A high-temperature-resistant and high-esterase-yield lodengia longispora and a specific identification method thereof

Abstract

This invention belongs to the field of microbial technology and relates to a thermoresistant, high-esterase-producing *Changfangluode* yeast and its specific identification method. The high-esterase-producing, thermoresistant *Changfangluode* yeast (… Lodderomyces elongisporus FBKL2.9-G53, deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC M 20253046 on December 29, 2025, exhibits excellent thermostability, maintaining good growth activity and enzyme production capacity even at 45℃. Quantitative esterase analysis showed a significant thermo-enhancing effect on enzyme production, with esterase activity of 12.83 U / mL at 28℃, increasing to 14.87 U / mL at 40℃ and 20.56 U / mL at 45℃. Simulated fermentation experiments further confirmed that the strain demonstrated robust metabolic adaptability under 45℃ heat stress, with esterase activity reaching 7.44±0.35 U / mL on day 7 of fermentation, approximately 1.55 times higher than the control group at 28℃.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to a thermoresistant, high-esterase-producing *Lycospora laurentii* yeast and its specific identification method. Background Technology

[0002] In the production of baijiu (Chinese liquor) and other fermented foods, fermentation microorganisms have a significant impact on the conversion efficiency of raw materials and the formation of flavor compounds. For production systems such as sauce-flavored baijiu that employ high-temperature koji-making and high-temperature fermentation processes, microorganisms typically need to grow and metabolize in environments above 40°C during fermentation. Therefore, the heat resistance of microorganisms and their metabolic stability under high-temperature conditions are important factors affecting the smooth progress of the fermentation process.

[0003] Ester compounds are an important component of the aroma system of baijiu (Chinese liquor), and their content and composition directly affect the aroma characteristics of the liquor. Existing studies have shown that esters such as ethyl acetate and isoamyl acetate can impart fruity and sweet aromas to baijiu, and the formation of esters is closely related to the catalytic activity of esterases and other related enzymes during microbial metabolism. Therefore, the esterase-producing ability of yeast during fermentation and its stability under different fermentation conditions are important factors affecting the aroma formation of baijiu.

[0004] Currently, in the production of high-temperature Daqu (a type of starter culture) and Baijiu (Chinese liquor) fermentation, commercial brewing yeast or conventional functional yeast strains are mostly used in production practice, mainly including brewing yeast (…). Saccharomyces cerevisiae Yeasts and their related strains. These yeasts have a relatively mature application base under medium- and low-temperature fermentation conditions, but under high-temperature conditions, their growth status and metabolic activity may be affected to varying degrees. Some strains exhibit decreased enzyme activity or changes in metabolite composition in high-temperature environments, thus affecting the stable formation of aroma substances. How to maintain the functionality of yeast under high-temperature fermentation conditions is a problem that still needs further optimization in current production practices. To address the problem of insufficient ester aroma, some technologies have attempted to improve the production capacity of certain aroma-related metabolites in yeast through breeding or process regulation. For example, by using mutagenesis or metabolic regulation, the production level of specific esters or their precursors can be increased to improve the aroma characteristics of fermented products. However, these technical solutions mostly focus on enhancing single or a few aroma components, with relatively limited attention to the overall metabolic performance of yeast under high-temperature conditions, and their stability and applicability in actual high-temperature fermentation systems still need further verification.

[0005] In recent years, the role of non-traditional yeasts in fermentation systems has gradually attracted attention. Among them, *Lonicera sporogenes* (… Lodderomyces elongisporusAs a non-brewing yeast commonly detected in natural fermentation environments, *C. laurentii* exhibits significant application potential due to its unique stress resistance and metabolic characteristics. For example, CN 118995452 A discloses a strain of *C. laurentii* L253 and its application in producing 2-methyl-1-butanol under high-temperature conditions, preliminarily confirming its survival ability in extreme brewing environments. However, research on the efficient ester-producing enzyme patterns of *C. laurentii* under high-temperature conditions remains scarce, and specific molecular identification tools designed targeting its core heat-resistant genes are lacking. Therefore, screening strains with good high-temperature adaptability and ester-producing activity, and constructing corresponding molecular recognition systems, is of great significance for supplementing the technical solutions for this type of microorganism in high-temperature daqu and baijiu fermentation research. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a thermoresistant, high-esterase-producing *Leptobacillus longifolia* and its specific identification method, as detailed below: A heat-resistant, high-esterase-producing *Lepiota* species ( Lodderomyces elongisporus The strain, FBKL2.9-G53, was deposited at the China Center for Type Culture Collection (CCTCC) on December 29, 2025, with accession number CCTCC M 20253046.

