Application of AtGRF4 gene in promoting cucumber fruit elongation

By stably integrating and overexpressing the AtGRF4 gene in cucumber, the problems of low precision and poor genetic stability in cucumber fruit development regulation technology were solved, resulting in a significant increase in fruit length, which is suitable for large-scale high-yield greenhouse cucumber production.

CN122256374APending Publication Date: 2026-06-23HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-17
Publication Date
2026-06-23

Smart Images

  • Figure CN122256374A_ABST
    Figure CN122256374A_ABST
Patent Text Reader

Abstract

The application will AtGRF4 The gene is stably integrated into the cucumber genome, realizes generation inheritance, and discovers that the overexpression AtGRF4 The gene can directly activate the key path of fruit development, significantly promote fruit cell division and expansion, and directly realize fruit growth. Compared with the traditional regulation mode, the present application has important practical significance and application value for developing high-efficiency and stable cucumber fruit growth technology. The present application does not need complex equipment, is simple to operate, is suitable for existing facility cultivation system, and simultaneously AtGRF4 The function is conservative, and the stable genetic transformation technology can be expanded to other melon and fruit crops, expand the application range, give consideration to high yield and operation convenience, and meet the needs of large-scale production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular biology technology, specifically relating to a... AtGRF4 Application of genes in promoting cucumber fruit elongation. Background Technology

[0002] The greenhouse vegetable industry is one of the core industries that ensures the year-round global supply of vegetables and improves agricultural economic efficiency, among which cucumbers ( Cucumis sativus L Cucumber, an annual herbaceous plant belonging to the genus Cucurbita in the family Cucurbitaceae, is an important greenhouse vegetable crop widely cultivated globally. It is also a typical dicotyledonous model plant for studying fundamental biological issues such as fruit development, sex determination, and stress response. As the core economic organ of cucumber, its development directly determines yield, fruit uniformity, quality, and marketability, playing a crucial role in ensuring a stable supply of vegetables and improving the economic benefits for growers. Currently, greenhouse cultivation environments are prone to abiotic stresses such as low temperature, weak light, and high temperature, often leading to abnormal cucumber fruit development, an increase in deformed fruits, and a decrease in fruit set rate. Traditional breeding methods are time-consuming and lack precision, and the use of chemical regulators does not meet the needs of green agriculture. Therefore, developing precise, efficient, and sustainable cucumber fruit development regulation technologies has become a research hotspot and urgent need in the current greenhouse vegetable industry and the field of plant molecular breeding.

[0003] growth regulators GRF (Growth-Regulating Factors) are a family of transcription factors unique to plants, widely involved in multiple key processes of plant growth and development, laying an important foundation for research on the regulation of plant growth and development. AtGRF Specifically refers to Arabidopsis thaliana ( Arabidopsis thaliana In ) GRF Gene family, AtGRF4 It is Arabidopsis thaliana GRF Core member of the family. Early studies clearly showed that it regulates leaf cell proliferation and the formation of cotyledonary and shoot apical meristems; subsequent studies found that it is negatively regulated by miR396, and... GIF It forms a complex that participates in signaling pathways such as GA-DELLA and auxin-MPK, coupling growth with carbon and nitrogen metabolism. In recent years, its role in shoot tip homeostasis, root development, and stress resistance has been expanded.

[0004] Despite the current situation GRF4 The regulatory mechanism has been preliminarily studied, but among the existing technologies, there is no technology that combines stable genetic transformation with... AtGRF4 Reports on technologies combining overexpression for targeted regulation of cucumber fruit growth indicate that existing cucumber fruit development regulation technologies still suffer from drawbacks such as low precision, poor genetic stability, short-lived yield-increasing effects, and insufficient adaptability, making it difficult to meet the production needs of large-scale, high-quality, and high-yield greenhouse cucumbers. Summary of the Invention

[0005] In view of this, the present invention will AtGRF4 Genes are stably integrated into the cucumber genome, achieving intergenerational inheritance, and overexpression has been observed in cucumbers. AtGRF4 It can significantly increase the length of cucumber fruits.

[0006] One of the objectives of this invention is to provide AtGRF4 The application of genes in promoting cucumber fruit elongation, the aforementioned AtGRF4 The gene nucleotide sequence is shown in SEQ ID NO.1.

[0007] Furthermore, promoting cucumber fruit elongation is achieved by overexpressing [a specific substance] within the cucumber. AtGRF4 Genetic implementation.

[0008] The second objective of this invention is to provide a product containing the above-mentioned... AtGRF4 The carrier of genes.

[0009] Furthermore, the vector, using pAG as its backbone, is digested with the restriction endonuclease BamHI, and the proAtUBQ10 promoter is inserted. AtGRF4 The terminator hspT gene was constructed.

