Gene for improving self-pollination seed setting rate of alfalfa and application thereof
By inhibiting the expression of the MsFER gene in alfalfa and using RNA interference technology to improve the self-pollination seed setting rate and self-pollination pod setting rate, the problem of low self-pollination seed setting rate of alfalfa was solved, resulting in a significant improvement in economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF BOTANY CHINESE ACAD OF SCI
- Filing Date
- 2026-04-07
- Publication Date
- 2026-06-23
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to a gene that improves the self-pollination and seed setting rate of alfalfa and its application. Background Technology
[0002] alfalfa ( Alfalfa ) is a type of legume ( Fabaceae Papilionoideae ( Papilionaceae ) genus Alfalfa ( Medicago Alfalfa is an important forage crop. However, due to its self-incompatibility (SI), the self-pollination rate of its seeds is often low in actual production applications. Improving the self-pollination rate of alfalfa seeds has significant economic and practical value.
[0003] FERONIA ( FER α and its family of receptor kinases are key regulators of plant growth, proliferation, and response to environmental changes. When first discovered, FER It plays an important role in the fertility of pistils in Arabidopsis thaliana; however, with further research, it has been found that... FERIt also regulates the growth and development of the entire plant and plays an important role in responding to biotic and abiotic stresses (Cheung A Y. FERONIA: a receptor kinase at the core of a global signaling network[J]. Annual review of plant biology, 2024, 75.). FER and LLG1 can form a co-receptor, which, after binding with the ligand RALF, forms the RALF-FER-LLG1 complex, participating in the regulation of multiple biological processes such as plant fertility, cell growth and proliferation, and response to environmental stress. (Capron A, Gourgues M, Neiva LS, et al. Maternal control of male-gamete delivery in Arabidopsis involves a putative GPI-anchored protein encoded by the LORELEI gene[J].The Plant Cell, 2008, 20(11):3038-3049. Haruta M, Sabat G, Stecker K, et al. A peptide hormone and its receptor protein kinase regulate plant cell expansion[J].Science, 2014, 343(6169):408-411. Ge Z, Zhao Y, Liu MC, et al. LLG2 / 3 are co-receptors in BUPS / ANX-RALF signaling to regulate Arabidopsis pollen tube integrity[J]. Current Biology, 2019, 29(19):3256-3265.e5.). FER is a transmembrane receptor kinase that can interact with a variety of molecules in the extracellular matrix, cell membrane, cytoplasm, and nucleus, such as pectin, reactive oxygen species (ROS), and calcium. 2+NO, LRX proteins, etc. By constructing complex signaling networks, FER plays a crucial role in plant signal transduction (Wang P, Clark NM, Nolan TM, et al. Integrated omics reveal novel functions and underlying mechanisms of thereceptor kinase FERONIA in Arabidopsis thaliana[J]. The Plant Cell, 2022, 34(7):2594-2614.). In addition, FER also crosstalks with other hormone pathways that mainly control plant growth and stress, such as auxin, brassinolide, ethylene, abscisic acid, and jasmonic acid (Li C, Wu HM, Cheung A Y. FERONIA and her pals: functions and mechanisms[J]. Plant physiology, 2016, 171(4):2379-2392.). However, whether it exists in alfalfa is unknown. FER There are no reports on the homologous genes of alfalfa, or whether the homologous genes, if present, can play a role in regulating the reproductive growth of alfalfa and increasing the self-pollination rate of alfalfa seeds. Summary of the Invention
[0004] The purpose of this invention is to improve the self-pollination seed setting rate and / or self-pollination pod setting rate of alfalfa.
[0005] This invention first protects a method for breeding transgenic alfalfa, which may include the following steps: reducing the expression level of the gene encoding the protein MsFER in the starting alfalfa to obtain transgenic alfalfa; compared with the starting alfalfa, the self-pollination seed setting rate and / or self-pollination pod setting rate of the transgenic alfalfa are increased.
[0006] In the above method, the protein MsFER can be a1) or a2).
[0007] a1) The amino acid sequence is that of the protein shown in SEQ ID No. 1; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 1.
