A mutant of a glycosyltransferase from sesame and its use in the synthesis of salidroside in bacillus licheniformis

By site-directed mutagenesis of the sesame-derived glycosyltransferase SiUGT, the SiUGT mutant E232P/Y400A was constructed, solving the problems of low catalytic efficiency and yield of rhodioloside, realizing the efficient synthesis of rhodioloside, and enhancing its application potential in the food, nutrition, and pharmaceutical fields.

CN122256290APending Publication Date: 2026-06-23HUBEI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-08
Publication Date
2026-06-23

AI Technical Summary

Technical Problem

The low catalytic efficiency and low yield of rhodioloside in existing technologies limit its widespread application in the food, nutrition and pharmaceutical fields.

Method used

By site-directed mutagenesis of the sesame-derived glycosyltransferase SiUGT, specifically by mutating glutamic acid at position 232 to proline and tyrosine at position 400 to alanine, the SiUGT mutant E232P/Y400A was constructed and expressed in Bacillus licheniformis, thus achieving the efficient synthesis of rhodioloside.

Benefits of technology

The catalytic efficiency and yield of rhodioloside were significantly improved. The mutant E232P/Y400A increased the yield of rhodioloside in Bacillus licheniformis by 17.71%-32.62%, laying the foundation for the industrial production of rhodioloside through microbial synthesis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering and enzyme engineering, and particularly discloses a sugar transferase mutant from sesame and application of the sugar transferase mutant in synthesis of salidroside in bacillus licheniformis. Si UGT molecule catalytic domain near the 232th glutamic acid is mutated into proline and the 400th tyrosine is mutated into alanine, so as to obtain a double mutant, which significantly improves the enzyme activity of the sugar transferase in converting tyrosol into salidroside, solves the problem that the current sugar transferase has low catalytic efficiency on tyrosol, is used for biological fermentation of salidroside, provides a new idea for production of salidroside, and is suitable for large-scale promotion.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and enzyme engineering technology, specifically relating to a sesame-derived glycosyltransferase mutant and its application in the synthesis of rhodioloside in Bacillus licheniformis. Background Technology

[0002] Site-directed mutagenesis (such as PCR-based site-directed mutagenesis, oligonucleotide-mediated site-directed mutagenesis, CRISPR-Cas9-mediated precision editing, or error-prone PCR-based screening) is a crucial strategy for regulating microbial metabolic networks. By mutating the DNA sequence of a target gene (e.g., functional domain mutation, active site modification, or key regulatory residue substitution), the structure and function of the protein encoded by that gene can be precisely controlled, thereby relieving its inhibitory effect on metabolic pathways or optimizing its catalytic efficiency, and promoting the biosynthesis of target products. However, research on how site-directed mutations of a specific gene (such as regulatory factors, secondary metabolic pathway genes, or global stress response genes) precisely affect the reconstruction of microbial metabolic networks and product synthesis remains relatively limited in many industrial microorganisms (such as Bacillus, Actinomycetes, or Halomonas). The key question remains: how can we target and mutate key genes to alter their protein functions (such as substrate affinity, thermal stability, or catalytic efficiency), thereby removing metabolic bottlenecks and improving the synthesis efficiency of target products?

[0003] Rhodioloside (p-hydroxyphenylethyl-O-β-D-glucoside) is a plant-derived phenylethanol glycoside formed by the condensation of the hydroxyl group of tyrosol (2-(4-hydroxyphenyl)ethanol) and the hemiacetal hydroxyl group of uridine diphosphate glucose. Rhodioloside is widely found in various precious medicinal plants such as Rhodiola rosea, privet fruit, and cinnamon, and possesses various health-promoting biological activities including anti-fatigue, anti-aging, anti-cancer, anti-tumor, antioxidant, and anti-inflammatory effects. Rhodioloside has a huge market potential and is widely used in food, nutrition, cosmetics, and pharmaceuticals. Currently, the microbial synthesis of rhodioloside still faces problems such as long cycle time, low conversion rate, and low yield. Researchers such as Bai et al. cloned UGT73B6 and its mutant UGT73B6 from Rhodiola rosea. F389AThree glycosyltransferases related to the synthesis of rhodioloside were identified. Overexpression of these three enzymes in *E. coli* revealed that only UGT73B6 could catalyze the synthesis of rhodioloside, and its catalytic efficiency was low; with the addition of 2 mM tyrosol, the substrate conversion rate of UGT73B6 was only 6%. Liu et al. obtained 6.03 g / L rhodioloside by co-culturing tyrosol-producing *E. coli* and rhodioloside-transformed *E. coli*. Li et al., starting from *Bacillus licheniformis*-derived *BlYjiC*, constructed a "mutation-function" interaction map by analyzing the active site in its receptor pocket. Guided by this map, iterative saturation mutagenesis successfully yielded the mutant M6 with 99% regioselectivity for the tyrosol hydroxyl group, achieving a rhodioloside production of 3.6 g / L. These studies demonstrate the great potential of glycosyltransferase protein engineering for promoting rhodioloside synthesis.

