend the bacterial cells, slowly add 280 μL of DMSO in three portions, and place on ice for 10 min after resuspending.

[0050] 8) Quickly aliquot competent cells into sterile EP tubes, 60 μL per tube, freeze rapidly with liquid nitrogen, and then store at -80°C for later use.

[0051] Note: The steps above should be followed when preparing DH5α competent cells for plasmid construction.

[0052] (2) Construction of recombinant plasmid for phenylpropionyl fatty amine biosynthesis gene 1) Goji berry RNA was reverse transcribed using the TransScript® One-Step gDNA Removal and cDNA Synthesis SuperMix kit to obtain goji berry cDNA.

[0053] 2) Using KOD-One DNAase and paired primers Inf-LbSCT1-F / R (SEQ ID NO: 5 / 6) and Inf-LbSCT2-F / R (SEQ ID NO: 7 / 8), the gene related to the biosynthesis of phenylpropionyl fatty amine was amplified from the cDNA of Lycium barbarum. The target gene was then recombinantly ligated with the corresponding vector using the In-Fusion® HD Cloning Kit to construct pET-28b-LbSCT1 and pCDF-Duet-LbSCT2.

[0054] SEQ ID NO: 5 >Inf-LbSCT1-F GTCGGGATCCGAATTATATGGATAGCATACATGTAG SEQ ID NO: 6 >Inf-LbSCT1-R GACGGAGCTCGAATTCTAGACAAAGTGCTCGATGA SEQ ID NO: 7 >Inf-LbSCT2-F tcagggatccgaattcATGAGCAAATTAGAGCTGGTGTT SEQ ID NO: 8 >Inf-LbSCT2-R gtgcggccgcaagctTAGGAATCAAGAATAGTTTCAACAAATCG 3) Add the recombinant plasmid ligation reaction solution to competent DH5α cells, mix well by pipetting, and let stand on ice for 20 min.

[0055] 4) After heat shock at 42℃ for 90 s, let stand on ice for 2 min.

[0056] 5) Add 500 μL of SOC medium and incubate at 37°C with shaking for 1 h to revive the cells.

[0057] 6) Spread the bacterial culture evenly onto LB solid medium containing the corresponding antibiotic and incubate overnight in a biochemical incubator at 37°C with the culture inverted.

[0058] 7) Use DNA reactive enzymes such as T5 Super Mix to screen single clones. Pick positive clones and inoculate them into 10 mL of LB liquid medium containing the corresponding antibiotic, and incubate overnight at 37°C with shaking.

[0059] 8) Extract the target plasmid according to the operation steps of the plasmid extraction kit, and confirm the successful construction of the recombinant plasmid by enzyme digestion or plasmid sequencing.

[0060] Note: For protein expression, refer to steps 3-8 above for transformation with the recombinant plasmid of strain Rosetta (DE3).

[0061] (3) Protein expression and purification 1) Using LB liquid medium containing the corresponding antibiotics, ferment the BL21 (DE3) transformant strain containing pETDuet-LbDBR2, and the Rosseta (DE3) transformant strain containing pET-28b-LbSCT1 and pCDF-Duet-LbSCT2, and culture overnight at 37°C with shaking at 220 rpm.

[0062] 2) Inoculate 1 mL of seed culture into 100 mL of LB liquid medium containing 100 μg / mL of the corresponding antibiotic, and incubate at 37°C with shaking at 220 rpm until OD (dose retardation). 600 The value reached 0.6.

[0063] 3) Add isopropyl-β-D-thiogalactoside (IPTG) to the bacterial culture to a final concentration of 0.4 mM, and then incubate at 16°C and 160 rpm for 20 h with shaking. Collect the bacterial cells by centrifugation at 4°C and 8000×g.

[0064] 4) Resuspend the bacterial cells of the protein expression strain in Buffer A. When lysing the cells, add PMSF as a protease inhibitor (10 μL per ml). High-pressure lyse for 3-5 minutes until the bacterial solution is clear and non-sticky. Then centrifuge at 4°C, 10,000 rpm for 30 minutes to obtain the protein supernatant.