[0008] SEQ ID No.1 consists of 899 amino acid residues.
[0009] In a2), the labels can be as shown in Table 1.
[0010] Table 1. Sequence of Labels
[0011] In the above method, the gene encoding the protein MsFER can specifically be... MsFER Genes. The aforementioned MsFER The nucleotide sequence of the gene may be as shown in SEQ ID No. 2.
[0012] In the above method, reducing the expression level of the gene encoding the protein MsFER in the starting alfalfa is achieved by introducing an inhibitor into the starting alfalfa. MsFER It is achieved through the substances that express genes.
[0013] Furthermore, the suppression of the MsFER The gene expression substance may be a specific DNA molecule, an expression cassette containing the specific DNA molecule, or a recombinant plasmid containing the specific DNA molecule; The specific DNA molecule may include a sense fragment, an antisense fragment, and a spacer fragment located between them; The positive segment may be the DNA molecule shown in SEQ ID No. 4 from position 1 to 222 starting from the 5' end; The antisense fragment may be the DNA molecule represented by SEQ ID No. 4, positions 423-644 from the 5' end.
[0014] Furthermore, the spacer fragment may be the DNA molecule shown in SEQ ID No. 4, positions 223-422 from the 5' end.
[0015] Furthermore, the specific DNA molecule may specifically consist of a sense fragment, an antisense fragment, and a spacer fragment located between them.
[0016] Furthermore, the nucleotide sequence of the specific DNA molecule is shown in SEQ ID No. 4.
[0017] Furthermore, the recombinant plasmid containing the specific DNA molecule may specifically be the RNA interference vector mentioned in the embodiments. PEG100 - MsFER - RNAi - K RNA interference vector PEG100 - MsFER - RNAi - K It contains the palindromic sequence shown in SEQ ID No. 4.
[0018] In the above text, positions 1-222 from the 5' end of SEQ ID No. 4 represent the target site sequence, and positions 423-644 represent the reverse complementary sequence of the target site sequence. The palindromic sequence shown in SEQ ID No. 4 can form a hairpin structure.
[0019] The suppression described above MsFER The application of gene-expressed substances in improving the self-pollination seed setting rate and / or self-pollination pod setting rate of alfalfa is also within the scope of protection of this invention.
[0020] The suppression described above MsFER The application of gene-expressed substances in the cultivation of transgenic alfalfa with improved self-pollination seed setting rate and / or self-pollination pod setting rate also falls within the scope of protection of this invention.
[0021] The alfalfa mentioned above can specifically be alfalfa variety Zhongmu No. 1.
[0022] Experiments have shown that RNA interference technology can reduce the concentration of certain substances in alfalfa (such as Alfalfa No. 1). MsFER Gene expression levels, self-pollination pod setting rate, and self-pollination seed setting rate were all significantly increased. This indicates that inhibiting... MsFER Gene expression can improve the self-pollination pod setting rate and self-pollination seed setting rate of alfalfa. This invention has significant application value. Attached Figure Description
[0023] Figure 1 for MsFER Gene structure, knockdown MsFER A schematic diagram of gene target sites (A) and knockdown using an RNA interference system. MsFER RNA interference vectors for genes PEG100 - MsFER - RNAi - K Schematic diagram (B).
[0024] Figure 2 For the identification of the three pseudo-transgenic alfalfas in step two of Example 2; A is the positive detection of Zhongmu No. 1 and transgenic alfalfa using Bar test strips; B is Zhongmu No. 1 and positive transgenic alfalfa. MsFER Detection of relative gene expression levels.
[0025] Figure 3 To knock down MsFER The phenotype of adult transgenic alfalfa.
[0026] Figure 4 To knock down MsFER Genetically modified alfalfa MsFER - RNAi - K4 The phenotype of the pods and seeds.
[0027] Figure 5 To knock down MsFER Statistical results of self-pollination pod setting rate of transgenic alfalfa (A) and knockdown MsFER Statistical results of self-pollination seed set rate of transgenic alfalfa (B). Detailed Implementation
[0028] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0030] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.
