Use of lactylation modified parp1-k548 in diagnosis, prognosis analysis and treatment of glioma drug resistance

Abstract

The application belongs to the technical field of biological medicine and molecular biology, and particularly relates to application of lactylation modified PARP1-K548 in glioma drug resistance diagnosis, prognosis analysis and treatment. Specifically, through in-depth research on the GBM TMZ drug resistance formation mechanism, the application finds that the lactylation modified PARP1-K548 signal shaft plays a key role in maintaining the drug resistance phenotype, and further provides related application of the lactylation modified PARP1-K548 in glioma drug resistance diagnosis, prognosis analysis and treatment, and therefore has good practical application value.

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and molecular biology, specifically relating to the application of lactation-modified PARP1-K548 in the diagnosis, prognostic analysis and treatment of glioma drug resistance. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Gliomas are the most common primary malignant intracranial tumors in adults, characterized by high mortality, high recurrence rates, and low cure rates. Glioblastoma (GBM) is the most common and malignant type. Currently, the standard treatment for GBM is surgical resection combined with postoperative chemoradiotherapy (Stupp regimen), but the median survival is still less than 15 months, and the recurrence rate is close to 100%. Temozolomide (TMZ) is currently the only first-line chemotherapy drug that can significantly improve the survival of GBM patients, but its widespread acquired resistance has become a major cause of disease progression and clinical treatment failure. Therefore, in-depth investigation into the specific mechanisms of TMZ resistance formation during GBM progression and the search for novel and effective intervention targets are of great significance for improving the treatment efficacy of GBM.

[0004] Poly(ADP-ribose) polymerase 1 (PARP1) is a core regulator of the intracellular DNA damage repair (DDR) response network. TMZ, as an alkylating agent, primarily kills tumor cells by inducing DNA strand breaks, while PARP1, as a major sensor for DNA breakage, exhibits significantly enhanced adaptive activity in drug-resistant tumors. Therefore, PARP1 inhibitors have entered preclinical trials as an alternative to TMZ resistance. Although the importance of PARP1 in DNA damage repair and tumor drug resistance is widely recognized, questions remain regarding whether PARP1 activity is regulated by lactation modification, the specific modification sites, and the impact of this modification on its biological function. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the inventors, through long-term technical and practical exploration, have developed an application of lactated PARP1-K548 in the diagnosis, prognostic analysis, and treatment of glioma drug resistance. Specifically, this invention, through in-depth research into the GBM TMZ drug resistance formation mechanism, has discovered the crucial role of the lactated PARP1-K548 signaling axis in maintaining the drug resistance phenotype, thereby providing its relevant applications in the diagnosis, prognostic analysis, and treatment of glioma drug resistance.

[0006] To achieve the above technical objectives, the present invention adopts the following technical solution: In a first aspect, the invention provides the use of a detection reagent for lactation-modified PARP1-K548 in the preparation of products for the diagnosis and / or prognostic analysis of glioma drug resistance.

[0007] A second aspect of the present invention provides a system for diagnosing and / or prognostic analysis of glioma drug resistance, the system comprising: i) An analysis module comprising a detection reagent for determining the level of PARP1-K548 lactation modification in a subject's test sample; ii) An assessment module comprising: assessing the subject’s condition based on the lactation modification level of PARP1-K548 determined in i).

[0008] A third aspect of the invention provides the use of lactation-modified PARP1-K548 as a target in the development, screening, and / or preparation of drugs for the treatment or adjuvant treatment of gliomas.

[0009] Specifically, the drug may be a chemotherapy drug sensitizer, and further, the chemotherapy drug may be temozolomide.

[0010] A fourth aspect of the invention provides the use of a substance that inhibits the level of lactation modification of PARP1-K548 in at least one of the following a1)-a3): a1) To prepare products for the treatment or adjuvant treatment of gliomas; a2) To prepare products that promote the treatment of gliomas with chemotherapy drugs; a3) Prepare products that combine chemotherapy drugs for the treatment of glioma.

[0011] Specifically, promoting the treatment of gliomas with chemotherapy drugs manifests as increasing the sensitivity of gliomas to chemotherapy drugs (reducing the resistance of gliomas to chemotherapy drugs).