[0065] 5) Purify the target protein using Ni affinity chromatography. Add the protein supernatant to the column and load at a low flow rate to ensure sufficient adsorption of the target protein. Perform gradient elution: 100 mL of 5% B (Buffer B 5 mL, Buffer A 95 mL), 100 mL of 10% B, 100 mL of 15% B, and finally elute the target protein with 100% B. For proteins requiring tag removal, add TEV enzyme for removal experiments, performing removal while concentrating the protein. Detect the protein purification results using SDS-PAGE gel electrophoresis (see attached). Figure 1 A).

[0066] 6) Use Millipore Amicon Ultra ultrafiltration tubes to concentrate proteins, and replace them with the corresponding enzyme catalytic reaction system buffer. Quick freeze in liquid nitrogen and store at -80°C for later use.

[0067] Example 3: Enzymatic Synthesis Method of Lycium barbarum Spermine A, B, C, and D (1) Combinatorial enzyme-catalyzed synthesis method of spermidine alpha from Lycium barbarum: 0.5 mM LbSCT1, 0.5 mM LbSCT2, 1.0 mM caffeoyl-CoA (2), 1.0 mM dihydrocaffeoyl-CoA (3) and 1.0 mM spermidine (1) were dissolved in 100 μL HEPES buffer (pH=7.5), and incubated with shaking in a 37℃ incubator for 3 h. The reaction was terminated by adding 50 μL methanol, and then centrifuged at 12000×g for 10 min. The supernatant was collected, and the liquid chromatography-mass spectrometry analysis was performed. The corresponding products were identified using standards (see attached). Figure 3 A,ii). By detecting the combined enzyme catalytic reaction, it was observed that using LbSCT1 and LbSCT2 to catalyze caffeoyl-CoA, dihydrocaffeoyl-CoA and spermidine produced four products, including lycium barbarum spermidine A (5), with a yield of approximately 12%.

[0068] (2) Enzymatic synthesis method of spermidine alpha from Lycium barbarum: 1) Dissolve 0.5 mM LbSCT1, 1.0 mM dihydrocaffeoyl coenzyme A (3) and 1.0 mM N in 100 μL HEPES buffer (pH=7.5). 1 -Caffeoylspermine (8), incubated with shaking in a 37°C incubator for 3 h, the reaction was terminated by adding 50 μL of methanol, then centrifuged at 12000×g for 10 min, the supernatant was collected, and the corresponding product was identified using liquid chromatography-mass spectrometry and standards (see attached). Figure 2 B,ii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can efficiently catalyze dihydrocaffeoyl coenzyme A and N 1 - Caffeoyl spermidine specifically generates lycopene spermidine A (5) with a yield of approximately 83%; 2) 0.5 mM LbSCT1, 1.0 mM caffeoyl coenzyme A (2) and 1.0 mM caffeoyl coenzyme A (2) were dissolved in 100 μL HEPES buffer (pH=7.5). N 10 -Dihydrocaffeoylsemidine (11) was incubated with shaking in a 37°C incubator for 3 h, and the reaction was terminated by adding 50 μL of methanol. The mixture was then centrifuged at 12000 × g for 10 min, and the supernatant was collected. The supernatant was analyzed by liquid chromatography-mass spectrometry, and the corresponding product was identified using standards (see attached). Figure 2C,ii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can efficiently catalyze caffeoyl-CoA and N 10 -Dihydrocaffeoyl spermidine specifically generates lycium spermidine A (5), with a yield of approximately 61%.

[0069] (3) Combinatorial enzyme-catalyzed synthesis method of spermidine B from Lycium barbarum: 0.5 mM LbSCT1, 0.5 mM LbSCT2, 1.0 mM caffeoyl-CoA (2), 1.0 mM dihydrocaffeoyl-CoA (3) and 1.0 mM spermidine (1) were dissolved in 100 μL HEPES buffer (pH=7.5), and incubated with shaking in a 37℃ incubator for 3 h. The reaction was terminated by adding 50 μL methanol, and then centrifuged at 12000×g for 10 min. The supernatant was collected, and the liquid chromatography-mass spectrometry was used for analysis. The corresponding products were identified using standards (see attached). Figure 3 A,ii). By detecting the combined enzyme catalytic reaction, it was observed that using LbSCT1 and LbSCT2 to catalyze caffeoyl-CoA, dihydrocaffeoyl-CoA and spermidine could produce four products, the main one of which was lycine ethylspermidine (7), with a yield of about 32%.