[0031] Alfalfa Zhongmu No. 1 is an alfalfa variety bred by the Institute of Animal Husbandry, Chinese Academy of Agricultural Sciences. Breeding was completed in 1997, and it was approved by Ningxia in 2003 (registration number: Ning Shen Mu 2003006). In the following text, Alfalfa Zhongmu No. 1 will be abbreviated as Zhongmu No. 1.
[0032] Example 1: Cloning of the protein MsFER and its encoding gene The inventors of this application cloned FER protein homologous sequence from Zhongmu No. 1. MsFER Gene. MsFER The nucleotide sequence of the gene is shown in SEQ ID No. 2. MsFER The gene encodes the protein MsFER, and the amino acid sequence of the protein MsFER is shown in SEQ ID No. 1. MsFER The structure of a gene is as follows Figure 1 As shown in Figure A.
[0033] The specific steps for cloning genes from Zhongmu-1 are as follows: Primers P1 and P2 were designed and synthesized for full-length gene amplification. Then, using cDNA from *Agrostis chinensis* var. *mongolica* as a template, PCR amplification was performed using the primer pair composed of primers P1 and P2 to obtain the PCR amplification product.
[0034] The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their sequence information is as follows: Primer P1: ATGGTCATGATGAGGAACATGA (SEQ ID No. 5); Primer P2: TTAACGTCCTTTTGGATTCATGATCT (SEQ ID No. 6).
[0035] The PCR reaction system consisted of 5 μl DNA, 2 μl primer P1 (10 μM), 2 μl primer P2 (10 μM), 25 μl 2× PhantaMax buffer, 1 μl PhantaMax Super-Fidelity DNA Polymerase (Vazyme Biotech Co., Ltd.), 1 μl 10x dNTP Mix (10 μM), and 14 μl ddH2O, for a total volume of 50 μl.
[0036] PCR reaction program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 3 min, for a total of 35 cycles; 72℃ final extension for 5 min; store at 4℃. PCR reactions were performed using a PCR instrument (BIO-GENDER Technology).
[0037] The PCR amplification products were subjected to 1% agarose gel electrophoresis (Sigma-Aldrich), yielding a PCR product band of approximately 2700 bp of the target gene. After gel excision, the PCR product was purified and recovered using a kit (UElandy Inc.). The purified product was then ligated into the pTOPO (GenStar) vector and transformed into *E. coli* DH5α competent cells (Beijing Tsingke Biotech Co., Ltd.). After bacterial selection and shaking, identification was performed using universal primer M13, and positive clones were selected for first-generation sequencing. Sequencing results showed that the PCR reaction yielded the nucleotide sequence shown in SEQ ID No. 2, and... MsFER The gene sequence is identical, encoding the amino acid sequence shown in SEQ ID No. 1. After extracting the plasmid from the positive clone, it was labeled as... MsFER -template, stored at -20℃.
[0038] Example 2, Knockdown MsFER Obtaining genetically modified alfalfa 1. Used for knocking down MsFER RNA interference vectors for genes PEG100 - MsFER - RNAi - K Construction The company commissioned Wuhan Boyuan Biotechnology Co., Ltd. to develop a method for knocking out low-dose cells. MsFER RNA interference vectors for genes PEG100 - MsFER - RNAi - K The specific steps are as follows: 1. Based on the nucleotide sequence shown in SEQ ID No. 2 MsFERThe gene was designed with target site sequences. The target site sequence is: 5'-GATGTGAAGACTACAAACATTTTACTAGATGAGAAGTGGGTGGCCAAGGTTTCTGATTTTGGATTGTCTAAAACAGGTCCTACATTGGATAATACTCATGTAAGTACCGTGGTAAAGGGTAGTTTTGGTTACTTGGATCCAGAATACTTTAGGAGGCAACAACTGACCGACAAATCCGATGTGTACTCATTTGGTGTGGTTCTATTCGAGGTACTTTGTGCT-3' (shown in SEQ ID No. 3), corresponding to positions 1996-2217 from the 5' end of SEQ ID No. 2.