[0010] The third objective of this invention is to provide an engineered bacterium containing the aforementioned carrier.

[0011] Furthermore, the engineered bacteria is Agrobacterium EHA105.

[0012] The fourth objective of this invention is to provide a method for obtaining long-diameter cucumber fruits. The method utilizes the aforementioned engineered bacteria to infect cucumber plants, identifies positive plants, and cultivates positive plants to obtain long-diameter cucumber fruits.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention combines stable genetic transformation AtGRF4 Overexpression was used to increase cucumber fruit growth, resulting in cucumber fruits with a longitudinal diameter approximately 1.33 times longer than wild-type cucumber fruits. This invention will... AtGRF4 This technology achieves stable integration of genes into the cucumber genome, enabling intergenerational inheritance and avoiding the problems of unstable regulatory effects and the need for repeated operations caused by transient expression. It also reduces long-term application costs. Furthermore, this technology requires no complex equipment, is easy to operate, and is compatible with existing facility cultivation systems. AtGRF4 Its functions are conservative, and its stable genetic transformation technology can be extended to other melon and fruit crops, expanding its application scope, balancing high yield and ease of operation, and meeting the needs of large-scale production. Attached Figure Description

[0014] Figure 1 This is a pAG carrier spectrum in Embodiment 1 of the present invention.

[0015] Figure 2 pAG- in Embodiment 1 of the present invention AtGRF5 Carrier map.

[0016] Figure 3 pBSE- in Embodiment 1 of the present invention AtGRF4 Carrier map.

[0017] Figure 4 pAG- in Embodiment 1 of the present invention AtGRF4 Carrier map.

[0018] Figure 5 pAG- in Embodiment 1 of the present invention AtGRF4 Carrier construction flowchart.

[0019] Figure 6 In Example 2 of this invention, pAG- was overexpressed. AtGRF4 Images of male and female flowers of cucumber T0 generation plants.

[0020] Figure 7 In Example 2 of this invention, pAG- was overexpressed. AtGRF4 Stable genetic transformation processes in cucumbers.

[0021] Figure 8 Example 2 of the present invention: overexpression of pAG- in cucumber AtGRF4 Promotes fruit elongation and fruit setting. Detailed Implementation

[0022] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and all reagents and consumables are commercially available products.

[0023] Example 1 This embodiment provides a AtGRF4 The application of genes in promoting cucumber fruit elongation is as follows: 1.1 pAG- AtGRF4 Construction of overexpression vectors Using pAG as the backbone vector (see vector map) Figure 1 The enzyme was digested with the restriction endonuclease BamHI, and the proAtUBQ10 promoter was inserted. AtGRF5 Gene( AtGRF5 The gene sequence is shown in SEQ ID NO.2) and the terminator. HspT The gene and vector were named pAG- AtGRF5 (See vector map)Figure 2 (This was constructed by Genewiz Biotechnology Co., Ltd.) The return vector pAG- AtGRF5 Enzymatic digestion with Stul and BamHI enzymes was used to extract pBSE- AtGRF4 Vector (see vector map) Figure 3 amplification on ) AtGRF4 The target fragment was cloned into the restriction enzyme vector pAG- using homologous recombination via 5' Stul and 3' BamHI. AtGRF5 Constructing the overexpression vector pAG- AtGRF4 (pAG-) AtGRF4 See the vector map Figure 4 All vector plasmids contain the GFP green reporter gene and aadA resistance, which will be used for tagging and screening in subsequent transformation experiments (see the entire vector construction process). Figure 5 ).

[0024] Vector digestion: First, pAG- was digested using Stul and BamHI enzymes. AtGRF5 The vector was double-digested, incubated overnight at 37°C, and then inactivated at 80°C for 15 minutes. The reaction system is shown in Table 1.

[0025] Table 1. Stul and BamHI double enzyme digestion reaction system

[0026] Target gene cloning and recovery: Cloning primers were designed using Geneious software and synthesized by Beijing Qingke Biotechnology Co., Ltd. pAG- was added to the primers. AtGRF5 Upstream and downstream adapter primer sequences for the vector. Using pBSE- AtGRF 4 Using the vector plasmid as a template, a high-fidelity PCR reaction system was used to amplify the CDS of the target gene. The PCR amplification reaction system and procedure are shown in Tables 2 and 3.

[0027] The amplification primers are as follows: aadA- GRF4 -GFP-F: TCATCTTCATATGGATCCTTAATGAAAAACTTGAGTAGAGATTCCCA; aadA- GRF4 -GFP-R: TAACAGAGGCCTTGTACAATGGACTTGCAACTGAAACAATGG.

