A strain of the genus pleurotus and its use in the degradation of mycotoxins

Abstract

This invention discloses a strain of *Pleurotus ostreatus* and its application in the degradation of mycotoxins. The strain exhibits the ability to degrade various mycotoxins (including OTA, ZEN, AFB1, and DON). The freeze-dried fruiting body powder and mycelium powder extract of this strain show a degradation efficiency of up to 99% for OTA (1 μg / mL), and the mycelium extract achieves near-complete removal of OTA within 6 hours. The fruiting bodies of the *Pleurotus ostreatus* strain 914T1 of this invention are characterized by high water content and tender texture. Their dry matter is rich in total sugar, protein, and cellulose, expanding the scope of edible fungi in the field of mycotoxin degradation and providing new strain resources for the development of related biological agents.

Description

(I) Technical Field

[0002] This invention belongs to the field of mycotoxin biodegradation technology, specifically relating to a strain of Pleurotus ostreatus and its application in mycotoxin degradation. (II) Background Technology

[0004] Mycotoxins are secondary metabolites produced by molds, widely contaminating grains and feed. Common mycotoxins include ochratoxin A (OTA), aflatoxin B1 (AFB1), zearalenone (ZEN), and deoxynivalenol (DON). Mycotoxins are prevalent in grain feed, grain and oil products, and the food chain. Consuming contaminated products can directly lead to acute and chronic poisoning, causing serious health problems such as kidney damage, liver disease, immunosuppression, and even cancer and birth defects, posing a significant threat to public health and safety. Data shows that the proportion of multiple mycotoxins co-existing in major grains is as high as 40%, becoming a major problem threatening my country's food security, food safety, and livestock farming.

[0005] Biological detoxification methods mainly include bioadsorption and biodegradation. Bioadsorption utilizes the unique structure of microorganisms (such as lactobacilli and yeast) to bind with fungal toxins, forming a complex that achieves detoxification. However, this method suffers from poor specificity and unstable effectiveness, limiting its practical application. Biodegradation, on the other hand, utilizes enzymes secreted by microorganisms to specifically degrade fungal toxins, offering stability, high efficiency, and environmental friendliness. Compared to commonly used biodegradable fungi or bacteria, edible fungi are traditional foods with a long and recognized history of safe consumption. Developing green and efficient detoxification materials and methods using these fungi offers greater safety advantages in food and feed applications, better ensuring the quality and safety of food products.

[0006] While existing technologies have reported on the degradation of mycotoxins using edible fungi, limitations remain in their degradation efficiency, spectrum of action, and ease of use. The *Agrocybe aegerita* strain disclosed in patent application CN117603818A showed degradation rates of 95.4% and 90.8% for AFB1 and ZEN, respectively, after 48 hours of fermentation. The degradation rates of intracellular components of mycelium for AFB1 and ZEN were 15.1% and 7.7%, respectively, revealing significant differences in degradation efficiency among different components of the strain. Simultaneously, the degradation rates for 15A-DON and FB3 were greater than 50%, and for FB1, FB2, and OTA were greater than 20%, but it could not degrade DON and 3A-DON. The *Lentinula edodes* or *Lentinula shiitake* strains disclosed in patent application CN104824493A required 6 to 8 days of incubation with aflatoxin B1 in the fermentation broth of the *Lentinula edodes* strain to reach a degradation rate of 87.06%, indicating a long treatment period and insufficient application timeliness. The aforementioned patents indicate that there are two main problems that need to be addressed in current research on existing technologies: the lack of systematic comparison and understanding of the degradation efficiency of different active components of specific strains, which limits the targeted development and application of highly efficient active components; and the fact that existing methods generally have problems such as long degradation cycles or narrow degradation spectra, which fail to fully demonstrate the broad-spectrum and rapid detoxification potential of strains against a variety of common fungal toxins.

[0007] Therefore, further research is needed to screen edible fungi with a broader spectrum of fungal toxin degradation and a high degradation rate. (III) Summary of the Invention

[0009] Therefore, the purpose of this invention is to provide a novel mycotoxin-degrading strain—*Pleurotus ostreatus* strain—and its application in mycotoxin degradation. *Pleurotus ostreatus* strain 914T1 exhibits a broader degradation spectrum and higher degradation efficiency, demonstrating excellent degradation effects on OTA, ZEN, and DON. Furthermore, edible fungi themselves are a highly nutritious food; using them as a mycotoxin detoxifier aligns with the concept of "treating poison with food," and has high application potential. This invention solves the problems of narrow degradation spectrum and low degradation efficiency of existing edible fungi for mycotoxins.