[0070] (4) Enzymatic synthesis method of spermidine B from Lycium barbarum: 1) Dissolve 0.5 mM LbSCT1, 1.0 mM dihydrocaffeoyl coenzyme A (3) and 1.0 mM N in 100 μL HEPES buffer (pH=7.5). 1 -Dihydrocaffeoylsemidine (10) was incubated with shaking in a 37°C incubator for 3 h, and the reaction was terminated by adding 50 μL of methanol. The mixture was then centrifuged at 12000×g for 10 min, and the supernatant was collected. The supernatant was analyzed by liquid chromatography-mass spectrometry, and the corresponding product was identified using standards (see attached). Figure 2 D, ii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can efficiently catalyze dihydrocaffeoyl coenzyme A and N 1 - Dihydrocaffeoyl spermidine specifically generates lycopene spermidine B (7) with a yield of approximately 93%; 2) 0.5 mM LbSCT1, 1.0 mM dihydrocaffeoyl coenzyme A (3) and 1.0 mM N were dissolved in 100 μL HEPES buffer (pH=7.5). 10 -Dihydrocaffeoylsemidine (11) was incubated with shaking in a 37°C incubator for 3 h, and the reaction was terminated by adding 50 μL of methanol. The mixture was then centrifuged at 12000×g for 10 min, and the supernatant was collected. The supernatant was analyzed by liquid chromatography-mass spectrometry, and the corresponding product was identified using standards (see attached). Figure 2(D, iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can efficiently catalyze dihydrocaffeoyl coenzyme A and... N 10 - Dihydrocaffeoyl spermidine specifically generates lycopene spermidine B (7) with a yield of approximately 96%; 3) Dissolve 0.5 mM MbSCT1, 2.0 mM dihydrocaffeoyl coenzyme A (3) and 1.0 mM spermidine (1) in 100 μL HEPES buffer (pH=7.5), incubate with shaking in a 37℃ incubator for 3 h, add 50 μL methanol to terminate the reaction, then centrifuge at 12000×g for 10 min, collect the supernatant, analyze with liquid chromatography-mass spectrometry and identify the corresponding product using standards (see attached). Figure 1 D, ii). By detecting the enzyme-catalyzed reaction, it was observed that LbSCT1 can efficiently catalyze dihydrocaffeoyl coenzyme A and spermidine to specifically generate lycium barbarum spermidine B (7), with a yield of approximately 81%.

[0071] (5) Combinatorial enzyme-catalyzed synthesis method of spermidine propionate from Lycium barbarum: 0.5 mM LbSCT1, 0.5 mM LbSCT2, 1.0 mM caffeoyl-CoA (2), 1.0 mM dihydrocaffeoyl-CoA (3) and 1.0 mM spermidine (1) were dissolved in 100 μL HEPES buffer (pH=7.5), and incubated with shaking in a 37℃ incubator for 3 h. The reaction was terminated by adding 50 μL methanol, and then centrifuged at 12000×g for 10 min. The supernatant was collected, and the liquid chromatography-mass spectrometry analysis was performed. The corresponding products were identified using standards (see attached). Figure 3 A,ii). By detecting the combined enzyme catalytic reaction, it was observed that using LbSCT1 and LbSCT2 to catalyze caffeoyl-CoA, dihydrocaffeoyl-CoA and spermidine could produce four products, including lycium barbarum spermidine propionate (4), with a yield of approximately 14%.