[0012] The chemotherapy drug may be temozolomide.

[0013] A fifth aspect of the present invention provides a composition in which the active ingredients include a substance that inhibits the level of lactation modification of PARP1-K548 and a chemotherapeutic agent.

[0014] The chemotherapy drug may be temozolomide.

[0015] A sixth aspect of the present invention provides a method for treating glioma, the method comprising administering to a subject a substance or composition that inhibits the lactation modification level of PARP1-K548.

[0016] Compared with existing technical solutions, one or more of the above technical solutions have the following beneficial effects: The aforementioned technical approach is the first to discover and confirm that lactation modification at the PARP1-K548 site is closely related to the maintenance of TMZ resistance phenotype in DTP cells of gliomas, clarifying the key role of this modification in the formation of GBM TMZ resistance. Simultaneously, this technical approach provides lactation-modified PARP1-K548 as a diagnostic biomarker for TMZ-resistant gliomas, which can be used for early TMZ resistance prediction and clinical prognostic analysis, providing a basis for individualized selection of clinical treatment plans and helping to improve patient treatment outcomes. Furthermore, the aforementioned technical approach also provides therapeutic products and methods targeting lactation-modified PARP1-K548. By inhibiting lactation modification at this site or reducing its modification level, TMZ resistance in GBM can be effectively reversed, and chemosensitivity can be enhanced, providing a new intervention strategy for overcoming acquired TMZ resistance and possessing significant clinical application value. Attached Figure Description

[0017] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0018] Figure 1 TMZ-resistant DTP cell culture and characterization A. Schematic diagram of DTP cell culture; B. Light microscopic morphology of GBM parental cells and DTP cells, scale bar: 200μm (left), 100μm (right); C. CCK-8 detection results of DTP cells under TMZ concentration gradient treatment; D. Live-cell imaging analysis results of DTP cells treated with Incucyte S3 under TMZ treatment; E. Fluorescence intensity changes of CFSE staining in DTP cells detected by flow cytometry; F. Flow cytometry detection of DTP cell cycle characteristics; G. Ki-67 immunofluorescence staining of DTP cells (scale bar: 20μm); H. Western blot detection of the expression of stem cell markers, cell cycle markers, and EMT markers in DTP cells. Data are presented as mean ± standard deviation (each experiment was performed in at least 3 biological replicates). One-way ANOVA was used for statistical analysis, followed by Tukey's test. ns = no significance, *p<0.05, **p<0.01, ***p<0.001.

[0019] Figure 2 TMZ-resistant DTP cells exhibit upregulated overall protein lactation modifications driven by glucose metabolism reprogramming. A. Metabolomics revealed differential metabolic pathways between GBM parental cells and DTP cells; B. CCK-8 assay detected DTP cell activity after treatment with the glycolysis inhibitor 2-DG or the oxidative phosphorylation inhibitor rotenone; C. Seahorse energy metabolism assay analyzed the glycolytic activity of DTP cells; D. Results of glucose uptake assay (left) and lactate content assay (right) of DTP cells; E. Western blot detected the overall protein lactation modification level of DTP cells; F. Immunofluorescence staining detected the overall protein lactation modification level of DTP cells, scale bar: 20 μm; G. Western blot detected the overall protein lactation modification level of relapsed GBM tissue; H. Immunofluorescence staining detected the overall protein lactation modification level of relapsed GBM tissue, scale bar: 50 μm. Data are presented as mean ± standard deviation (each experiment was performed in at least 3 biological replicates). One-way ANOVA was used for statistical analysis, followed by Tukey's test. ns = no significance, *p<0.05, **p<0.01, ***p<0.001.