[0007] The PCR amplification product of the 5.8S-ITS region of this strain is approximately 500 bp; using Hae The amplification product was digested with restriction endonuclease III, and the resulting digested band was approximately 500 bp in size.

[0008] This strain was isolated from high-temperature Daqu (a type of starter culture) of sauce aroma type from Renhuai, Guizhou.

[0009] Furthermore, the heat-resistant, high-esterase-producing *Leptobacillus longifolia* colonies are white or milky white, with a smooth or slightly wrinkled surface and neat edges.

[0010] Furthermore, the heat-resistant, high-esterase-producing *Lepiota cephalosporin* cells are oval or oblong.

[0011] Furthermore, the thermoresistant and high-esterase-producing *Leptococcus longicornis* strain exhibits thermoresistance, achieving a cell concentration of 1×10⁻⁶ after 48 hours of culture at 45°C. 6 CFU / ml.

[0012] When the strain was cultured at 28°C, its esterase activity reached 12.83 U / mL; when cultured at 40°C, its esterase activity reached 14.87 U / mL; and when cultured at 45°C, its esterase activity was as high as 20.56 U / mL.

[0013] Furthermore, the strain exhibits excellent metabolic robustness and enhanced enzyme production under heat stress conditions.

[0014] Furthermore, the heat stress environment is 45°C.

[0015] The strain exhibited excellent metabolic robustness and enhanced enzyme production under heat stress at 45℃. On day 7 of simulated fermentation, its esterase activity reached 7.44±0.35 U / mL, approximately 1.55 times higher than the enzyme activity of the 28℃ control group (2.92±0.34 U / mL). Furthermore, throughout the entire fermentation process, the viable cell concentration of the strain remained consistently at 10⁻⁶ cells / mL under the 45℃ high-temperature condition. 6 CFU / ml or higher.

[0016] The application of the heat-resistant, high-esterase-producing *Leptospora longissima* in koji making and brewing.

[0017] Furthermore, the aforementioned koji making and brewing refers to the preparation of high-temperature koji and the fermentation of baijiu.

[0018] The heat-resistant and high-esterase-producing *Leptobacillus longifolia* strain can be used in high-temperature fermentation systems.

[0019] Specifically, this invention studies the metabolic characteristics of *Leptospira longicornis* strain FBKL2.9-G53 under simulated fermentation conditions, confirming its suitability as a high-quality functional microbial resource for high-temperature fermentation processes. This strain exhibits excellent thermo-adaptive enzyme production patterns, specifically manifested in: 1) Temperature-dependent characteristics of enzyme production: By measuring the esterase kinetics of this strain under different temperature gradients, it was found that its enzyme activity showed a significant stepwise increase with increasing temperature. At 28℃, its esterase activity was 12.83 U / mL; at 40℃, it increased to 14.87 U / mL; and at a high temperature of 45℃, its esterase activity reached as high as 20.56 U / mL.