[0004] SiUGT is a glycosyltransferase derived from sesame plants. There are no reports of protein-engineered mutants of this enzyme catalyzing the glycosylation of tyrosol's phenolic hydroxyl groups to produce rhodioloside. Summary of the Invention

[0005] The purpose of this invention is to provide a glycosyltransferase SiUGT mutant derived from sesame, the amino acid sequence of which is shown in SEQ ID NO.2.

[0006] Another objective of this invention is to provide the application of the sesame glycosyltransferase SiUGT mutant E232P / Y400A in the fermentation production of rhodioloside.

[0007] To achieve the above objectives, the present invention adopts the following technical measures:

[0008] To address the problems of low catalytic efficiency and low yield of rhodioloside in existing technologies, this invention provides a glycosyltransferase mutant E232P / Y400A from sesame, which is used for the bio-fermentation production of rhodioloside. The applicant mutated glutamic acid at position 232 to proline and tyrosine at position 400 to alanine in the amino acid sequence (SEQ ID NO. 4) of the wild-type glycosyltransferase SiUGT from sesame (Sesamum indicum L.), obtaining the glycosyltransferase SiUGT mutant E232P / Y400A of this invention, as shown in SEQ ID NO. 2.

[0009] The scope of protection of this invention also includes:

[0010] The fusion protein obtained by fusing the mutant protein described in SEQ ID NO.2 with a protein purification tag.

[0011] The gene encoding the mutant protein or fusion protein described in SEQ ID NO.2.

[0012] Expression cassettes, recombinant vectors, recombinant microorganisms, or in vitro recombinant cells containing the above-mentioned coding genes.

[0013] The use of the mutant protein shown in SEQ ID NO.2, the above-mentioned fusion protein, the above-mentioned encoding gene, the expression cassette having the above-mentioned encoding gene, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell in the preparation of glycosyltransferase mutants.

[0014] The use of the mutant protein shown in SEQ ID NO.2, the above-mentioned fusion protein, the above-mentioned encoding gene, the expression cassette having the above-mentioned encoding gene, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell in the preparation of rhodioloside.

[0015] A method for improving the catalytic performance of the glycosyltransferase SiUGT from sesame includes mutating glutamic acid at position 232 to proline and tyrosine at position 400 to alanine, as shown in SEQ ID NO.4.

[0016] A method for preparing rhodioloside using the above-mentioned mutant protein or fusion protein includes introducing an expression vector expressing the above-mentioned mutant protein or fusion protein into Bacillus licheniformis.

[0017] In the preferred embodiment of the above-described method, the Bacillus licheniformis is Bacillus licheniformis DTR20.

[0018] The coding gene described above is preferably the one shown in SEQ ID NO.1.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] The SiUGT mutant E232P / Y400A glycosyltransferase provided by this invention can efficiently and specifically convert tyrosol to rhodioloside, laying the foundation for the industrial production of rhodioloside through microbial synthesis. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the HPLC detection results for tyrosol standard.

[0022] Figure 2 This is a schematic diagram of the HPLC detection results of rhodioloside standard.

[0023] Figure 3 This is a schematic diagram of the HPLC detection results for a mixed standard of tyrosol, rhodioloside, and icariin D2.

[0024] Figure 4This diagram illustrates the synthesis of rhodioloside under the action of the SiUGT mutant glycosyltransferase.

[0025] Figure 5 A schematic diagram illustrating the de novo synthesis of rhodioloside by Bacillus licheniformis with different mutants of sesaminyltransferase. Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.

[0027] In this invention, there are no special requirements for the type of expression vector. It can be any commonly used expression vector in the art capable of expressing SiUGT in Bacillus licheniformis or other hosts, such as pHY300PLK and pET series plasmids. Those skilled in the art should understand that the expression vector can be constructed using various methods commonly used in the art, which will not be elaborated upon here.