[0039] 2. Sequence amplification and recovery (1) Artificially synthesized primers P3: cagtGGTCTCagatcgatgtgaagactacaaacattttactagatgagaagtg (SEQ ID No. 7), primer P4: cgatGGTCTCacaggagcacaaagtacctcgaatagaaccacac (SEQ ID No. 8), primer P5: cgatGGTCTCacctgcaggtctagtttttctccttcattttc (SEQ ID No. 9), primer P6: cgatGGTCTCagcccgggctctgtaactatcatc (SEQ ID No. 10), primer P7: cagtGGTCTCagggcagcacaaagtacctcgaatagaaccacac (SEQ ID No. 11) and primer P8: cagtGGTCTCactaggatgtgaagactacaaacattttactagatgagaagtg (SEQ ID No. 12).
[0040] (2) Obtained in Example 1 MsFER Using the template as a template, PCR amplification was performed using primer pair P3 and P4. The PCR amplification products were subjected to 1.5% agarose gel electrophoresis, and then the 222bp microarray was recovered using a kit. MsFER Gene amplification sequence tgtF.
[0041] (3) Using the RNA interference vector PEG100-CCDB (Biorun) as a template, PCR amplification was performed using primer pair composed of primers P5 and P6. The PCR amplification products were subjected to 1.5% agarose gel electrophoresis, and then the loop sequence with a size of 200bp was recovered using a kit.
[0042] (4) Obtained in Example 1 MsFER Using the template as a template, PCR amplification was performed using primer pair P7 and P8. The PCR amplification products were subjected to 1.5% agarose gel electrophoresis, and then the 222 bp microarray was recovered using a kit. MsFER Gene amplification sequence tgtR.
[0043] 3. RNA interference vector PEG100 - MsFER - RNAi - K Construction (1) The RNA interference vector PEG100-CCDB was digested with restriction endonucleases BamHI and XbaI, and the vector backbone was recovered.
[0044] The enzyme digestion system consisted of 20 μl of PEG100-CCDB RNA interference vector, 1 μl of restriction endonuclease BamHI, 1 μl of restriction endonuclease XbaI, 2 μl of 10× Buffer, and 12 μl of Nuclease-free Water.
[0045] Enzyme digestion procedure: react at 37℃ for 1 hour.
[0046] (2) The rDNA Flt3 sequence was digested with restriction endonucleases BsaI and Eco31I. MsFER Gene amplification sequence tgtF, loop sequence or MsFER Gene amplification sequence (tgtR), and DNA fragment recovery.
[0047] The enzyme digestion system consisted of 20 μl of rDNA Flt3 sequence, 0.5 μl of restriction endonuclease BsaI, 0.5 μl of restriction endonuclease Eco31I, 2 μl of 10× Buffer, and 13 μl of Nuclease-free Water.
[0048] (3) Ligate the vector backbone recovered in step (1) and the three DNA fragments recovered in step (2) to obtain the RNA interference vector. PEG100 - MsFER - RNAi - KThe specific steps are as follows: Combine the vector backbone recovered in step (1) and the three DNA fragments recovered in step (2), purify them using a PCR purification kit (Axygen), and label the purified product as P-rDNAFlt3; take a clean centrifuge tube for ligation reaction, react at 20℃ for 1 h to obtain ligation product; take 5 μL of ligation product to transform competent E. coli cells, plate them on Kan resistance culture dishes, and incubate at 37℃ for 12 h; after picking bacteria, perform colony PCR identification, and use universal primer M13F and primer P9: ctcaagcaatcaagcattctac (SEQ ID No. 13); after confirming positive (the PCR amplification product contains a DNA fragment of size 1602 bp), extract the plasmid, i.e., the RNA interference vector. PEG100 - MsFER - RNAi - K .
[0049] The ligation system consisted of 10 μl of 2.5 μl P-rDNAFlt3, 1 μl T4_ligase, 1 μl 10×Buffer, and 5.5 μl Nuclease-free Water.
[0050] RNA interference vector PEG100 - MsFER - RNAi - K Sequencing was performed. The sequencing results indicated that the RNA interference vector... PEG100 - MsFER - RNAi - K It contains the palindromic sequence shown in SEQ ID No. 4.