[0072] (6) Enzymatic synthesis method of spermidine propionate from Lycium barbarum: 1) Dissolve 0.5 mM LbSCT1, 1.0 mM caffeoyl coenzyme A (2) and 1.0 mM N in 100 μL HEPES buffer (pH=7.5). 1 -Caffeoylspermine (8), incubated with shaking in a 37°C incubator for 3 h, the reaction was terminated by adding 50 μL of methanol, then centrifuged at 12000×g for 10 min, the supernatant was collected, and the corresponding product was identified using liquid chromatography-mass spectrometry and standards (see attached). Figure 2 A, ii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can efficiently catalyze caffeoyl-CoA and N 1- Caffeoyl spermidine specifically generates lycopene spermidine propionate (4) with a yield of approximately 63%; 2) 0.5 mM LbSCT1, 1.0 mM caffeoyl coenzyme A (2) and 1.0 mM caffeoyl coenzyme A (2) were dissolved in 100 μL HEPES buffer (pH=7.5). N 10 -Caffeoyl spermidine (9) was incubated with shaking in a 37°C incubator for 3 h, and the reaction was terminated by adding 50 μL of methanol. Then, it was centrifuged at 12000×g for 10 min, and the supernatant was collected. The supernatant was analyzed by liquid chromatography-mass spectrometry and the corresponding product was identified using standards (see attached). Figure 2 (A, iii) By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can efficiently catalyze caffeoyl-CoA and N 10 - Caffeoyl spermidine specifically generates lycopene spermidine propionate (4) with a yield of approximately 58%; 3) Dissolve 0.5 mM LbSCT1, 2.0 mM caffeoyl coenzyme A (2) and 1.0 mM spermidine (1) in 100 μL HEPES buffer (pH=7.5), incubate with shaking in a 37℃ incubator for 3 h, add 50 μL methanol to terminate the reaction, then centrifuge at 12000×g for 10 min, collect the supernatant, analyze with liquid chromatography-mass spectrometry and identify the corresponding product using standards (see attached). Figure 1 C, ii). By detecting the enzyme-catalyzed reaction, it was observed that LbSCT1 can efficiently catalyze caffeoyl-CoA and spermidine to specifically generate lycium barbarum spermidine propionate (4), with a yield of approximately 66%.

[0073] (7) Combinatorial enzyme-catalyzed synthesis method of spermidine from Lycium barbarum: 0.5 mM LbSCT1, 0.5 mM LbSCT2, 1.0 mM caffeoyl-CoA (2), 1.0 mM dihydrocaffeoyl-CoA (3) and 1.0 mM spermidine (1) were dissolved in 100 μL HEPES buffer (pH=7.5), and incubated with shaking in a 37℃ incubator for 3 h. The reaction was terminated by adding 50 μL methanol, and then centrifuged at 12000×g for 10 min. The supernatant was collected, and the liquid chromatography-mass spectrometry analysis was performed. The corresponding products were identified using standards (see attached). Figure 3 A,ii). By detecting the combined enzyme catalytic reaction, it was observed that using LbSCT1 and LbSCT2 to catalyze caffeoyl-CoA, dihydrocaffeoyl-CoA and spermidine could produce four products, including lycine-speridine (6), with a yield of approximately 15%.

[0074] (8) Enzymatic synthesis method of spermidine from wolfberry: 1) Dissolve 0.5 mM LbSCT1, 1.0 mM dihydrocaffeoyl coenzyme A (3) and 1.0 mM N in 100 μL HEPES buffer (pH=7.5). 10 -Caffeoyl spermidine (9) was incubated with shaking in a 37°C incubator for 3 h, and the reaction was terminated by adding 50 μL of methanol. Then, it was centrifuged at 12000×g for 10 min, and the supernatant was collected. The supernatant was analyzed by liquid chromatography-mass spectrometry and the corresponding product was identified using standards (see attached). Figure 2 B, iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can efficiently catalyze dihydrocaffeoyl coenzyme A and... N 10 - Caffeoyl spermidine specifically generates lycopene spermidine (6) with a yield of approximately 59%; 2) 0.5 mM MbSCT1, 1.0 mM caffeoyl coenzyme A (2) and 1.0 mM caffeoyl coenzyme A (2) were dissolved in 100 μL HEPES buffer (pH=7.5). N 1 -Dihydrocaffeoylsemidine (10) was incubated with shaking in a 37°C incubator for 3 h, and the reaction was terminated by adding 50 μL of methanol. The mixture was then centrifuged at 12000×g for 10 min, and the supernatant was collected. The supernatant was analyzed by liquid chromatography-mass spectrometry, and the corresponding product was identified using standards (see attached). Figure 2 C, iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can efficiently catalyze caffeoyl-CoA and N 1 -Dihydrocaffeoyl spermidine specifically generates lycium spermidine (6) with a yield of approximately 69%.

[0075] Example 4: Enzymatic Synthesis of Lycium chinense root bark extract Enzymatic synthesis of Lycium barbarum glycoside: 0.5 mM LbSCT1, 1.0 mM dihydrocaffeoyl coenzyme A (3), and 1.0 mM spermine (12) were dissolved in 100 μL HEPES buffer (pH=7.5). The mixture was incubated at 37℃ with shaking for 3 h. The reaction was terminated by adding 50 μL methanol. The mixture was then centrifuged at 12000×g for 10 min, and the supernatant was collected. The supernatant was analyzed by liquid chromatography-mass spectrometry, and the corresponding product was identified using standards (see attached). Figure 3 C, ii). By detecting the enzyme-catalyzed reaction, it was observed that LbSCT1 could catalyze the specific production of lycopene (13) from dihydrocaffeoyl-CoA and spermine, with a yield of approximately 57%.