[0010] The technical solution adopted in this invention is:

[0011] In a first aspect, the present invention provides a novel strain - *Pleurotus ostreatus* (… Pleurotus citrinopileatus Strain 914T1 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42455, deposited on January 8, 2026, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0012] After being cultured at 25°C for 15 days in PDA medium, the mycelium of *Pleurotus ostreatus* strain 914T1 expanded radially from the center outwards, spreading evenly on the surface of the medium to form well-developed, regular, white, and uniform colonies. Optical microscopic observation revealed that the spores were regular and smooth in shape, with a highly consistent size; the mycelial structure was dense, interwoven into a network, and exhibited uniform thickness and stable morphology.

[0013] Secondly, the present invention provides an application of the aforementioned *Pleurotus ostreatus* strain 914T1 in the degradation of mycotoxins.

[0014] Furthermore, the fungal toxins include, but are not limited to, ochratoxin A (OTA), aflatoxin B1 (AFB1), zearalenone (ZEN), and deoxynivalenol (DON).

[0015] Furthermore, the application involves using the lyophilized mycelium powder or fruiting body powder of *Pleurotus ostreatus* strain 914T1, extracted with PBS buffer, to form a degradation system with mycotoxins. The system is then co-cultured at 25-55℃ and pH 7-8 for 3-24 hours to achieve the degradation of mycotoxins.

[0016] Furthermore, the mycotoxin is added in the form of a methanol solution, and the concentration of the mycotoxin in the degradation system is 0.5-8 μg / mL; the concentration of the extract is 50-70 g / L (preferably 50-62.5 g / L) based on the mass of the lyophilized powder before extraction, and the volume ratio of the extract to the mycotoxin is 5-10:1 (preferably 9:1).

[0017] Further, the degradation agent is prepared as follows: (1) Inoculate the 914T1 strain of *Pleurotus ostreatus* onto a PDA plate and culture it for 12-15 days at 25-30℃, 90% humidity, and in the dark. Take mycelial blocks and inoculate them into PDB medium. Culture them under shaking conditions at 25-30℃, 90% humidity, and 120-150 rpm in the dark for 10-15 days. Filter the mixture with sterile gauze and collect the filtrate and mycelium. The filtrate is the clarified fermentation broth. (2) Wash the mycelium collected in step (1) three times with sterile PBS. After washing, absorb the water from the mycelium and freeze-dry it at -55℃ in a freeze dryer. (3) After surface disinfection, freshly harvested *Pleurotus ostreatus* strain 914T1 fruiting bodies are placed in a freeze dryer at -55°C and then ground into powder under low-temperature liquid nitrogen to obtain fruiting body freeze-dried powder; (4) Preparation of extract: Take the mycelium freeze-dried powder or fruiting body freeze-dried powder, add sterile PBS buffer to resuspend, and place the resuspended solution in the dark at 25°C and 130 rpm for 3 h to allow the intracellular lysate to be fully released; then, centrifuge at 4°C and 10000 rpm for 20 min, collect the supernatant, and obtain the extract. The volume of the PBS buffer is 20-30 mL / g (preferably 20 mL / g) based on the mass of the mycelium freeze-dried powder, and 20-30 mL / g (preferably 16 mL / g) based on the mass of the fruiting body freeze-dried powder.

[0018] Thirdly, the present invention provides a biological agent for degrading fungal toxins, wherein the biological agent uses *Pleurotus ostreatus* strain 914T1, fermentation broth of *Pleurotus ostreatus* strain 914T1, intracellular components or active bacterial cells as active ingredients.

[0019] Furthermore, the biological agent is selected from one or more of the following: freeze-dried powder extract of fruiting body of Pleurotus ostreatus strain 914T1 and freeze-dried powder extract of mycelium.

[0020] Fourthly, the present invention provides mycelium or spores of a strain of *Pleurotus ostreatus* 914T1.

[0021] Fifthly, the present invention provides a fruiting body of a *Pleurotus ostreatus* strain 914T1.

[0022] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in the following aspects:

[0023] (1) This invention provides a new fungal toxin degrading bacterium isolated and purified from fungal fruiting bodies - the 914T1 strain of Pleurotus ostreatus. This strain has the ability to degrade a variety of fungal toxins (including OTA, ZEN, AFB1 and DON), which expands the scope of edible fungi in the field of fungal toxin degradation and provides new strain resources for the development of related biological agents.