[0051] In SEQ ID No. 4, positions 1-222 from the 5' end are the target sequence, and positions 423-644 are the reverse complementary sequence of the target sequence. The palindromic sequence shown in SEQ ID No. 4 can form a hairpin structure.
[0052] RNA interference vector PEG100 - MsFER - RNAi - K See the structural diagram. Figure 1 B.
[0053] II. Knocking down MsFER Obtaining genetically modified alfalfa The company commissioned Wuhan Boyuan Biotechnology Co., Ltd. to develop the RNA interference vector. PEG100 - MsFER - RNAi - K The specific steps for converting to Alfalfa No. 1 are as follows: 1. Contains RNA interference vector PEG100 - MsFER - RNAi - K Preparation of recombinant Agrobacterium 1 μL RNA interference vector PEG100 - MsFER - RNAi - KAdd 50 μL of EHA105 Agrobacterium competent cells (Wuhan Boyuan Biotechnology Co., Ltd.), mix thoroughly, and transfer to an electroporation cuvette. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and transfer to a 1.5 mL centrifuge tube. Incubate at 30℃ and 180 rpm for 30 min with shaking. Inoculate the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30℃ for 48 h. After picking bacteria, perform colony PCR detection. The primers were identified as universal primers M13F and P9, yielding a vector containing RNA interference. PEG100 - MsFER - RNAi - K The recombinant Agrobacterium (PCR amplification product containing a DNA fragment of 1602 bp).
[0054] The following text contains RNA interference vectors. PEG100 - MsFER - RNAi - K Recombinant Agrobacterium is abbreviated as recombinant Agrobacterium.
[0055] 2. Genetic transformation of Zhongmu No. 1 alfalfa—obtaining transgenic alfalfa Following the alfalfa leaf disc transformation method (Fu C, Hernandez T, Zhou C et al., Alfalfa (Medicago sativa L.) [M], New York, NY: Springer New York, 2014:213-221), recombinant Agrobacterium was transformed into Zhongmu No. 1 to obtain transgenic alfalfa. The specific steps are as follows: (1) Grind the seeds of Zhongmu No. 1 with sandpaper, disinfect them with 75% alcohol for 5 minutes, and rinse them with sterile water for 1 minute; then disinfect them with 84 disinfectant for 3 minutes, and rinse them with sterile water 3 times, 1 minute each time. Sow the disinfected seeds on germination medium and culture them at 23±2℃ with alternating light and dark for 2-3 months to obtain Zhongmu No. 1 leaves. Cut the sterile Zhongmu No. 1 leaves into small pieces with a scalpel and inoculate them into pre-culture medium, and culture them at 24℃ for 2-3 days.
[0056] (2) Resuspend the recombinant Agrobacterium in the infection solution to obtain OD. 600nm It is a resuspension of Agrobacterium at a concentration of 0.2-0.3.
[0057] (3) Place the leaves of Zhongmu No. 1 that have completed step (1) in Agrobacterium resuspension for 10-15 min, then place them on filter paper to dry, and then place them on co-culture medium and incubate in the dark at 24℃ for 48-72 h.
[0058] (4) After completing step (3), the leaves of Zhongmu No. 1 are inoculated into a resistance culture medium and cultured at 24°C until callus tissue grows (about 60 days), thus obtaining Zhongmu No. 1 callus tissue.
[0059] (5) After completing step (4), the Zhongmu No. 1 callus is inoculated into differentiation medium and cultured at 23±2℃ with alternating light and dark for about 60 days; if the callus produces buds, it is inoculated onto elongation medium and grown for about 60 days to obtain Zhongmu No. 1 seedlings.
[0060] (6) The seedlings of Zhongmu No. 1 obtained in step (5) were inoculated into rooting medium and cultured at 23±2℃ with alternating light and dark for about 30 days to obtain transgenic alfalfa.
[0061] The above-mentioned germination medium, infection solution, co-culture medium, resistance medium, differentiation medium, elongation medium and rooting medium can all be prepared according to the literature (Fu C, Hernandez T, Zhou C et al., Alfalfa (Medicago sativa L.) [M], New York, NY: Springer New York, 2014:213-221).