[0076] Example 5: N 1 , N 10-Di(p-coumaryl)semine and N 1 , N 10 Enzymatic synthesis of 2-di(feruloyl)spermine (1) N 1 , N 10 Enzymatic synthesis of bis(p-coumaryl)spermine: 0.5 mM LbSCT1, 1.0 mM p-coumaryl-CoA, and 1.0 mM spermine were dissolved in 100 μL HEPES buffer (pH=7.5) (1). The mixture was incubated at 37°C with shaking for 3 h. The reaction was terminated by adding 50 μL methanol, followed by centrifugation at 12000×g for 10 min. The supernatant was collected, and the corresponding product was identified by liquid chromatography-mass spectrometry (see attached). Figure 4 A, ii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can catalyze the specific production of coumaroyl-CoA and spermidine. N 1 , N 10 -Di(p-coumaryl)spermine (14a), yield approximately 63%.

[0077] (2) N 1 , N 10 Enzymatic synthesis of bis(feruloyl)spermine: 0.5 mM LbSCT1, 1.0 mM feruloyl-CoA, and 1.0 mM spermine were dissolved in 100 μL HEPES buffer (pH=7.5) (1). The mixture was incubated at 37℃ with shaking for 3 h. The reaction was terminated by adding 50 μL methanol, followed by centrifugation at 12000×g for 10 min. The supernatant was collected, and the corresponding product was identified by liquid chromatography-mass spectrometry (see attached). Figure 4 B, ii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT1 can catalyze the specific production of feruloyl-CoA and spermidine. N 1 , N 10 -Di(feruloyl)spermine (15a), yield approximately 71%.

[0078] Example 6: Enzymatic Synthesis of Monophenylpropionyl Fatty Amines (1) N 1- Enzymatic synthesis of caffeoyl spermidine: 1) Dissolve 0.5 mM LbSCT2, 1.0 mM caffeoyl coenzyme A (2) and 1.0 mM spermidine (1) in 100 μL HEPES buffer (pH=7.5), incubate with shaking at 37℃ for 3 h, add 50 μL methanol to terminate the reaction, then centrifuge at 12000×g for 10 min, collect the supernatant, analyze with liquid chromatography-mass spectrometry and identify the corresponding product using standards (see attached). Figure 1 C,iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT2 can efficiently catalyze caffeoyl-CoA and spermidine, specifically generating... N 1 -Caffeoyl spermidine (8), yield approximately 62%.

[0079] (2) N 10 - Enzymatic synthesis of caffeoyl spermidine: 1) Dissolve 0.5 mM LbSCT2, 1.0 mM caffeoyl coenzyme A (2) and 1.0 mM spermidine (1) in 100 μL HEPES buffer (pH=7.5), incubate with shaking at 37℃ for 3 h, add 50 μL methanol to terminate the reaction, then centrifuge at 12000×g for 10 min, collect the supernatant, analyze with liquid chromatography-mass spectrometry and identify the corresponding product using standards (see attached). Figure 1 C,iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT2 can efficiently catalyze caffeoyl-CoA and spermidine, specifically generating... N 10 -Caffeoylsperidine (9), yield approximately 23%.

[0080] (3) N 1 - Enzymatic synthesis of dihydrocaffeoyl spermidine: 1) Dissolve 0.5 mM LbSCT2, 1.0 mM dihydrocaffeoyl coenzyme A (3) and 1.0 mM spermidine (1) in 100 μL HEPES buffer (pH=7.5), incubate with shaking at 37℃ for 3 h, add 50 μL methanol to terminate the reaction, then centrifuge at 12000×g for 10 min, collect the supernatant, analyze with liquid chromatography-mass spectrometry and identify the corresponding product using standards (see attached). Figure 1 (D,iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT2 can efficiently catalyze dihydrocaffeoyl-CoA and spermidine, specifically generating... N 1 -Dihydrocaffeoylspermine (10), yield approximately 72%.