[0020] Figure 3 Overall protein lactation modification promotes TMZ resistance DTP phenotype A. Western blot analysis revealed changes in the overall lactation modification level of LN229 cells after treatment with the NALA or PKM2 inhibitor shikonin; B. Immunofluorescence staining showed similar results to (A), scale bar: 20 μm; C. CCK-8 assay showed changes in LN229 cell viability after treatment with NALA or shikonin; D. Plate colony assay showed the colony-forming ability of LN229 cells after treatment with NALA or shikonin, scale bar: 5 mm; E. Incucyte S3 live-cell imaging analysis showed similar results to (CD); F. Schematic diagram of drug treatment in nude mouse CDX model; G. Live imaging results of small animals in nude mouse CDX model; H. Statistical analysis of the results in (G). Data are presented as mean ± standard deviation (each experiment was performed at least 3 biological replicates, and in vivo experiments were performed at least 5 biological replicates). Statistical analysis was performed using one-way ANOVA, followed by Tukey's test. ns = no significance, *p<0.05, **p<0.01, ***p<0.001.

[0021] Figure 4 PARP1 in TMZ-resistant DTP cells exhibits high levels of lactation modification. A. Differential lactation modification proteomics results between GBM parental cells and DTP cells; B. Functional enrichment analysis results of lactation modification upregulated proteins in DTP cells (Reactome database); C. Bar chart showing differential lactation modification proteins and sites between GBM parental cells and DTP cells; D. Radar chart showing the top 30 differential lactation modification proteins and sites in (C); E. Secondary mass spectrometry of lactation modification proteomics showed lactation modification at the PARP1-K548 site; F. Western blot showing changes in PARP1 lactation modification in GBM cells after NALA (F) or shikonin (G) treatment; H. Western blot results showing high lactation modification of PARP1 in DTP cells; I. Western blot results showing upregulation of PARP1 lactation modification in relapsed GBM tissue; J. Schematic diagram of PARP1 protein molecular domains.

[0022] Figure 5 Lactation modification of PARP1-K548 promotes TMZ resistance activity in DTP cells. A. Lactation modification proteomics revealed potential lactation modification sites for PARP1; B. Immunoprecipitation-Western blot identified the key PARP1 lactation modification site K548 in TMZ-resistant DTP cells; C. The K548 site of PARP1 exhibits high evolutionary conservation; D. CCK-8 assay showed that lactation modification of PARP1-K548 promotes TMZ resistance activity in DTP cells; E. Incucyte S3 live-cell imaging analysis showed results similar to (D); F. Plate colony assay yielded results similar to (D). Scale bar: 5 mm. Data are presented as mean ± standard deviation (each experiment was performed in at least 3 biological replicates). Statistical analysis was performed using one-way ANOVA followed by Tukey's test. ns = no significance, *p<0.05, **p<0.01, ***p<0.001.

[0023] Figure 6 Lactation modification of K548 enhances its DNA damage repair capacity by activating the catalytic activity of PARP1. A. Western blot results showed that lactation modification of PARP1-K548 reduced the expression level of γ-H2AX in DTP cells; B. Immunofluorescence staining yielded results similar to (A), scale bar: 20 μm; C. In vitro catalytic reaction system showed that lactation modification of K548 enhanced the PARylation catalytic activity of PARP1. Data are presented as mean ± standard deviation (each experiment was performed in at least 3 biological replicates). Statistical analysis was performed using one-way ANOVA, followed by Tukey's test. ns = no significance, *p<0.05, **p<0.01, ***p<0.001.

[0024] Figure 7 DLST promotes TMZ resistance phenotype by regulating the lactation modification of PARP1-K548. A. Immunoprecipitation-mass spectrometry showed direct binding of PARP1 to DLST; B. TCGA database GBM transcriptomics results indicated that patients with high DLST expression had a poorer prognosis; C. TCGA database GBM transcriptomics results showed that DLST expression levels were high in relapsed GBM; D. Immunoprecipitation-Western blot results confirmed direct binding of PARP1 to DLST in DTP cells; E. Immunofluorescence co-staining indicated co-localization of PARP1 and DLST in DTP cells, scale bar: 20 μm (left), 10 μm (right); F. Western blot results indicated that DLST positively regulates PARP1 lactation modification; G. CCK8 assay (G), Incucyte S3 live-cell imaging (H), and plate colony assay (I, scale bar: 5 mm) showed that DLST promotes TMZ resistance activity in DTP cells. Data are presented as mean ± standard deviation (each experiment was performed in at least 3 biological replicates). Statistical analysis was performed using one-way ANOVA, followed by Tukey's test. ns = no significance, *p<0.05, **p<0.01, ***p<0.001. Detailed Implementation

[0025] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0026] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0027] In a typical embodiment of the present invention, the detection reagent for lactation-modified PARP1-K548 is used in the preparation of products for the diagnosis and / or prognostic analysis of glioma drug resistance.