[0028] Table 2 High-fidelity PCR reaction system for the target gene

[0029] Table 3 PCR amplification program

[0030] Transformation of Escherichia coli: The ligation product was transformed into E. coli by heat shock. The specific steps are as follows: Take out competent E. coli cells from the -80℃ freezer, add 10 μL of ligation product to 100 μL of competent E. coli cells, freeze for 5 min, then react in a 42℃ water bath for 45 s, freeze for another 5 min, then add 700 μL of antibiotic-free LB liquid medium in a clean bench, place in a 37℃ shaker, shake at 200 rpm for 30 min, then take 100 μL and spread evenly on LB solid medium (Kan resistant, 50 mg / L) plates, seal the plates and incubate overnight in a 37℃ incubator.

[0031] Colony PCR: Single colonies were picked from overnight LB solid medium containing Kan resistance using a sterile toothpick or pipette tip and placed into a centrifuge tube containing 1 mL of liquid LB medium containing Kan resistance. The mixture was shaken at 37°C and 200 rpm for colony PCR identification. After the PCR reaction, 1% agarose gel electrophoresis was performed for identification. Once the bands met the expected size, they were sent to the company for sequencing. Then, Geneious software was used for sequence alignment to verify that the obtained gene coding region sequence matched the reference CDS sequence.

[0032] 1.2 pAG- AtGRF4 Genetic transformation experiments of overexpression vectors Agrobacterium transformation: The plasmid was transformed into Agrobacterium competent cells using a freeze-thaw method. The specific steps are as follows: The expression vector plasmid returned by Genewiz Biotechnology Co., Ltd. was transformed into Agrobacterium EHA105 (Agrobacterium strain EHA105 was purchased from Shanghai Weidi Biotechnology Co., Ltd.). In a clean bench, 2 μL of plasmid was added to 100 μL of EHA105 Agrobacterium competent cells and gently tapped to mix. After mixing, the cells were incubated on ice for 5 min, then frozen in liquid nitrogen for 1 min, and then quickly placed in a 37°C water bath for 5 min. 800 μL of LB medium was added, and the cells were incubated at 28°C and 220 rpm for 2 h on a shaker. Spread it evenly on a solid medium containing 50 mg / L kanamycin and 50 mg / L rif, and incubate in the dark at 28°C for two days. Select single-clone plaques and shake them in LB+Kanamycin+Rif liquid for 12 hours. After shaking and mixing, perform positive identification. Agrobacterium-containing solutions that test positive can be stored in a 4°C refrigerator for short-term use. For long-term use, add an equal volume of 50% sterilized glycerol, mix by inversion, and store in a -80°C refrigerator for later stable genetic transformation.

[0033] Cucumber genetic transformation experiment: (1) Sowing: Take plump and uniform CU2 cucumber seeds (from the National Key Laboratory of Germplasm Innovation and Utilization of Fruit, Vegetable and Horticultural Crops, Huazhong Agricultural University), soak them in 55℃ warm water for more than half an hour, and remove the seed coat. In a clean bench, first wash with 75% alcohol for less than 30 seconds, then soak in 0.3% NaClO solution for 15 minutes, gently shaking during the process. After disinfection, rinse 5 times with sterile water. Transfer the disinfected seeds to the prepared seed germination medium. Incubate in the dark at 28℃ for 24 hours. When the seed coat begins to peel off and clear vascular bundle ridges appear on the cotyledons, the explants can be cut off.

[0034] (2) Agrobacterium infection: A single colony of positive Agrobacterium EHA105 was picked and placed in 2 mL of LB liquid medium containing 50 mg / L Kan and 50 mg / L Rif, and incubated overnight at 28°C and 220 rpm. Then, it was diluted 1:500 and added to 50 mL of fresh LB liquid medium (containing Kan and Rif), and incubated overnight at 28°C and 220 rpm. The next day, when the bacterial culture reached OD... 600 When the concentration is 0.4-0.8, centrifuge at 6000 rpm for 8 min to collect Agrobacterium, resuspend the cells in 1M liquid medium and dilute to OD. 600 Prepare 0.2 mL for later use. Take germinated seeds and, in a clean bench, remove approximately 1 / 3 of the distal cotyledons, remove the hypocotyl, and separate the two cotyledons. Each cotyledon will form a U-shaped wound near its proximal end, thus obtaining the explant. Place the cut explants into the prepared resuspension solution and sonicate at 50W for 30 seconds. In the clean bench, remove the plunger of the syringe. Add the sonicated cotyledon explants and resuspension solution to the syringe barrel of a 20 mL syringe. Gently insert the plunger and push it forward to the 10 mL mark. Seal the syringe tip with a rubber stopper. Slowly and forcefully pull the plunger back to the 20 mL mark and hold for 1.5 minutes to apply vacuum pressure. Release the plunger; it will slowly return to the 10 mL mark. Repeat this vacuum pressure application for 1.5 minutes each time.