[0020] 2) Functional applications in high-temperature fermentation: The strain FBKL2.9-G53 can maintain a vigorous metabolic level even under simulated high-temperature fermentation conditions of 45℃. It participates in the biosynthesis of esters and flavor regulation in the fermentation system by secreting highly active esterases. This has significant application value in strengthening the functional microbial community structure of the fermentation system and increasing the content of major ester metabolites. A primer set for the specific identification of the above-mentioned thermostable, high-ester-producing *Cymbopogon spp.* contains any one or more of the following four primer pairs: Targeting mitochondrial chaperone protein genes SSC1The primer pair (L.elongisporusSSC1) is used to identify the gene that ensures the correct folding and transport of mitochondrial proteins at high temperatures. The upstream sequence is GAGGCGAACAATACTCACCA, and the downstream sequence is CTCCAAACCATAAGCCAAAG. Targeting heat shock protein gene SSA1 The primer pair (L.elongisporusSSA1) is used to identify the gene responsible for depolymerization proteins to maintain cellular thermal homeostasis. The upstream sequence is TCATCACCAGAGCCAGA, and the downstream sequence is AGCAGCAACCATAAGCAAC. Targeting heat shock protein gene SSA2 The primer pair (L.elongisporusSSA2) is used to identify structural heat shock genes that ensure the continuity of cellular physiological functions under heat stress. The upstream sequence is AACGACTCACAAAGACAAGC, and the downstream sequence is GACAAGAGGGAGACATCAAA. Targeting key genes in carbon metabolism PDA1 The primer pair (L.elongisporusPDA1) is used to identify genes that ensure cellular energy supply and ester precursor synthesis under high-temperature metabolism. The upstream sequence is CGACCCAGGTACTACTTACA, and the downstream sequence is ATACTTTCTTGCGGCTTT.

[0021] The primer set described above can be used for molecular identification of *L. elongisporus*, in vitro amplification and sequence verification of core functional genes, and evaluation of the molecular response mechanism of the strain under high-temperature stress. *L. elongisporus* PDA1, as an internal reference primer, can be used to analyze the three thermotolerant genes based on RT-qPCR technology. SSA1 , SSA1 and SSC1 Expression at different culture stages and during fermentation.

[0022] A specific identification method for the above-mentioned thermostable and high-esterase-producing *Lycium sporodon* is characterized by the use of the above-mentioned primer set for identification.

[0023] The beneficial effects of this invention are: To address the issues of insufficient thermoresistance and limited stability of ester-producing enzymes in yeasts under high-temperature fermentation conditions, this invention aims to provide a *Saccharomyces cerevisiae* strain capable of maintaining growth and metabolic activity at higher temperatures and possessing high ester-producing enzyme capacity. This provides a monitoring technology solution for its application in high-temperature fermentation systems such as high-temperature koji preparation and baijiu fermentation. This has significant practical implications and application value for improving the efficiency of ester flavor compound formation and enhancing the aroma quality of the liquor during high-temperature koji and baijiu fermentation. Specific beneficial effects are as follows: 1. This invention provides a novel strain of *Lymnaezia longispora* (…). Lodderomyces elongisporus FBKL2.9-G53, this strain has a clear origin and identification. Its taxonomic status was confirmed through morphological characteristics and molecular biological sequence analysis, providing a new yeast resource for high-temperature fermentation systems.

[0024] 2. The strain described in this invention has good heat resistance; its cell concentration can reach 1×10⁻⁶ under culture conditions at 45°C. 6 CFU / ml. This robust heat resistance ensures that the strain can adapt to extreme heat stress environments such as high-temperature fermentation of baijiu or pile fermentation.

[0025] 3. The strain described in this invention possesses unique characteristics of high esterase production and heat-enhanced enzyme production. This high-temperature induced enzyme production characteristic gives it excellent biocatalytic efficiency in high-temperature fermentation systems, providing core technical support for improving the main ester flavor of fermentation products.

[0026] 4. This invention provides a precise molecular tool for identifying *Cymbopogon longissima* based on a specific identification primer set designed using the core thermosusceptibility gene. This primer set targets… SSC1 , SSA1 , SSA2 , PDA1 The development of key genes, with extremely high species specificity and amplification stability, enables rapid qualitative identification and dynamic monitoring of target strains in complex fermentation environments where multiple species coexist.