[0028] The diagnosis of glioma drug resistance specifically refers to the diagnosis of glioma resistance to the chemotherapy drug temozolomide.

[0029] Specifically, the higher the lactation modification expression level of PARP1-K548, the stronger the resistance of glioma to the chemotherapy drug temozolomide, and the worse the prognosis of glioma.

[0030] In another specific embodiment of the present invention, a system for diagnosing and / or prognostic analyzing drug resistance in gliomas is provided, the system comprising: i) An analysis module comprising a detection reagent for determining the level of PARP1-K548 lactation modification in a subject's test sample; ii) An assessment module comprising: assessing the subject’s condition based on the lactation modification level of PARP1-K548 determined in i).

[0031] The sample to be tested can be a sample of the subject's glioma, such as the subject's glioma cells or glioma tissue.

[0032] The assessment of the subject's condition includes at least an evaluation and analysis of the subject's resistance to the chemotherapy drug temozolomide and its clinical prognosis.

[0033] Specifically, the higher the lactation modification expression level of PARP1-K548, the stronger the resistance of glioma to the chemotherapy drug temozolomide, and the worse the prognosis of glioma.

[0034] In another specific embodiment of the present invention, the use of lactation-modified PARP1-K548 as a target in the development, screening and / or preparation of drugs for the treatment or adjuvant treatment of gliomas is provided.

[0035] Specifically, the drug may be a chemotherapy drug sensitizer, and further, the chemotherapy drug may be temozolomide.

[0036] In another specific embodiment of the present invention, the use of a substance that inhibits the lactation modification level of PARP1-K548 is provided in at least one of the following a1)-a3): a1) To prepare products for the treatment or adjuvant treatment of gliomas; a2) To prepare products that promote the treatment of gliomas with chemotherapy drugs; a3) Prepare products that combine chemotherapy drugs for the treatment of glioma.

[0037] Specifically, promoting the treatment of gliomas with chemotherapy drugs manifests as increasing the sensitivity of gliomas to chemotherapy drugs (reducing the resistance of gliomas to chemotherapy drugs).

[0038] The substance that inhibits the lactation modification level of PARP1-K548 includes substances that inhibit the lactation modification level of PARP1-K548 using targeted drugs or genetic engineering techniques; it further includes DLST inhibitors, including but not limited to siRNA, shRNA (SEQ ID NO.2) and small molecule compound inhibitors targeting DLST, as well as antibodies against DLST, etc., which are not limited here.

[0039] The chemotherapy drug may be temozolomide.

[0040] In another specific embodiment of the present invention, a pharmaceutical composition is provided, wherein the active ingredients of the pharmaceutical composition include a substance that inhibits the lactation modification level of PARP1-K548 and a chemotherapeutic drug.

[0041] The substance that inhibits the lactation modification level of PARP1-K548 includes substances that inhibit the lactation modification level of PARP1-K548 using targeted drugs or genetic engineering technology; it further includes DLST inhibitors, including but not limited to siRNA, shRNA, and small molecule compound inhibitors targeting DLST, as well as antibodies against DLST, etc., which are not limited here.

[0042] The chemotherapy drug may be temozolomide.

[0043] The pharmaceutical composition may also include at least one inactive pharmaceutical ingredient.

[0044] The inactive components of the drug can be pharmaceutically commonly used carriers, excipients, and diluents. Furthermore, according to conventional methods, it can be formulated into oral, topical, suppository, and sterile injectable solutions such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and sprays.

[0045] The non-pharmaceutical active ingredients that may be included, such as carriers, excipients, and diluents, are well known in the art, and those skilled in the art can determine that they meet clinical standards.