[0035] (3) Co-culture: After infection, the explants were spread on filter paper to gently absorb the attached bacterial solution, and then transferred to a co-culture medium with two layers of filter paper. After sealing, they were co-cultured at 23°C in the dark for four days. The luminescence of GFP was observed using a handheld fluorescent protein observation lamp LUYOR-3415RG dual-wavelength fluorescent protein excitation light source UV lamp to evaluate the infection efficiency.

[0036] (4) Differentiation and regeneration: Wash the explants 7-8 times with sterile water, blot dry the liquid adhering to the surface with sterile absorbent paper, and insert the explants obliquely into the recovery medium. After 7 days of recovery culture, transfer them to the differentiation medium and subculture them about every two weeks. After culturing under light for four weeks, use a handheld fluorescent protein observation lamp to select cotyledons containing GFP fluorescence and subculture them into tissue culture bottles containing regeneration medium or elongation medium.

[0037] (5) Identification of positive buds: Positive plants were detected using a handheld fluorescent protein observation lamp, LUYOR-3415RG, with a dual-wavelength fluorescent protein excitation source and ultraviolet light. Following the instructions for use, the green light source was turned on to excite fluorescence, and the presence of green fluorescence was detected using the corresponding green filter (results are shown in [link to results]). Figure 6 , 7 ).

[0038] The formulation of the cucumber plant tissue culture medium used in this experiment is as follows: Seed germination medium: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 2 mg / L 6-BA + 1 mg / L LABA, pH 5.85-5.90; IM liquid medium: 4.43 g / L MS + 30 g / L sucrose + 2 mg / L 6-BA + 1 mg / L ABA + 2.5 M MES + 80 mg / L LAs, pH 5.85-5.90; Co-culture medium: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 2 mg / L 6-BA + 1 mg / L ABA + 2.5 M MES + 80 mg / L As + 250 μM LA, pH 5.85-5.90; Recovery medium: 4.43 g / L MS + 30 g / L sucrose + 9 g / L Agar + 2 mg / L 6-BA + 1 mg / L ABA + 200 mg / mL TMT, pH 5.85-5.90; Differentiation medium: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 2 mg / L 6-BA + 1 mg / L ABA + 200 mg / mL TMT + 125 mg / L Spe, pH 5.85-5.90; Rooting medium: 4.43 g / L MS + 30 g / L sucrose + 3.5 g / L plant gel + 200 mg / mL TMT, pH 5.85-5.90.

[0039] Depend on Figure 4 , 5It can be seen that the cucumber seedlings were successfully transfected. The transgenic plants were planted in the artificial climate chamber of the glass greenhouse and the plastic greenhouse of the National Vegetable Improvement Center of Huazhong Agricultural University in Wuhan, China. After the fruits matured, they were harvested, their lengths were measured with a tape measure, and photographs were taken. The data were statistically plotted using Graphpad Prism 10.1.2 (results are shown in...). Figure 8 ).

[0040] Figure 6 The results showed that overexpression AtGRF4 The transgenic plants showed a positive regulatory effect on fruit elongation. The longitudinal diameter of wild-type fruits was 36 cm, while the longitudinal diameter of AtGRF4-overexpressing plants was 48 cm, which was about 1.33 times that of wild-type fruits.

[0041] The above series of studies demonstrate that this application has successfully verified Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0042] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. AtGRF4 The application of genes in promoting cucumber fruit elongation is characterized by, The AtGRF4 The gene nucleotide sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, Promoting cucumber fruit elongation by overexpressing [a specific substance] within the cucumber. AtGRF4 Genetic implementation.

3. A device comprising the contents of claim 1 AtGRF4 The carrier of genes.

4. The carrier according to claim 3, characterized in that, The vector, using pAG as its backbone, is digested with the restriction endonuclease BamHI, and then the proAtUBQ10 promoter is inserted. AtGRF4 The terminator hspT gene was constructed.

5. An engineered bacterium, characterized in that, The engineered bacteria contain the vector described in any one of claims 3 or 4.

6. The engineered bacteria according to claim 5, characterized in that, The engineered bacteria is Agrobacterium EHA105.

7. A method for obtaining cucumber fruits with long longitudinal diameter, characterized in that, The method utilizes the engineered bacteria described in any one of claims 5 or 6 to infect cucumber plants, identify positive plants, and cultivate positive plants to obtain cucumber fruits with long longitudinal diameter.