[0027] 5. This invention not only provides excellent strains, but also elucidates their high-temperature enzyme production patterns and provides molecular detection methods. It has good scientific research value and industrial application prospects in the fields of strengthening the functional microbial community structure of high-temperature Daqu, optimizing brewing process and reducing energy consumption. Attached Figure Description

[0028] Figure 1 The single colony morphology characteristics of *Lepiota longissima* FBKL2.9-G53 of this invention; Figure 2 The cell morphology of *Lymnaezia longissima* FBKL2.9-G53 of this invention; Figure 3 The present invention describes the detection of the upper limit of high temperature resistance of *L. longiflora* FBKL2.9-G53. Figure 4 : PCR amplification effect verification diagram of the identification primers of *Lycium sporeans* FBKL2.9-G53 of the present invention. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to specific embodiments. These descriptions are for explanation purposes only and are not intended to limit the scope of the invention.

[0030] Example 1 1. Identification of *Lymnaezia longifolia* strains 1.1 Morphological identification The colony characteristics of the *Leptobacillus longifolia* strain are that it is milky white in color, of moderate size, spherical with a domed shape, moist in texture and smooth without wrinkles; under a microscope, the cells are visible to the naked eye and are uniformly sized round.

[0031] 1.2 Molecular identification 5.8S-ITS-RFLP analysis: PCR amplification was performed targeting the 5.8S-ITS region, and the amplification product size was 500 bp. (Using...) Hae The PCR product was digested with restriction endonuclease III, and the digestion product size was 500 bp.

[0032] 26S rRNA gene D1 / D2 region sequence analysis: Representative strains were selected for 26S rRNA gene D1 / D2 region sequence analysis, and the amplified product size was 503 bp (GenBank database sequence number PX625167). The sequencing results were compared with the sequence of the type strain in the GenBank database. The sequence similarity of strain FBKL2.9-G53 was as high as 100%, further confirming that it is *Leptospora longissima*.

[0033] Example 2 Test of the high temperature resistance of the strain The *Longifroniomycin* strain described in this invention ( Lodderomyces elongisporus FBKL2.9-G53 was inoculated into YPD liquid medium and pre-cultured at 28°C. After culture, the bacterial concentration was adjusted to approximately 1×10⁻⁶ using cell counting. 6 CFU / mL was inoculated into multiple culture systems of the same volume. The inoculated culture systems were then incubated at 28℃, 40℃, 45℃, 47℃, and 50℃ for 48 h. After incubation, the growth and survival of the strain under different temperature conditions were observed and recorded by cell counting and spread culture on YPD solid medium.

[0034] The results showed that ( Figure 3 The FBKL2.9-53 strain can grow normally at 28℃ and 40℃; viable cells can still be detected at 45℃, indicating that the strain has the ability to survive at this temperature. Therefore, the highest temperature that the strain can tolerate under the test conditions is 45℃, which shows certain high temperature resistance characteristics and is suitable for high temperature fermentation environment.

[0035] Example 3 Design and Amplification Validation of Primers for Specific Identification of *Lepiota laurentii* 3.1 Primer design process based on comparative genomics strategy Long-spore Lordosac ( Lodderomyces elongisporus This cell exhibits good adaptability to high-temperature environments, and its heat resistance mechanism is closely related to highly conserved molecular chaperones such as heat shock proteins (HSPs). These proteins ensure cell survival under stress conditions such as heat, ethanol, and osmotic pressure by assisting protein folding and maintaining homeostasis. This invention employs a comparative genomics strategy, utilizing conserved sequences from closely related species to develop specific identification primers, as follows: 1) Reference gene screening: Retrieve and screen for brewer's yeast from the NCBI database ( Saccharomyces cerevisiae ) and Longspore yeast ( Lodderomyces elongisporus The highly conserved functional gene sequences of the heat shock family and core metabolic pathways were determined. SSA1 , SSC1 , HSP82 and PDA1 This is a target reference template.

[0036] 2) Homology search and localization: The above reference sequence was compared with the raw data of whole genome sequencing (WGS) of *Cymbidium goeringii* using the BLAST algorithm to accurately locate candidate contig fragments.

[0037] 3) Open reading frame prediction: Open reading frames (ORFs) are predicted for the located fragments, and candidate functional regions with the highest homology are identified by comparison of conserved structural domains, providing core targets for primer design.