[0062] 3. Identification of genetically modified alfalfa (1) Preliminary molecular identification Genomic DNA was extracted from the alfalfa protogenes obtained in step 2 using the CTAB method and used as templates for PCR amplification with universal primers M13F and P9. The PCR amplification products were then determined as follows: if the PCR amplification product of a protogenes alfalfa contained a DNA fragment of 1602 bp, the protogenes alfalfa was preliminarily identified as a transgenic alfalfa.
[0063] (2) Positive identification Crude protein extracts were extracted from the leaves of the alfalfa to be tested (the transgenic alfalfa obtained in step (1) or Zhongmu No. 1 (as a negative control)), and then tested using Bar test strips (Wuhan Boyuan Biotechnology Co., Ltd.). The following determination was then made: if the Bar test strip for a certain transgenic alfalfa contained two bands, then the transgenic alfalfa was a positive transgenic alfalfa.
[0064] Some test results can be found Figure 2 Zhong A (WT refers to Zhongmu No. 1) MsFER - RNAi - K (For transgenic alfalfa). The results showed that all the transgenic alfalfa identified in step (1) were positive transgenic alfalfa.
[0065] (3) Identification of RNA knockdown levels ① Total RNA was extracted from the leaves of the alfalfa to be tested (positive transgenic alfalfa identified in step (2) or Zhongmu No. 1 (as a negative control)) using a polysaccharide and polyphenol plant RNA extraction kit (Coolaber Science & Technology Co., Ltd.). The total RNA of the alfalfa to be tested was then reverse transcribed (Beijing LABLEAD Trading Co., Ltd.) to obtain the cDNA of the alfalfa to be tested.
[0066] ②RT-PCR detection of cDNA in the alfalfa sample MsFER Relative gene expression levels (in terms of) Actin (This is an internal reference gene).
[0067] Detection MsFER The primers for the gene are the upstream primer MsFER-JD-F: TCTCCAAACTTCGTCACCGG (SEQ ID No. 14) and the downstream primer MsFER-JD-R: TTGGCCACCCACTTCTCATC (SEQ ID No. 15).
[0068] Detection Actin The primer for the gene is the upstream primer. Actin - F : AGAAGCATTTCCTGTGGACA (SEQ ID No. 16) and downstream primer Actin - R :GTATTGCTGACCGTATGAGC (SEQ ID No. 17).
[0069] The reaction system consisted of 10 μl of alfalfa cDNA, 0.3 μl of upstream primer (10 μM) aqueous solution, 0.3 μl of downstream primer (10 μM) aqueous solution, 5 μl of 2×Rapid Taq Master Mix (Vazyme Biotech Co., Ltd.), and 3.4 μl of ddH2O.
[0070] The reaction procedure was as follows: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles; extension at 72℃ for 5 min; storage at 4℃.
[0071] Some test results can be found Figure 2 ZhongB (WT represents Zhongmu No. 1, and i4, i8, and i9 are positive transgenic alfalfa). Results showed that compared to Zhongmu No. 1, i4, i8, and i9... MsFER The relative expression levels of genes were significantly reduced. Therefore, i4, i8, and i9 were all knocked down. MsFER The genetically modified alfalfa were named sequentially. MsFER - RNAi - K4 ,MsFER - RNAi - K8 and MsFER - RNAi - K9 .
[0072] Example 3, Knockdown MsFER Phenotypic identification of transgenic alfalfa genes Three alfalfa seedlings were planted in the greenhouse. MsFER - RNAi - K4 , MsFER - RNAi - K8 and MsFER - RNAi - K9 Observe the phenotype of mature plants. After the pods mature, observe the phenotype of the harvested pods and seeds; based on the pod-bearing status of the plants, count the number of large branches, small branches, inflorescences, florets, pods, self-pollination pod setting rate (pods / florets), seed / pod ratio, and self-pollination seed setting rate (seeds / florets).