[0024] (2) The *Pleurotus ostreatus* strain 914T1 of this invention exhibited excellent degradation effects on OTA, ZEN, and DON. The freeze-dried fruiting body powder and mycelium powder extract of this strain showed a degradation efficiency of up to 99% for OTA (1 μg / mL), and the mycelium extract achieved near-complete removal of OTA within 6 hours. Furthermore, the mycelium extract showed a degradation efficiency of up to 50% for ZEN (5 μg / mL) and 68% for DON (5 μg / mL). Simultaneously, the freeze-dried fruiting body powder extract, mycelium powder extract, and fermentation broth of this strain showed degradation rates of 21%, 15%, and 13% for AFB1, respectively.

[0025] (3) The *Pleurotus ostreatus* strain 914T1 of this invention exhibits a wide concentration tolerance for OTA degradation. Within an OTA concentration range of 0.5 to 8 μg / mL, its degradation rate remains above 99%, demonstrating good concentration tolerance and degradation stability.

[0026] (4) The *Pleurotus ostreatus* strain 914T1 of this invention exhibits outstanding temperature adaptability. Within the temperature range of 25℃ to 55℃, its degradation rate of OTA remains above 80%. Even at a high temperature of 85℃, it can still retain about 40% of the degradation activity, indicating that it has good thermal stability and is suitable for application in different temperature environments.

[0027] (5) The *Pleurotus ostreatus* strain 914T1 of this invention exhibits higher degradation activity under neutral to weakly alkaline conditions. The degradation rate of OTA by this extract reaches the optimal level in the pH range of 7.0-8.0; when the pH is 6.0, the degradation rate decreases to about 40%, and when the pH is 9.0, the degradation rate is about 50%.

[0028] (6) The fruiting bodies of the 914T1 strain of *Pleurotus ostreatus* of this invention have the characteristics of high water content and tender texture. The dry matter is rich in total sugar, protein and cellulose. On a dry basis, the total sugar content is 9.18±0.72 g / 100g, the protein content is 3.05±0.46 g / 100g and the cellulose content is 31.56%±1.47%, which has high nutritional value. (iv) Description of the attached drawings

[0030] Figure 1 Morphological observation of strain 914T1. A: Fruiting body morphology; B: Mycelial morphology on PDA plate; C: Mycelial morphology in PDB liquid culture.

[0031] Figure 2 1. Microscopic observation of mycelium and spore morphology of strain 914T1. A: Mycelium (400×); B: Spore (400×).

[0032] Figure 3 ITS phylogenetic tree of strain 914T1.

[0033] Figure 4 The degradation rate of OTA by mycelial extract of strain 914T1 after different treatments.

[0034] Figure 5 Degradation rate of OTA by mycelial extract of strain 914T1 under different incubation conditions. (V) Detailed Implementation Methods

[0036] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0037] PDA solid culture medium: 6.0 g potato extract powder, 20.0 g glucose, 20.0 g agar, pH 5.6±0.2, dissolved in 1000 mL distilled water, sterilized at 121℃ for 15 min.

[0038] PDB liquid culture medium: 5 g potato extract powder, 15 g glucose, 10 g peptone, and 5 g sodium chloride are dissolved in 1000 mL distilled water and sterilized at 121℃ for 15 min.

[0039] Unless otherwise specified, the PBS used in the embodiments of this invention is pH 7.4 and 10mM.

[0040] Example 1: Acquisition and identification of strain 914T1

[0041] 1. Obtaining strain 914T1

[0042] This invention collected fruiting bodies of 13 common large edible fungi, including *Pleurotus ostreatus*, *King Oyster Mushroom*, *Pleurotus ostreatus*, *Pleurotus ostreatus*, *Pleurotus ostreatus*, and *Termitomyces albuminosus*, from the Wukang Xiaoyezi Edible Fungus Farm in Deqing County, Zhejiang Province. A freeze-dried powder extract of the fruiting bodies was prepared using the method described in Example 2, and the degradation rate of mycotoxins (including OTA, AFB1, ZEN, and DON) was tested. A new strain with a broad spectrum of mycotoxin degradation and strong degradation ability was screened and designated as strain 914T1. Strain 914T1 was inoculated into PDA slant medium and cultured under low-temperature conditions.