[0028] Unless otherwise specified, the experimental methods described in the following examples were performed under standard conditions, such as those described in Molecular Cloning: A Laboratory Manual, or as recommended by the manufacturer of the relevant biological reagent.

[0029] In the following examples, *Escherichia coli* DH5α is commercially available, and the *Bacillus licheniformis* used is *Bacillus licheniformis* DTR20 (see Yang Junru. Metabolic Engineering of *Bacillus licheniformis* Tyrosol Chassis Strains for De novo Synthesis of Rhodioloside [D]. Hubei University, 2025.). *Bacillus licheniformis* DTR20 is used for the expression of the glycosyltransferase SiUGT gene in this invention, and *Escherichia coli* DH5α is used for gene cloning and mutant construction of SiUGT.

[0030] The culture medium formulation used in the examples is as follows:

[0031] Solid culture medium formula (1 L): yeast extract 5.0 g, peptone 10.0 g, sodium chloride 10.0 g, agar 15.0 g. Make up to volume with deionized water and autoclave.

[0032] LB medium formula (1 L): 5.0 g yeast extract, 10.0 g peptone, 10.0 g sodium chloride, bring to volume with deionized water, and autoclave.

[0033] Basic salt culture medium formula (1 L): 50.0 g sucrose, 5.0 g glucose, 5.0 g peptone, 3.0 g NH4Cl, 15.1 g Na2HPO4·12H2O, 5.0 g KH2PO4, 1.0 g MgSO4·7H2O, 0.5 g NaCl, 1.0 g sodium citrate, 1 mL trace metal stock solution (g / 100 mL) -1 : CaCl2·2H2O 1.47, FeCl3·6H2O 1.35, ZnCl2 0.17, MnCl2·4H2O 0.1, NaMoO4·7H2O 0.06, CoCl2·6H2O 0.06, CuSO4·5H2O 0.043).

[0034] Analytical methods for the product rhodioloside:

[0035] Sample preparation: The supernatant obtained from fermentation was diluted with ultrapure water at a certain ratio and then filtered using a 0.22 μm aqueous filter membrane.

[0036] Rhodioloside HPLC detection method: The concentration of rhodioloside in the supernatant was measured using a Shimadzu PDA detector (224 nm) and an Elite HyperSil ODS2 column (4.6 mm × 250 mm, 5 μm) via high-performance liquid chromatography (HPLC, Shimadzu Nexera XR series). The mobile phase was 0.1% formic acid and methanol (v / v 8:2), the flow rate was 1.0 mL / min, the column temperature was 30°C, the injection volume was 10 μL, and the detection wavelength was 224 nm. A standard curve of rhodioloside was obtained by plotting the concentration on the x-axis and the corresponding peak area on the y-axis. The yield of rhodioloside was calculated based on the standard curve.

[0037] Example 1: Construction of pHY-SiUGT expression plasmid

[0038] Based on the amino acid sequence of the SiUGT (GenBank: BEE35697.1) protein provided by GenBank, as shown in SEQ ID NO.4, codon optimization was performed in Bacillus licheniformis. The optimized nucleotide sequence is shown in SEQ ID NO.3. The optimized gene was synthesized by Suzhou Junji Technology Co., Ltd. The synthesized gene was amplified and recovered by PCR using primers SiUGT-F and SiUGT-R. Using the vector pHY-kivD template (Zhan Y, et al. Efficient synthesize Sis of 2-phenylethanol from L-phenylalanine by engineered Bacillus licheniformis using molasses as carbon source. Appl Microbiol Biotechnol. 2020. 104(17): 7507-7520), the vector backbone was amplified using primers T5-pHY-F and T5-pHY-R. The backbone was then gel-cleaved and recovered. The recovered gene fragments and vector backbone were ligated according to the kit instructions, transformed into E. coli DH5α, plasmids were extracted, and sequencing was performed to verify that the correct plasmid pHY-SiUGT was obtained.

[0039] SiUGT-F:AACAAAGGGGGAGATTTGTATGAAACCGCATGCAGTCC

[0040] SiUGT-R: GTAAACTTGGTCTGACAGTTAGTTCTTCAACAGGATCTCG;

[0041] T5-pHY-F: CTGTCAGACCAAGTTTACTCATATA

[0042] T5-pHY-R;ACAAATCTCCCCCTTTGTTGTTTCATT.