[0073] Some adult plant phenotypes are shown Figure 3 (WT refers to Zhongmu No. 1) MsFER - RNAi - K4 , MsFER - RNAi - K8 and MsFER - RNAi - K9 To knock down MsFER (Transgenic alfalfa). Results showed that under the same culture conditions, *Zhongmu No. 1* barely formed pods. MsFER - RNAi - K4 , MsFER - RNAi - K8 and MsFER - RNAi - K9 All of them are capable of self-pollination and pod formation.
[0074] See phenotypes of pods and some seeds. Figure 4 (A represents the pods harvested after the plant has matured; WT represents Zhongmu No. 1.) MsFER - RNAi - K for MsFER - RNAi - K4 B is MsFER - RNAi - K4 (Phenotypes of pods and seeds). The results showed that... MsFER - RNAi - K4 , MsFER - RNAi - K8 and MsFER - RNAi - K9 It can self-pollinate in large quantities to form pods, while Zhongmu No. 1 can only self-pollinate in very few cases to form pods.
[0075] Some statistical results are shown in Table 2 (WT1, WT2, and WT3 are three alfalfa plants). Statistical results for self-pollination pod setting rate and self-pollination seed setting rate are shown in Table 2. Figure 5 (A represents the percentage of self-pollination pod setting rate, B represents the percentage of self-pollination seed setting rate; WT is the average value of Alfalfa No. 1 among WT1, WT2, and WT33 plants.) MsFER - RNAi for MsFER - RNAi - K4 , MsFER - RNAi - K8 and MsFER - RNAi - K9 The average value was used; a two-tailed t-test was employed to analyze the significant differences. This indicates that the difference between the two reached a significant level (P<0.05). The results show that, compared to Zhongmu No. 1, knockdown... MsFER Genetically modified alfalfa (e.g.) MsFER - RNAi - K4 ,MsFER - RNAi - K8 , MsFER - RNAi - K9 The self-pollination pod setting rate and self-pollination seed setting rate of ) were significantly improved.
[0076] Table 2
[0077] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A method for breeding transgenic alfalfa, comprising the following steps: reducing the expression level of the gene encoding the protein MsFER in the starting alfalfa to obtain transgenic alfalfa; compared with the starting alfalfa, the self-pollination seed setting rate and / or self-pollination pod setting rate of the transgenic alfalfa are increased. The protein MsFER is either a1) or a2). a1) The amino acid sequence is that of the protein shown in SEQ ID No. 1; a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No.
1.
2. The method according to claim 1, characterized in that: The gene encoding the protein MsFER is MsFER Gene; The MsFER The nucleotide sequence of the gene is shown in SEQ ID No.
2.
3. The method according to claim 1 or 2, characterized in that: The reduction of the expression level of the gene encoding the protein MsFER in alfalfa is achieved by introducing an inhibitor into the alfalfa. MsFER It is achieved through the substances that express genes.
4. The method according to claim 3, characterized in that: The suppression of MsFER The gene expression substance is a specific DNA molecule, an expression cassette containing the specific DNA molecule, or a recombinant plasmid containing the specific DNA molecule; The specific DNA molecule includes a sense segment, an antisense segment, and a spacer segment located between them; The positive segment is the DNA molecule shown in SEQ ID No. 4, positions 1-222 from the 5' end; The antisense fragment is the DNA molecule shown in SEQ ID No. 4, positions 423-644 from the 5' end.
5. The method according to claim 4, characterized in that: The spacer fragment is the DNA molecule represented by SEQ ID No. 4, positions 223-422 from the 5' end.
6. The method according to claim 4 or 5, characterized in that: The nucleotide sequence of the specific DNA molecule is shown in SEQ ID No.
4.
7. The suppression of the [subject / containment] as described in any one of claims 4 to 6 MsFER Application of gene-expressing substances in improving the self-pollination seed setting rate and / or self-pollination pod setting rate of alfalfa.
8. The suppression of the as described in any one of claims 4 to 6 MsFER Application of gene-expressing substances in the breeding of transgenic alfalfa with improved self-pollination seed setting rate and / or self-pollination pod setting rate.