[0043] 2. Morphological observation of strain 914T1

[0044] Morphological identification of strain 914T1 was performed according to the *Handbook of Fungal Identification*. After alcohol disinfection, the surface of the fruiting bodies of strain 914T1 was wiped clean with sterile cotton balls and placed in a laminar flow hood. Internal tissue blocks were dissected using a sterile scalpel and inoculated into PDA medium. After 15 days of static incubation at 26°C, 90% humidity, and in the dark, the colonies had covered a 9 cm diameter petri dish. Mycelial discs approximately 5 mm in diameter were cut from the edge of the colony and transferred to new PDA plates for purification. This purification process was repeated 2 to 3 times to obtain single colonies. The colonies were round, with dense, fluffy hyphae, light grayish-white in color, and loose in texture, expanding radially from the center to the edge, with relatively neat edges. Figure 1 (B). The mycelium of strain 914T1, when cultured in PDB liquid medium at 25°C, 90% humidity, and 130 rpm in the dark for 10-15 days with shaking, exists as numerous dense, pale yellow to golden yellow granular mycelial balls. In the later stages of culture, white aerial mycelium grows on the bottle wall. Figure 1 (C). Hyphae were picked from the surface of the plate and prepared onto a glass slide. Under an optical microscope, the hyphae were observed to be long, thin filaments, interwoven into a network structure. The surface of the hyphae was smooth and of uniform thickness. Figure 2 A).

[0045] Mycelium of strain 914T1 was injected into the substrate bag and cultured at 20℃ for approximately 30-40 days. Fruiting bodies were harvested when they emerged but before the caps opened. The resulting fruiting bodies had smooth, round caps with a yellow to pale yellow surface and no obvious annulus; the flesh was white, and the stipe was slender. Figure 1 A).

[0046] The fruiting body caps, which have been surface-sterilized with alcohol, are covered onto black cardstock and left to stand in the dark to allow the spores to be naturally ejected, forming spore imprints. The ejected spores are collected for microscopic observation; the spores of *Pleurotus eryngii* are observed to be round, smooth, and uniform in size. Figure 2 B).

[0047] 3. Identification of strain 914T1

[0048] Strain 914T1 was inoculated into PDB liquid medium and cultured in the dark at 25°C, 90% humidity, and 130 rpm with shaking for 15 days. The culture medium was filtered, and the filtrate and mycelium were collected. The resulting filtrate was the fermentation broth. The mycelium was thoroughly washed with sterile water, blotted dry with filter paper, freeze-dried at -55°C, and then ground into a fine powder under liquid nitrogen conditions to obtain the mycelium powder sample.

[0049] Total DNA was extracted from mycelial powder samples using the Solarbio fungal genome extraction kit for amplification of the target gene ITS. Universal primers ITS1-F (5'-CTTGGTCATTTAGAGGAAGTAA-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') were used for amplification. 8 μL of PCR product was collected and analyzed by 1% agarose gel electrophoresis to observe band characteristics. The amplified product was sent to Beijing Qingke Biotechnology Co., Ltd. for ITS sequencing. The obtained spliced ​​gene sequence was compared with the NCBI database using BLAST software, and a phylogenetic tree was constructed using MEGA. Figure 3 ).

[0050] The ITS sequencing sequence (SEQ ID NO.1) was imported into NCBI for BLAST homology comparison. The results showed that strain 914T1 is similar to *Pleurotus ostreatus*. Pleurotus citrinopileatus The similarity reached 99.5%. Based on morphological characteristics, strain 914T1 was identified as... Pleurotus citrinopileatus It was named Elm Yellow Mushroom ( Pleurotus citrinopileatus Strain 914T1 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 42455 and deposit date of January 8, 2026.

[0051] ITS sequence of strain 914T1 (SEQ ID NO.1):

[0052] CGGATACACTTCTCTAGATTACAACTCGGATGGCCAGAAGACCACCAGATTTTAAATTTGAGCTTTTCCCGCTTCACTCGCAGTTACTAGGGGAATCCTTGTTAGTTTCTTTTCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAAATGGTCAAAAGCTGTCCGAAGACGATT AGAGAGCTGGACTCCAATAAGTATCATTGCGTACGGTCTGGCGTAGATAATTATCACACCATGTAGCAGAGGCAACAACAAAGTCCCGCTAATGCATTTAAGAGGAGCCGACTCGGTGACAAGCCAGCAACCCCCAACAATCCAAACACTACGATTTACAGCAAAGCAAAAGGTAGGTTTGAGAATTTAATGACACTC AAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTGTATTAGGTTTTTATAGGCAGCATGGCCCATATAAATGACATTCGTAGACA TACGTTTGTGTGTGTAATGGTTATAGACCCACCGGAGTTCAAGTCACCGTGAGGCGACCGTCTTTCCAGCGAATCTATCAAAGGTGCACAGGGGTGTGAAAGGGGACTAATGAAGCGTGCACATGCCCCTAAGGGCCAGCATTCAGCTTCAAAAGCGAATTCATTAATGATCCTTCCGCAGGTTCACCTACGGAAACC TTGTTACG.