[0043] Example 2:

[0044] Construction of SiUTG mutant vector and engineered strain

[0045] To further improve the glycosylation efficiency of SiUGT, pHY-SiUGT was used as a template. Primers SiUGT-E232P-F and SiUGT-E232P-R were used for PCR amplification, followed by recovery according to the kit instructions. The recovered mutant backbone was ligated according to the kit instructions, transformed into *E. coli* DH5α, plasmid was extracted, and sequencing verified the correct plasmid pHY-SiUGT. E232P The constructed plasmid pHY-SiUGTE232P Using primers SiUGT-Y400A-F and SiUGT-Y400A-R as a template, the mutant backbone was amplified by PCR and then recovered according to the kit instructions. The recovered mutant backbone was ligated according to the kit instructions, transformed into *E. coli* DH5α, and the plasmid was extracted and sequenced to verify the correct plasmid pHY-SiUGT. E232P / Y400A .

[0046] SiUGT-E232P-F:CTCGAAAAccgGTTCTTGACGCCCTTC

[0047] SiUGT-E232P-R:CGTCAAGAACcggTTTTTCGAGTTCATCA;

[0048] SiUGT-Y400A-F:TTGCAGGgcCGTCTGCCGCGATTG

[0049] SiUGT-Y400A-R:CGGCAGACGgcCCTGCAATTGGTCTGC.

[0050] Wild-type pHY-SiUGT and mutant plasmid pHY-SiUGT E232P / Y400A The recombinant genetically engineered strains DTR20 / pHY-SiUGT and DTR20 / pHY-SiUGT were obtained by transferring them into Bacillus licheniformis DTR20. E232P / Y400A .

[0051] Example 3:

[0052] Verification of the rhodioloside synthesis capacity of SiUTG mutant

[0053] Seed fermentation: Engineered strains DTR20 / pHY-SiUGT and DTR20 / pHY-SiUGT... E232P / Y400A Activation was performed separately: 1% by volume was inoculated from a glycerol tube into 5 mL of LB medium and cultured at 230 r / min and 37 ℃ for 12 hours. Then, the activated bacterial solution was inoculated into seed culture medium at 1% by volume and cultured at 230 r / min and 37 ℃ for 12 hours to obtain the seed culture solution (the seed culture medium formula was: 10.0 g / L peptone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride, pH 7.2).

[0054] The specific steps of the fermentation culture are as follows: 30 mL of different fermentation culture media with varying formulations (see Table 1) are added to a 250 mL Erlenmeyer flask. Each culture medium contains: Na₂HPO₄·12H₂O 15.1 g / L, KH₂PO₄ 5.0 g / L, MgSO₄·7H₂O 1.0 g / L, NaCl 0.5 g / L, sodium citrate 1.0 g / L, and 1 mL / L trace metal mother liquor (g / 100 mL). -1 : CaCl2·2H2O 1.47, FeCl3·6H2O 1.35, ZnCl2 0.17, MnCl2·4H2O 0.1, NaMoO4·7H2O0.06, CoCl2·6H2O 0.06, CuSO4·5H2O 0.043).

[0055] The pH of the fermentation medium used was natural. Then, the seed culture was inoculated at an inoculation rate of 3% (volume percentage), the rotation speed was 230 r / min, the temperature was 37℃, and the fermentation was carried out for 60 hours to obtain the fermentation broth.

[0056] Table 1. Culture medium formulation for Rhodiola rosea glycoside fermentation

[0057] .

[0058] After the above fermentation is completed, the fermentation broth is centrifuged, and the supernatant is collected for HPLC analysis of the content of rhodioloside.

[0059] Table 2 Bacillus licheniformis DTR20 / pHY-SiUGT, DTR20 / pHY-SiUGT E232P / Y400A Comparison of Rhodioloside Production

[0060] .