[0046] In another specific embodiment of the invention, the drug of the invention can be administered into the body by known means, such as intravenous systemic delivery. Alternatively, it can be administered via intravenous, percutaneous, intranasal, mucosal, or other delivery methods. Such administration can be performed via a single dose or multiple doses. Those skilled in the art will understand that the actual dose to be administered in the invention can vary considerably depending on a variety of factors, such as target cells, biological type or tissue, the general condition of the subject to be treated, route of administration, manner of administration, etc.

[0047] In another specific embodiment of the present invention, the drug can be administered to humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, orangutans, preferably humans.

[0048] In another specific embodiment of the present invention, a method for treating glioma is provided, the method comprising administering to a subject a substance that inhibits the lactation modification level of PARP1-K548 or the above-described pharmaceutical composition.

[0049] In this invention, the glioma includes low-grade gliomas (grades I and II) and high-grade gliomas (grades III and IV); wherein the glioma is glioblastoma.

[0050] The present invention will be further illustrated below with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Experimental conditions not specifically specified in the examples are generally performed under conventional conditions or as recommended by the sales company; unless otherwise specified in the present invention, these conditions are commercially available.

[0051] Example I. Materials and Methods 1.1 Lactic acidification modification proteomics Tumor cells were pretreated with 80 mM NALA for 24 h before collection. Total protein was extracted from cells using a high-intensity sonication processor (Scientz) in cryolysis buffer (8 M urea, 1% protease inhibitor, 3 μM TSA, and 50 mM NAM, 1% phosphatase inhibitor). After centrifugation at 4 °C (12000 g) for 10 min, the supernatant was transferred to a new tube, and protein concentration was determined using a BCA kit. An equal volume of protein solution was collected and mixed with 20% trichloroacetic acid (TCA), and vortexed at 4 °C for 2 h. After centrifugation for 5 min (4500 g), the supernatant was aspirated, mixed with 200 mM triethylammonium bicarbonate buffer (TEAB), and sonicated. Trypsin was added at a trypsin-to-protein ratio of 1:50 and digested overnight. The lysed peptides were then dissolved in NETN buffer (100 mM NaCl, 1 mM EDTA, 50 mM Tris-HCl, 0.5% NP-40, pH 8.0) and incubated overnight at 4°C with pre-washed antibody beads (anti-Pan Kla, Cat: PTM-1401RM). The antibody beads were then washed with NETN buffer and water. The bound peptides were eluted with 0.1% trifluoroacetic acid and desalted by vacuum drying using C18 ZipTips (Millipore). LC-MS / MS analysis was performed on a 4D mass spectrometer platform. The peptides were dissolved and separated in solvent A (0.1% formic acid, 2% acetonitrile / water) and solvent B (0.1% formic acid / acetonitrile) using a nanoelution system (Bruker Daltonics) at a flow rate of 450 nL / min. The peptides were analyzed by mass spectrometry in parallel accumulation sequence fragmentation (PASEF) mode. The collected data was analyzed using MaxQuant (v.1.6.15.0).

[0052] 1.2 Lentiviral transfection and transient transfection Lentiviral backbones, packaging plasmid psPAX2, and envelope plasmid pMD2.G were co-transfected into HEK293T cells using Lipofectamine 3000. Supernatants were collected at 48 h and 72 h post-transfection, filtered through a 0.45 μm low-protein-binding filter, and concentrated using a Lentivix concentrator. Lentiviral transduction was performed at 8 μg / ml polyethylene to improve transfection efficiency. Stably transfected cell lines were selected after two weeks of continuous culture in media containing puromycin or neomycin. Target protein expression levels were determined by Western blotting. shRNAs were cloned into the pLKO.1-puro vector, and complementary DNAs (cDNAs) of specific genes were cloned into the pLVX-neo vector, provided by Keyybio (Shandong, China). shPARP1: GCAGCTTCATAACCGAAGATT (SEQ ID NO.1); shDLST: CGAAAGAATGAACTTGCCATT (SEQ ID NO.2). We used Lipofectamine 3000 for transient transfection of siRNAs according to the manufacturer's protocol.