[0053] Example 2: Degradation ability of extracts and fermentation broth of Pleurotus ostreatus strain 914T1 on various mycotoxins

[0054] To systematically evaluate and compare the biodegradation capacity of different tissue parts of strain 914T1 for mycotoxins, three components were selected: freeze-dried fruiting body powder extract, freeze-dried mycelium powder extract, and fermentation broth. Under the same conditions, their degradation rates for a variety of common mycotoxins (including OTA, AFB1, ZEN, and DON) were determined.

[0055] 1. The sample preparation method is as follows:

[0056] (1) The fermentation broth preparation process is as follows:

[0057] The *Pleurotus ostreatus* strain 914T1 was inoculated into PDB liquid medium and cultured in the dark at 25°C, 90% humidity, and 130 rpm for 15 days with shaking. The culture medium was filtered, and the filtrate and mycelium were collected. The resulting filtrate was the fermentation broth.

[0058] (2) The preparation process of freeze-dried fruiting body powder is as follows:

[0059] Fresh fruiting bodies of *Pleurotus ostreatus* strain 914T1 were cleaned, surface-sterilized, and then freeze-dried at -55°C. The fruiting bodies were then ground at low temperature in a liquid nitrogen environment to obtain freeze-dried powder. The powder was stored in a sealed container at -80°C for subsequent experimental use.

[0060] (3) The preparation process of mycelial freeze-dried powder is as follows:

[0061] The mycelium collected in step (1) was washed three times with sterile PBS buffer (pH 7.4). The washed mycelium was then freeze-dried at -55°C in a freeze dryer and ground at low temperature in liquid nitrogen to obtain lyophilized mycelium powder. It was then sealed and stored at -80°C for subsequent experiments.

[0062] (4) The preparation process of the extract is as follows:

[0063] Fruiting body extract: Accurately weigh 0.25 g of lyophilized fruiting body powder and resuspend it in 4 mL of sterile PBS buffer (pH 7.4). Incubate the resuspended solution at 25°C and 130 rpm in the dark for 3 h to allow for the full release of intracellular lysates. Then, centrifuge at 4°C and 10,000 rpm for 20 min and collect the supernatant to obtain the fruiting body extract.

[0064] Mycelial extract: Replace the 0.25 g of fruiting body freeze-dried powder with 0.20 g of mycelial freeze-dried powder, and perform the same other operations to obtain mycelial extract.

[0065] 2. The degradation system is constructed as follows:

[0066] 270 μL of the above extract or fermentation broth was used as the reaction matrix, and 30 μL of 10 μg / mL OTA standard methanol solution and AFB1 standard methanol solution were added to a final concentration of 1 μg / mL, respectively. 30 μL of 50 μg / mL DON standard methanol solution and ZEN standard methanol solution were added to a final concentration of 5 μg / mL, respectively. The reaction was carried out at 25℃ in the dark for 24 h. The reaction was terminated by adding an equal volume of methanol. After filtration through a 0.22 μm filter membrane, the toxin concentration was detected by high-performance liquid chromatography (HPLC).

[0067] HPLC detection conditions:

[0068] Aflatoxin AFB1: The chromatographic column was a C18 column (5 μm, 250 mm × 4.6 mm); mobile phase A was methanol, mobile phase B was pure water, and the volume ratio of phase A to phase B was 40:60; the flow rate was 1 mL / min; the injection volume was 20 μL; the column temperature was 40℃; the fluorescence detector was used, the excitation wavelength Ex was 360 nm, the emission wavelength Em was 440 nm, and post-column derivatization was used.

[0069] Ochratoxin (OTA): The chromatographic column was a C18 column (5 μm, 250 mm × 4.6 mm); mobile phase A was acetonitrile, mobile phase B was 1% acetic acid water, and the volume ratio of phase A to phase B was 50:50; the flow rate was 1 mL / min; the injection volume was 20 μL; the column temperature was 30℃; the fluorescence detector was used, the excitation wavelength Ex was 333 nm, the emission wavelength Em was 460 nm, and post-column derivatization was used.