[0081] (4) N 10- Enzymatic synthesis of dihydrocaffeoyl spermidine: 1) Dissolve 0.5 mM LbSCT2, 1.0 mM dihydrocaffeoyl coenzyme A (3) and 1.0 mM spermidine (1) in 100 μL HEPES buffer (pH=7.5), incubate with shaking at 37℃ for 3 h, add 50 μL methanol to terminate the reaction, then centrifuge at 12000×g for 10 min, collect the supernatant, analyze with liquid chromatography-mass spectrometry and identify the corresponding product using standards (see attached). Figure 1 (D,iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT2 can catalyze dihydrocaffeoyl-CoA and spermidine, specifically generating... N 10 -Dihydrocaffeoylsemidine (11), yield approximately 11%.

[0082] (5) N 1 - p-Coumaroyl spermidine and N 10 - Enzymatic synthesis of coumaroyl spermidine: 0.5 mM LbSCT2, 1.0 mM p-coumaroyl coenzyme A, and 1.0 mM spermidine were dissolved in 100 μL HEPES buffer (pH=7.5) (1). The mixture was incubated at 37℃ with shaking for 3 h. The reaction was terminated by adding 50 μL methanol, followed by centrifugation at 12000×g for 10 min. The supernatant was collected, and the corresponding product was identified by liquid chromatography-mass spectrometry (see attached). Figure 4 A, iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT2 can catalyze the specific production of coumaroyl-CoA and spermidine. N 1 - p-Coumaroyl spermidine and N 10 - p-Coumaroylspermine (14b & 14c), yields of approximately 46% and 38%, respectively.

[0083] (6) N 1 -ferulinospermidine and N 10 - Enzymatic synthesis of feruloyl spermidine: 0.5 mM LbSCT2, 1.0 mM feruloyl-CoA, and 1.0 mM spermidine were dissolved in 100 μL HEPES buffer (pH=7.5) (1). The mixture was incubated at 37℃ with shaking for 3 h. The reaction was terminated by adding 50 μL methanol, followed by centrifugation at 12000×g for 10 min. The supernatant was collected, and the corresponding product was identified by liquid chromatography-mass spectrometry analysis (see attached). Figure 4B, iii). By detecting the enzyme-catalyzed reaction, it can be observed that LbSCT2 can catalyze the specific production of feruloyl-CoA and spermidine. N 1 -ferulinospermidine and N 10 -Feruloylspermine (15b & 15c), with yields of approximately 37% and 32%, respectively.

[0084] The HPLC conditions are as follows: Instruments: The Dionex UltiMate 3000 is equipped with the UltiMate 3000 Diode Array Detector (DIONEX, USA) and an Amazon SL ion trap electrospray mass spectrometer (BRUKER, Germany).

[0085] Liquid chromatography column: Phenomenex Gemini 5μ C18 column (5 μm, 4.6 × 250 mm) Mobile phase: Solvent A: Methanol; Solvent B: Water (0.1% formic acid); Gradient settings: 10%A (0 min) -10%A (10 min) -55%A (25 min) -100%A (26 min) -100%A (36 min); flow rate 1 mL / min.

[0086] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. An acyltransferase selected from LbSCT1 and / or LbSCT2, wherein the amino acid sequence of LbSCT1 is shown in SEQ ID NO: 1 and the amino acid sequence of LbSCT2 is shown in SEQ ID NO:

2.

2. The application of the acyltransferase according to claim 1 in the preparation of phenylpropionyl fatty amine compounds, wherein the phenylpropionyl fatty amine compounds are selected from Lycium barbarum spermidine A, B, C, D, Lycium barbarum B, ... N 1 , N 10 -Di(p-coumaryl)semine, N 1 , N 10 -Di(feruloyl)semine, N 1 -Caffeoylspermethylene, N 10 -Caffeoylspermethylene, N 1 -Dihydrocaffeoylsemine N 10 -Dihydrocaffeoylsemine N 1 -p-Coumaroylspermine, N 10 -p-Coumaroylspermine, N 1 -ferulinospermidine or N 10 -Feruloylsemine.

3. A method for synthesizing lycopene spermidine A, comprising using caffeoyl-CoA, dihydrocaffeoyl-CoA, and spermidine as substrates, and catalyzing the synthesis of lycopene spermidine A via the LbSCT1 and LbSCT2 combination as described in claim 1; or, using... N 10 -Dihydrocaffeoylsemidine and caffeoyl coenzyme A as substrates or N 1 - Using caffeoyl spermidine and dihydrocaffeoyl coenzyme A as substrates, lycopene spermidine A is generated by LbSCT1 catalysis as described in claim 1.