[0038] 4) Development of specific primers: Based on the identified sequence characteristics, four pairs of specific identification primers targeting the core functional genes of *Saccharomyces cerevisiae* strain were designed and synthesized. The primer sequences are shown in Table 1.

[0039] Table 1. Specific primer information for thermosusceptibility-related genes in *Changluoduo* yeast.

[0040] 3.2 Primer-specific amplification verification 1) PCR reaction system and procedure: Using the genomic DNA of *Lycium sporogenes* FBKL2.9-G53A as a template, PCR amplification was performed using the primer set in Table 1.

[0041] The PCR reaction system consisted of 25 μL of the following components: 10× buffer (2.5 μL), 25 mmol / L MgCl2 (3 μL), 5 U / μL Taq DNA polymerase (0.2 μL), 2.5 mmol / L dNTPs (2 μL), 0.5 μL each of forward and reverse primers (10 μmol / L), 1 μL DNA template, and ddH2O to make up the difference. The reaction conditions were: 94℃ pre-denaturation (5 min); 94℃ denaturation (30 s), 55℃ annealing (30 s), 72℃ extension (30 s), for 35 cycles; 72℃ extension (7 min). 2) Amplification Results and Sequencing Verification: 5 mL of PCR amplification product was subjected to 1.5% agarose gel electrophoresis. Electrophoresis Results: All five primer pairs stably amplified clear and single target fragments (see instruction manual appendix). Figure 4 .

[0042] The primer set designed in this invention can specifically and accurately amplify the core functional genes from *Changsporum lodo*, and can serve as an effective means for the precise identification of this strain in complex fermentation environments and the study of its heat resistance mechanism.

[0043] Example 4 Quantitative determination of esterase activity in *Saccharomyces cerevisiae* strain The quantitative method for esterase activity uses the p-nitrophenol detection method, which utilizes esterase to catalyze the hydrolysis of p-nitrophenylacetic acid ester to produce p-nitrophenol (PNP) which is yellow under alkaline conditions. The enzyme activity is reflected by measuring its absorbance value at a wavelength of 400 nm.

[0044] 4.1 Reagent preparation and crude enzyme solution preparation 1) Preparation of substrate solution: Accurately weigh 905.75 mg of p-nitrophenylacetic acid ester, dissolve it in a small amount of acetonitrile, and make up to 100 mL to prepare a 50 mM p-nitrophenylacetic acid ester-acetonitrile solution. Store in the dark.

[0045] 2) Buffer preparation: Prepare 10 mM potassium phosphate buffer (pH=6.5) as the buffer environment for the reaction system.

[0046] 3) Preparation of crude enzyme solution: The fermentation broth of *Leptobacillus longiflorus* FBKL2.9-G53 was centrifuged at 4℃ and 12,000 rpm for 10 minutes, and the supernatant was collected as the crude enzyme solution. The supernatant was used directly without dilution for the assay.

[0047] 4.2 Establishment of the standard curve 1) Preparation of standard gradient: Dilute PNP standards with 10 mM potassium phosphate buffer to a concentration gradient of 0.02, 0.04, 0.06, 0.08, 0.10, 0.12, 0.14, 0.16, 0.18, and 0.20 μmol / mL.

[0048] 2) Absorbance measurement: Add each gradient solution to the microplate (200 μL / well) and read the absorbance A400 at a wavelength of 400 nm.

[0049] 3) Equation Fitting: A standard curve was plotted with PNP concentration on the x-axis and A400 on the y-axis, yielding the linear regression equation Y = 1.188X + 0.0426, R0. 2 =0.9973.

[0050] 4.3 Enzyme activity initiation and detection process 1) Pre-equilibration: Place the potassium phosphate buffer and crude enzyme solution at the target temperatures (28℃, 40℃, 45℃) for pre-equilibration.

[0051] 2) Reaction system: Add 900 μL of potassium phosphate buffer (pH=6.5) and 50 μL of crude enzyme solution to a 1.5 mL centrifuge tube or microplate well, mix well and pre-incubate at the target temperature for 2 minutes.