[0070] Zearalenone (ZEN): The chromatographic column was a C18 column (5 μm, 250 mm × 4.6 mm); mobile phase A was acetonitrile, mobile phase B was pure water, and the volume ratio of phase A to phase B was 50:50; the flow rate was 1 mL / min; the injection volume was 20 μL; the column temperature was 40℃; the fluorescence detector was used, with an excitation wavelength Ex of 274 nm and an emission wavelength Em of 440 nm, and post-column derivatization was performed.

[0071] DON (vomiting toxin): The chromatographic column was a C18 column (5 μm, 250 mm × 4.6 mm); mobile phase A was acetonitrile, mobile phase B was water, and the volume ratio of phase A to phase B was 20:80; the flow rate was 0.8 mL / min; the injection volume was 20 μL; the column temperature was 35℃; and the detection was performed using a UV detector at a wavelength of 220 nm.

[0072] Both the experimental and control groups were configured with three replicates. The control group had its reaction substrate changed to PBS solution. The degradation rate was calculated using the following formula:

[0073] Degradation rate = [(A0 - A1) / A0] × 100%

[0074] In the formula, A0 represents the content of mycotoxins in the control group; A1 represents the content of mycotoxins in the experimental group.

[0075] The results are shown in Table 1. Both the lyophilized fruiting body powder extract and the lyophilized mycelium powder extract of strain 914T1 showed high degradation efficiency for OTA, with degradation rates of 96.9% and 99.75%, respectively. For ZEN and DON, both extracts also showed significant degradation effects. For ZEN, the degradation efficiency of the mycelium extract (51.58%) was significantly higher than that of the fruiting body extract (32.13%); for DON, the degradation rate of the mycelium extract (68.01%) was slightly higher than that of the fruiting body extract (56.24%). Furthermore, both extracts showed some degradation ability for AFB1, with similar degradation rates of approximately 20%.

[0076] The fermentation broth of strain 914T1 showed degradation rates of OTA, ZEN, AFB1, and DON of 7.24%, 4.92%, 14.20%, and 4.39%, respectively. These rates were significantly lower than those of the fruiting bodies and mycelial extracts of strain 914T1.

[0077] Table 1. Degradation rates of various mycotoxins by extracts and fermentation broths of *Pleurotus ostreatus* strain 914T1.

[0078]

[0079] Example 3: Effects of heating and proteinase K on the degradation of fungal toxins by mycelium

[0080] The mycelial extract of Pleurotus ostreatus 914T1 was prepared according to the method in Example 2, and the following experimental groups were set up:

[0081] (1) Untreated: Take 2 mL of extract, do not treat it in any way, and refrigerate for later use;

[0082] (2) Heat treatment: Take 2 mL of extract and heat in a 100℃ water bath for 5 min;

[0083] (3) Proteinase K treatment: Take 1.9 mL of extract and add 0.1 mL of 20 mg / mL proteinase K (solvent is water) to make the final concentration 1 mg / mL. Incubate at 45℃ for 3 h.

[0084] Each treatment described above included a control group, which used PBS buffer instead of the extraction solution and underwent the same treatment as the experimental groups. Both the experimental and control groups were performed in triplicate. After treatment, the degradation system from Example 2 was used. 10 μg / mL OTA standard methanol solution was added to both the experimental and control groups to a final concentration of 1 μg / mL. The mixture was incubated at 25°C in the dark for 24 hours. The reaction was terminated by adding an equal volume of methanol. After filtration through a 0.22 μm filter membrane, the degradation rate of OTA was detected and calculated according to the method in Example 2.

[0085] The results are as follows Figure 4 As shown, after 24 hours of reaction, the mycelial extract of *Pleurotus ostreatus* 914T1 exhibited a 99.7% degradation rate of OTA. Heating the extract at 100℃ for 5 minutes significantly reduced its OTA degradation capacity to 1.3%. Further treatment with proteinase K also significantly decreased the degradation activity, with a degradation rate of only 6.4%. These heat treatment and proteinase treatment results collectively indicate that the main active component responsible for degradation in this extract is a protein, and that this protein is sensitive to high temperatures and can be specifically hydrolyzed by proteases, thus confirming the protein-based nature and enzymatic characteristics of its degradation function.