[0053] 1.3 Immunoprecipitation After cell harvesting, cells were lysed on ice for 0.5 h using IP lysis buffer (0.5% Nonidet P-40; 20 mM Tris-HCl (pH 8.0); 150 mM NaCl; 2 mM EDTA; 1 Mm NaF) with added protease inhibitors. After centrifugation at 12,000 rpm for 10 min at 4 °C, the supernatant containing all cellular proteins was collected and incubated overnight at 4 °C with a specific primary antibody or IgG. The total cell lysis buffer was incubated with protein A / G magnetic beads at room temperature for 2 h. The resulting precipitate was washed three times thoroughly with cold IP lysis buffer, then mixed with 1% (w / v) SDS loading buffer, boiled for 10 min, and then analyzed by Western blotting or mass spectrometry.

[0054] 1.4 Western Blotting Technique Collected cells were lysed in RIPA lysis buffer containing protease and phosphatase inhibitors on ice for 0.5 h, followed by centrifugation at 12,000 rpm for 10 min. The supernatant was collected, and protein concentration was determined using a BCA protein assay kit. The cells were then mixed with SDS loading buffer and boiled for 10 min to denature the proteins. Cell lysates were separated using SDS-PAGE and transferred to a PVDF membrane. After blocking in 5% skim milk diluted with PBS for 1.5 h, the membrane was incubated with the specified primary antibody at 4°C. Incubate overnight at C, then incubate with the corresponding horseradish peroxidase-conjugated secondary antibody at room temperature for 2 h. After washing with Tris buffer containing 0.1% Tween 20, protein bands on the PVDF membrane are detected using an Enhanced Chemiluminescent (ECL) kit on a ChemiDoc MP imaging system.

[0055] 1.5 Cloning Experiment Cells were placed in 12-well plates, and cell populations were examined after 2-3 weeks. Cells were washed with PBS, fixed with formaldehyde, and stained with crystal violet for 12 h.

[0056] 1.6 Real-time quantitative live cell imaging analysis system (Incucyte S3) detection Cells were seeded in 96-well plates at a density of 5000 cells per well, and cell growth status was assessed using Incucyte S3.

[0057] 1.7 Mass Spectrometry Analysis Cell lysates were pre-immunoprecipitated with specific antibodies, followed by electrophoresis and Coomassie brilliant blue staining of the gel strips. The desired bands were then excised for mass spectrometry analysis. In short, gel fragments were cleaned in 50 mM NH4HCO3 and 50% acetonitrile (v / v), then dehydrated sequentially with 100% acetonitrile, 10 mM dithiothreitol, 100% acetonitrile, and 55 mM iodoacetamide. Peptides were then extracted with 50% acetonitrile / 5% formic acid and 100% acetonitrile. The peptides were placed in an NSI source and analyzed by mass spectrometry in QExactive™ Plus (Thermo Fisher Scientific). Data were processed using Proteome Discoverer 1.3. Peptides with ion scores greater than 20 were identified.

[0058] 1.8 Immunofluorescence staining (1) Fixation: Fix glioma cells in 4% paraformaldehyde for 10-30 min.

[0059] (2) Permeability: Permeability for 20 min under 0.5% Triton X-100 (3) Blocking: Wash 3 times with PBS, 3 min each time, then block with 5% BSA / PBS for 30 min. (4) Incubation: Aspirate the blocking solution, incubate the tissue / cells with the specific primary antibody at 4 °C overnight, wash 3 times with PBS for 3 min each time, and then incubate with the corresponding fluorescent secondary antibody at 37 °C for 2 h.

[0060] (5) Staining the nucleus: Wash 3 times with PBS, 3 min each time, and stain the cell nucleus with DAPI staining solution for 5 min in the dark.

[0061] (6) Observation: Remove the staining solution, mount the slide with an anti-fluorescence quencher, and observe the cells with a confocal microscope.