4. A method for synthesizing lycopene spermidine B, comprising using caffeoyl-CoA, dihydrocaffeoyl-CoA, and spermidine as substrates, and catalyzing the synthesis of lycopene spermidine B via the LbSCT1 and LbSCT2 combination as described in claim 1; or, using... N 10 -Dihydrocaffeoylsemidine and dihydrocaffeoyl coenzyme A as substrates or N 1 - Using dihydrocaffeoyl spermidine and dihydrocaffeoyl coenzyme A as substrates or using spermidine and dihydrocaffeoyl coenzyme A as substrates, lycine ethylspermidine is generated by LbSCT1 catalysis as described in claim 1.

5. A method for synthesizing lycopene spermidine propionate, comprising using caffeoyl-CoA, dihydrocaffeoyl-CoA, and spermidine as substrates, and catalyzing the synthesis of lycopene spermidine propionate via the combination of LbSCT1 and LbSCT2 as described in claim 1; or, using... N 10 -Caffeoyl spermidine and caffeoyl coenzyme A as substrates or N 1 - Using caffeoyl spermidine and caffeoyl coenzyme A as substrates, lycopene spermidine propionate is generated by LbSCT1 catalysis as described in claim 1.

6. A method for synthesizing lycopene spermidine, comprising using caffeoyl-CoA, dihydrocaffeoyl-CoA, and spermidine as substrates, and catalyzing the synthesis of lycopene spermidine via the LbSCT1 and LbSCT2 combination as described in claim 1; or, using... N 10 -Caffeoyl spermidine and dihydrocaffeoyl coenzyme A as substrates or N 1 - Using dihydrocaffeoyl spermidine and caffeoyl coenzyme A as substrates, lycine-containing spermidine is generated by LbSCT1 catalysis as described in claim 1.

7. A method for synthesizing Lycium barbarum extract, wherein the extract is generated by using spermine and dihydrocaffeoyl-CoA as substrates and catalyzing with LbSCT1 as described in claim 1.

8. A method for synthesizing spermidine derivatives, wherein the spermidine derivatives are selected from... N 1 , N 10 -Di(p-coumaryl)semine or N 1 , N 10 -Di(feruloyl)spermine, with the corresponding substrate selected from spermine and p-coumaroyl-CoA or spermine and feruloyl-CoA, catalyzed by LbSCT1 as described in claim 1 to generate a spermine derivative.

9. A method for synthesizing spermidine derivatives, wherein the spermidine derivatives are selected from... N 1 -Caffeoylspermethylene, N 10 -Caffeoylspermethylene, N 1 -Dihydrocaffeoylsemine N 10 -Dihydrocaffeoylsemine N 1 -p-Coumaroylspermine, N 10 -p-Coumaroylspermine, N 1 -ferulinospermidine or N 10 -feruloyl spermidine; wherein Using caffeoyl-CoA and spermidine as substrates, LbSCT2 as described in claim 1 is used to catalyze the generation of... N 1 -Caffeoyl spermidine; Using caffeoyl-CoA and spermidine as substrates, LbSCT2 as described in claim 1 is used to catalyze the generation of... N 10 -Caffeoyl spermidine; Using dihydrocaffeoyl-CoA and spermidine as substrates, LbSCT2 as described in claim 1 is used to catalyze the production of... N 1 -Dihydrocaffeoyl spermidine; Using dihydrocaffeoyl-CoA and spermidine as substrates, LbSCT2 as described in claim 1 is used to catalyze the production of... N 10 -Dihydrocaffeoyl spermidine; Using p-coumaroyl-CoA and spermidine as substrates, LbSCT2 as described in claim 1 is used to catalyze the production of... N 1 -p-Coumaryl spermidine; Using p-coumaroyl-CoA and spermidine as substrates, LbSCT2 as described in claim 1 is used to catalyze the production of... N 10 -p-Coumaryl spermidine; Using feruloyl-CoA and spermidine as substrates, LbSCT2 as described in claim 1 is catalyzed to produce N 1 -Feruloyl spermidine; Using feruloyl-CoA and spermidine as substrates, LbSCT2 as described in claim 1 is catalyzed to produce N 10 -Feruloylsemine.

Images