[0086] Example 4: Effect of incubation conditions on OTA degradation by strain 914T1 mycelium

[0087] 1. Effect of incubation time on the OTA degradation activity of strain 914T1

[0088] Mycelial extract of strain 914T1 was prepared according to Example 2. Using the degradation system of Example 2, 10 μg / mL OTA standard methanol solution was added to the extract to a final concentration of 1 μg / mL. After incubation at 25°C in the dark for 0.5, 3, 6, 9, 12, 15, 18, 24, and 48 h, the reaction was terminated by adding the same volume of methanol. The mixture was vortexed and filtered through a 0.22 μm filter membrane. The OTA content was then determined according to the method of Example 2. A control group was set up for each treatment, using PBS buffer instead of the extract and undergoing the same treatment as the experimental group. Both the experimental and control groups were performed in triplicate.

[0089] The results are as follows Figure 5 As shown in Figure A, the mycelial extract of the strain exhibited highly efficient OTA degradation activity. Within 3 hours of the reaction initiation, the OTA degradation rate reached 80%; by 6 hours, the degradation rate reached 100%, and thereafter remained stable without significant fluctuations. Based on this kinetic characteristic, subsequent experiments determined that the incubation time should be set to 6 hours to ensure the degradation reaction was complete and stable.

[0090] 2. Effect of initial toxin concentration on the OTA degradation activity of the strain

[0091] Mycelial extracts of strain 914T1 were prepared according to Example 2. Using the degradation system of Example 2, 10 μg / mL OTA standard methanol solution was added to the extracts to final concentrations of 0.5, 0.8, 1, 2, 5, and 8 μg / mL. After incubation at 25°C in the dark for 6 h, the reaction was terminated by adding the same volume of methanol, followed by vortexing. The mixture was then filtered through a 0.22 μm filter membrane, and the OTA content was determined according to the method of Example 2. A control group was set up for each treatment, with PBS buffer used instead of the extract and treated the same as the experimental groups. Both the experimental and control groups were performed in triplicate.

[0092] The results are as follows Figure 5 As shown in Figure B, the mycelial extract exhibited a broad-spectrum and highly efficient degradation ability for OTA. Within an OTA concentration range of 0.5 μg / mL to 8 μg / mL, the degradation rate remained above 99%, and no significant differences were observed between different concentrations. This indicates that the extract possesses good stability and high efficiency in degradation activity over a wide concentration range, without significant concentration dependence.

[0093] 3. Effect of pH on the OTA degradation activity of the strain

[0094] Mycelial extracts of strain 914T1 were prepared according to Example 2. The pH values ​​of the extracts were adjusted to 3, 4, 5, 6, and 7 using citric acid (0.1M) and sodium citrate (0.1M) buffer solutions, and to 8, 9, 10, and 11 using sodium carbonate (0.1M) and sodium bicarbonate (0.1M) buffer solutions, respectively.

[0095] Using the degradation system of Example 2, 10 μg / mL OTA standard methanol solution was added to the pH-adjusted extract to a final concentration of 1 μg / mL. After incubation at 25°C in the dark for 6 h, the reaction was terminated by adding the same volume of methanol, vortexed, and filtered through a 0.22 μm filter membrane. The OTA content was then determined according to the method of Example 2. A control group was set up for each treatment, with PBS buffer used instead of the extract and treated the same as the experimental group. Both the experimental and control groups were performed in triplicate.

[0096] The results are as follows Figure 5 As shown in Figure C, the degradation effect of the mycelial extract on OTA is significantly affected by the ambient pH, exhibiting higher degradation activity under neutral to weakly alkaline conditions. Experimental data show that the degradation rate of OTA by this extract reaches the optimal level within the pH range of 7.0-8.0; when the pH is 6.0, the degradation rate decreases to about 40%, and when the pH is 9.0, the degradation rate is about 50%; while under strongly acidic (pH ≤ 5.0) or strongly alkaline (pH ≥ 10.0) conditions, the degradation activity is basically lost.

[0097] 4. Effect of temperature on the OTA degradation activity of the strain

[0098] Mycelial extract of strain 914T1 was prepared according to Example 2. Using the degradation system of Example 2, 10 μg / mL OTA standard methanol solution was added to the extract to a final concentration of 1 μg / mL.

[0099] The samples were allowed to stand in the dark for 6 hours at 4℃, 25℃, 37℃, 45℃, 55℃, 65℃, 75℃, and 85℃, respectively. The reaction was terminated by adding the same volume of methanol, followed by vortexing. After filtration through a 0.22μm filter, the OTA content was determined according to the method in Example 2. A control group was set up for each treatment, using PBS buffer and undergoing the same treatment as the experimental groups. Both the experimental and control groups were performed in triplicate.