[0062] 1.9 CCK-8 Proliferation Experiment After 24 h of treatment, cells were digested with trypsin and collected. Cells were counted using a cell counter and seeded in 96-well plates at a density of 5000 cells / well. The cells were divided into a control group and an experimental group, with 5 replicates in each group and 4 replicates. At 0 h, 24 h, 48 h and 72 h after cell adhesion, 10 µL of CCK-8 solution was added to each well. The 96-well plates were placed in a dark environment and incubated at 37 °C for 90 min. After incubation, the absorbance of the solution was measured using a microplate reader.

[0063] 1.10 Quantitative and Statistical Analysis Differences between groups were analyzed using either the unpaired Student's test or the one-way ANOVA-Tukey test. All results are expressed as mean ± SD and were analyzed using GraphPad Prism 10.0.2 (GraphPad Software Inc., San Diego, California, USA). p < 0.05 was considered statistically significant; * indicates p < 0.05; ** indicates p < 0.01; *** indicates p < 0.001.

[0064] II. Experimental Results 2.1 Culture and characterization of TMZ-resistant DTP cells DTP cells were obtained from human GBM cell line LN229 and primary GBM cells GBM26 after TMZ treatment and culture. The cells were analyzed using CCK-8 assay, Incucyte S3 real-time quantitative live cell imaging analysis system, flow cytometry, Ki-67 immunofluorescence staining, and Western blot to clarify the phenotypic characteristics of DTP. Figure 1 ).

[0065] 2.2 DTP cells exhibit upregulation of overall protein lactation modification driven by glucose metabolism reprogramming. Through metabolomics and Seahorse energy metabolism analysis of DTP cells, the applicant confirmed that DTP cells undergo metabolic reprogramming, accompanied by enhanced glycolytic activity. Further investigation revealed a significant upregulation of overall protein lactation modification levels in DTP cells, which was validated in clinical GBM samples. Figure 2 ).

[0066] 2.3 Overall protein lactation modification promotes TMZ resistance DTP phenotype The levels of whole-cell protein lactation in GBM cells were upregulated or downregulated using NALA or the glycolysis inhibitor shikonin. CCK-8 assays, real-time quantitative live-cell imaging analysis, and plate colony assays revealed that whole-cell protein lactation enhanced the TMZ resistance phenotype, suggesting a close correlation between the two. An in vivo CDX model in nude mice based on the GBM cell line further confirmed that protein lactation enhances the TMZ resistance DTP phenotype in GBM cells. Figure 3 ).

[0067] 2.4 PARP1 in TMZ-resistant DTP cells exhibits high levels of lactation modification. Differentially expressed lactate-modified proteins and potential sites between GBM parental cells and DTP cells were identified using lactate modification proteomics. Functional enrichment analysis indicated that the upregulated lactate-modified proteins in DTP cells are closely related to DNA double-strand break repair. The applicant identified significantly upregulated lactate-modified PARP1 in DTP cells among the top 30 differentially modified proteins, which was further validated by immunoprecipitation-Western blot. Given the crucial role of PARP1 in DNA damage modification, the applicant intends to conduct in-depth research on it. The applicant also found that compared to GBM parental cells, the expression level of PARP1 protein in DTP cells was not significantly different, but its lactate modification level was significantly increased. Through immunoprecipitation and Western blot, we further confirmed that PARP1 is highly lactated in both DTP cells and relapsed GBM tissues, and that this modification level can be regulated by NALA and shikonin, which strongly links upstream glycolysis metabolism with downstream PARP1 modification. Figure 4 ).

[0068] 2.5 Confirming the key role of lactation-modified PARP1-K548 in maintaining the DTP resistance phenotype. Based on lactation modification proteomics, we used immunoprecipitation-Western blot to verify that K548 is a key lactation modification site of PARP1 in DTP cells, and sequence alignment showed that this site is highly conserved across species. To determine the specific function of lactation modification at the K548 site, we constructed a PARP1 lactation modification site defective mutant (K548R, mimicking the delactated state). Through a series of cell biology experiments (CCK-8, Incucyte S3, plate cloning) for phenotypic complementation experiments, we found that in PARP1 knockdown DTP cells, complementation of wild-type PARP1 (WT) maintained its TMZ resistance phenotype, while complementation of the K548R mutant failed to restore its resistance, and cell proliferation and colony formation were significantly inhibited. These data strongly suggest that lactation modification at the PARP1-K548 site is a key molecular event necessary for DTP cells to maintain the TMZ resistance phenotype. Figure 5 ).