[0061] As shown in the HPLC chromatogram ( Figure 4 The fermentation broth of strain DTR20 / pHY-SiUGT showed a rhodioloside retention time (RT) of 13 min, which was the same as that of rhodioloside in the mixed standard of tyrosol, rhodioloside, and icariin D2. Figure 3 The study confirmed that DTR20 / pHY-SiUGT catalyzes the glycosylation of tyrosol to generate rhodioloside. The chromatogram showed only rhodioloside and the precursor tyrosol, with no production of icariin D2, indicating specific synthesis of rhodioloside. The yield of rhodioloside in the fermentation broth of the above strain, determined by liquid chromatography, is shown in Table 2. (DTR20 / pHY-SiUGT...) E232P / Y400AThe yield of rhodioloside by the strain was increased by 17.71%-32.62% compared to the wild type in nine different culture media. The highest yield was in group 5, which had a yield of 13.54 g / L, representing a 32.62% increase compared to the wild type. This indicates that the SiUGT mutant E232P / Y400A significantly enhanced the ability of the strain to synthesize rhodioloside from tyrosol, thereby improving the strain's overall ability to synthesize rhodioloside.

[0062] Comparative Example 3:

[0063] Using pHY-SiUGT as a template, and following the method described in Example 2, three single-mutant glycosyltransferase mutants were prepared by mutating glutamic acid at position 232 of SiUGT to arginine, arginine at position 399 to asparagine, or aspartic acid at position 404 to leucine. The mutation primers are as follows:

[0064] SiUGT-D404L-F: ACGTCTGCCGCCTTTGGGCAATGGGACTCGAAAT

[0065] SiUGT-D404L-R:CATTGCCCAAAGGCGGCAGACGTACCTGCAA;

[0066] SiUGT-R399N-F:ACCAATTGCAatTACGTCTGCCGCGATT

[0067] SiUGT-R399N-R:CAGACGTAatTGCAATTGGTCTGCTGTT;

[0068] SiUGT-E232R-F:ACTCGAAAAAAGAGTTCTTGACGCCCTT

[0069] SiUGT-E232R-R:GTCAAGAACTCTTTTTTCGAGTTCATCAA.

[0070] Construction of mutant plasmid DpHY-SiUGT D404L pHY-SiUGT R399N and pHY-SiUGT E232R The plasmids were then transformed into Bacillus licheniformis DTR20 to obtain strain DTR20 / pHY-SiUGT. D404L DTR20 / pHY-SiUGT R399N DTR20 / pHY-SiUGT E232R .

[0071] The engineered strains DTR20 / pHY-SiUGT (WT) and DTR20 / pHY-SiUGT were used. D404L DTR20 / pHY-SiUGT R399N DTR20 / pHY-SiUGT E232R The culture was inoculated into liquid LB medium containing 20 mg / L tetracycline and incubated overnight at 37°C. 0.5 mL of the overnight culture was then inoculated into 30 mL of basic salt medium and incubated at 37°C for 60 hours. The supernatant of the fermentation broth was analyzed by HPLC to determine the content of rhodioloside. The fermentation results are as follows: Figure 5 As shown. Mutant strain DTR20 / pHY-SiUGT D404L Loss of the ability to synthesize rhodioloside, DTR20 / pHY-SiUGT R399N and DTR20 / pHY-SiUGT E232R The yield is basically the same as that of the wild type.

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A synthetically produced glycosyltransferase mutant protein, the amino acid sequence of which is shown in SEQ ID NO.

2.

2. The fusion protein obtained by fusing the mutant protein described in SEQ ID NO.2 with a protein purification tag.

3. The gene encoding the mutant protein of SEQ ID NO.2 or the fusion protein of claim 2.

4. An expression cassette, recombinant vector, recombinant microorganism, or ex vivo recombinant cell having the gene encoding as described in claim 2.

5. The use of the mutant protein shown in SEQ ID NO.2, the fusion protein of claim 2, the encoding gene of claim 3, an expression cassette having the encoding gene of claim 3, a recombinant vector, a recombinant microorganism or an ex vivo recombinant cell in the preparation of a glycosyltransferase mutant.

6. The mutant protein shown in SEQ ID NO.2, the fusion protein of claim 2, the encoding gene of claim 3, the expression cassette having the encoding gene of claim 3, the recombinant vector, the recombinant microorganism or the recombinant cell in vitro, in the preparation of rhodioloside.

7. A method to enhance glycosyltransferases derived from sesame Si A method for improving UGT catalytic performance includes mutating glutamic acid at position 232 of SEQ ID NO.4 to proline and tyrosine at position 400 to alanine.

8. A method for preparing Rhodiola rosea using the mutant protein of claim 1 or the fusion protein of claim 2, comprising introducing an expression vector expressing the mutant protein of claim 1 or the fusion protein of claim 2 into Bacillus licheniformis.

9. The method according to claim 8, wherein the Bacillus licheniformis is Bacillus licheniformis DTR20.