[0100] The results are as follows Figure 5 As shown in Figure D, ambient temperature significantly affects the OTA degradation activity of the mycelial extract. Within a temperature range of 25℃ to 55℃, the degradation rate of OTA by the extract consistently remained above 80%, demonstrating good temperature adaptability and stability. With further increases in temperature, the degradation efficiency gradually decreased; however, when the temperature reached 85℃, the degradation rate still remained at approximately 40%.

[0101] Example 5: Nutritional quality determination of fruiting bodies of Pleurotus ostreatus strain 914T1

[0102] Fresh fruiting bodies of *Pleurotus ostreatus* strain 914T1 were used to determine nutritional components using the following methods: moisture content was determined using the direct drying method (GB 5009.3-2016); total sugar content was determined using the phenol-sulfuric acid method (GB / T 15672-2009); protein content was determined using the Kjeldahl method (GB5009.5-2016); and cellulose content was determined using the acid detergent method (GB / T 20806-2022 or equivalent standard).

[0103] The results are shown in Table 2. The moisture content of the fresh fruiting bodies of *Pleurotus ostreatus* strain 914T1 was 92.84% ± 0.17%; on a dry basis, the total sugar content was 9.18 ± 0.72 g / 100g, the protein content was 3.05 ± 0.46 g / 100g, and the cellulose content was 31.56% ± 1.47%. The fruiting bodies of this *Pleurotus ostreatus* strain 914T1 have both good edible quality and high health and nutritional value.

[0104] Table 2. Evaluation of Fruiting Body Quality of Pleurotus ostreatus strain 914T1

[0105]

Claims

1. *Pleurotus ostreatus* strain ( Pleurotus citrinopileatus )914T1, deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No.42455, on January 8, 2026.

2. The application of the *Pleurotus ostreatus* strain 914T1 as described in claim 1 in the degradation of mycotoxins.

3. The application as described in claim 2, characterized in that, The fungal toxins include ochratoxin A, aflatoxin B1, zearalenone, and vomitoxin.

4. The application as described in claim 2, characterized in that, The application involves using the lyophilized mycelium powder or fruiting body powder of *Pleurotus ostreatus* strain 914T1, extracted with PBS buffer, to form a degradation system with mycotoxins. The system is then co-cultured at 25-55℃ and pH 7-8 for 3-24 hours to degrade the mycotoxins.

5. The application as described in claim 4, characterized in that, The mycotoxins are added in the form of methanol solution, and the concentration of mycotoxins in the degradation system is 0.5-8 μg / mL; the concentration of the extract is 50-70 g / L based on the mass of the lyophilized powder before extraction.

6. The application as described in claim 4, characterized in that, The extract was prepared as follows: (1) The *Pleurotus ostreatus* strain 914T1 was inoculated onto a PDA plate and cultured for 12-15 days at 25-30℃, 90% humidity, and in the dark. Mycelial blocks were then inoculated into PDB medium and cultured with shaking at 25-30℃, 90% humidity, and 120-150 rpm in the dark for 10-15 days. d. Filter with sterile gauze, collect the filtrate and mycelium, the filtrate is the clarified fermentation liquid; (2) Wash the mycelium collected in step (1) with sterile PBS 3 times, absorb the water from the washed mycelium, put it in a freeze dryer at -55℃ for freeze drying, grind it into powder under low temperature liquid nitrogen environment, and thus obtain mycelium freeze-dried powder; (3) After surface disinfection, freshly picked elm yellow mushroom strain 914T1 fruiting bodies are placed in a freeze dryer at -55℃ for freeze drying, and ground into powder under low temperature liquid nitrogen environment, thus obtain fruiting body freeze-dried powder; (4) Preparation of extract: take mycelium freeze-dried powder or fruiting body freeze-dried powder, add sterile PBS buffer to resuspend, place the resuspended liquid in 25℃, 130 rpm under light-protected shaking incubation for 3 h, so that the intracellular solubles are fully released; then, centrifuge at 4℃, 10000 rpm for 20 min, collect the supernatant, and thus obtain the extract.

7. The application as described in claim 6, characterized in that, The volume of the PBS buffer used is 20-30 mL / g, based on the mass of the mycelial lyophilized powder or fruiting body lyophilized powder.

8. A biological agent for degrading mycotoxins, characterized in that, The biological agent uses *Pleurotus ostreatus* strain 914T1, its fermentation broth, intracellular components, or active bacterial cells as active ingredients.

9. Mycelium or spores of the *Pleurotus ostreatus* strain 914T1 as described in claim 1.

10. A fruiting body of the *Pleurotus ostreatus* strain 914T1 as described in claim 1.

Images