[0069] 2.6 Lactic acidification of K548 enhances its DNA damage repair ability by activating PARP1 catalytic activity. Lactoylation of PARP1-K548 enhances the DNA damage repair capacity of DTP cells. Further in vitro catalytic reactions using purified PARP1 protein confirmed that lactoylation of PARP1-K548 enhances PARP1 enzymatic activity and increases its PARylation modification function on downstream target proteins. Figure 6 ).

[0070] 2.7 DLST promotes TMZ resistance phenotype by regulating the lactation modification of PARP1-K548. Based on immunoprecipitation-mass spectrometry, the applicant used Western blot and immunofluorescence co-staining experiments to confirm the direct binding of DLST (dihydrolipoamide S-succinyltransferase) and PARP1. Building on this, further Western blot and other methods revealed that DLST mediates PARP1-K548 lactation modification. Through cell phenotype experiments, the applicant found that knocking down DLST enhances the TMZ treatment sensitivity of DTP cells, further confirming the crucial role of lactated PARP1-K548 in the phenotype of TMZ-resistant DTP cells. Figure 7 ).

[0071] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Application of the detection reagent for lactation-modified PARP1-K548 in the preparation of products for the diagnosis and / or prognostic analysis of glioma drug resistance.

2. The application as described in claim 1, characterized in that, The diagnosis of glioma drug resistance specifically refers to the diagnosis of glioma resistance to the chemotherapy drug temozolomide.

3. The application as described in claim 1, characterized in that, The higher the lactation modification level of PARP1-K548, the stronger the resistance of glioma to the chemotherapy drug temozolomide, and the worse the prognosis of glioma.

4. A system for diagnosing and / or prognostically analyzing drug resistance in gliomas, characterized in that, The system includes: i) An analysis module comprising a detection reagent for determining the level of PARP1-K548 lactation modification in a subject's test sample; ii) An assessment module comprising: assessing the subject’s condition based on the lactation modification level of PARP1-K548 determined in i).

5. The system as described in claim 4, characterized in that, The sample to be tested was a glioma sample from the subject's brain.

6. The system as described in claim 4, characterized in that, The assessment of the subject's condition includes at least evaluating and analyzing the subject's resistance to the chemotherapy drug temozolomide and its clinical prognosis; Furthermore, the higher the lactation modification expression level of PARP1-K548, the stronger the resistance of glioma to the chemotherapeutic drug temozolomide, and the worse the prognosis of glioma.

7. Application of lactation-modified PARP1-K548 as a target in the development, screening and / or preparation of drugs for the treatment or adjuvant treatment of gliomas.

8. The application as described in claim 7, characterized in that, The drug is a chemotherapy drug sensitizer, and more specifically, the chemotherapy drug is temozolomide.

9. The use of a substance that inhibits the level of PARP1-K548 lactation modification in at least one of the following a1)-a3): a1) To prepare products for the treatment or adjuvant treatment of gliomas; a2) To prepare products that promote the treatment of gliomas with chemotherapy drugs; a3) To prepare products that combine chemotherapy drugs for the treatment of gliomas; in, The specific manifestation of promoting chemotherapy drug treatment for glioma is to increase the sensitivity of glioma to chemotherapy drugs; The substances that inhibit the lactation modification level of PARP1-K548 include DLST inhibitors, which include siRNA, shRNA (SEQ ID NO.2) against DLST, small molecule compound inhibitors, and antibodies against DLST. The chemotherapy drug in question is temozolomide.

10. A pharmaceutical composition, characterized in that, The active ingredients of the pharmaceutical composition include a substance that inhibits the lactation modification level of PARP1-K548 and a chemotherapeutic drug; The substances that inhibit the lactation modification level of PARP1-K548 include DLST inhibitors, which include siRNA, shRNA (SEQ ID NO.2) against DLST, small molecule compound inhibitors, and antibodies against DLST. Furthermore, the chemotherapy drug is temozolomide.

Images