[0052] 3) Start the reaction: Add 50 μL of substrate solution to start the reaction, so that the final substrate concentration is 2.5 mM.

[0053] 4) Termination and detection: Immediately after 1 minute of precise reaction, read the absorbance value at 400 nm (A400). The blank control group is replaced with an equal volume of distilled water instead of crude enzyme solution, and the remaining steps are the same.

[0054] 4.4 Enzyme Activity Calculation and Result Definition The PNP content generated in the sample was calculated based on the standard curve, and the enzyme activity was calculated using the following formula: Enzyme activity (U / mL) = One unit of esterase activity is defined as the amount of enzyme that catalyzes the production of 1 μmol of p-nitrophenol per minute under the stated assay conditions. The esterase activity of the crude enzyme solution is calculated based on the reaction time, reaction volume, and amount of crude enzyme solution used, and expressed as U / mL.

[0055] Following the above method, the esterase activity of the *Leptobacillus longiflora* strain FBKL2.9-G53 was determined under different culture temperature conditions. The results (Table 2) show that the strain could still produce catalytically active esterases at 45℃, indicating that its esterase-producing ability can be maintained at higher temperatures, and that the enzyme-producing ability increases with increasing temperature.

[0056] Table 2. Esterase activity of *Saccharomyces cerevisiae* strain FBKL2.9-G53 under different temperature conditions.

[0057] Example 5 Enzyme production application of *Lactobacillus longifolia* FBKL2.9-G53 in a simulated fermentation system 5.1 Design of Simulated Fermentation Experiment Scheme To evaluate the application potential of *Lycium sporeans* FBKL2.9-G53 in actual fermentation environments, this invention established a simulated fermentation experimental system, focusing on investigating the dynamic evolution of its esterase activity under suitable temperature (28℃) and high temperature stress (45℃) conditions.

[0058] 1) Fermentation medium: Prepare to a final volume of 1.5 L by weighing 300 g of glucose, 15 g of yeast extract, 1.5 g of (NH4)2SO4, 1.5 g of KH2PO4, and 1.5 g of MgSO4·7H2O, adding distilled water to bring the volume to 1.5 L, with a natural pH of approximately 5. Dispense 200 mL of the medium into 250 mL Erlenmeyer flasks and autoclave at 121℃ for 15 min.

[0059] 2) Strain activation and inoculation: The preserved FBKL2.9-G53 strain was cultured on YPD medium at 28℃ for 48 h. The biomass of the seed culture was determined using a cell counter, and the inoculation was performed at a ratio of 10⁻⁶ cells / mL. 6 An inoculum of cells / mL was inoculated into an Erlenmeyer flask containing 200 mL of simulated fermentation medium.

[0060] 3) Fermentation conditions control: Set 28℃ as the control temperature, and select 45℃ as the high temperature treatment condition according to the upper limit of the strain's heat tolerance.

[0061] 4) Sampling and esterase detection: Aseptic sampling was performed on days 2, 4, and 7 of fermentation. The fermentation supernatant was collected by centrifugation as crude enzyme solution. Esterase activity was determined using the p-nitrophenylacetic acid method, and enzyme activity units (U / mL) were calculated using the p-NP standard curve.

[0062] 5.2 Results of dynamic changes in esterase activity during high-temperature fermentation Experimental results showed that *Leptospermum jasminoides* FBKL2.9-G53 exhibited extremely significant heat-induced enzyme production characteristics during simulated fermentation, with its esterase activity showing a stepwise increase with increasing temperature and fermentation time. Specific data are shown in Table 3.

[0063] Table 3. Changes in esterase activity of FBKL2.9-G53 at different fermentation stages and temperatures.

[0064] Analysis of simulated fermentation experimental data revealed significant differences in esterase metabolism of *Lycium sporogenes* FBKL2.9-G53 at different temperatures: at 28℃, its esterase activity was at a low level (2.92–3.25 U / mL) and fluctuated slightly downward in the later stages of fermentation; however, under high temperature stress of 45℃, the strain exhibited excellent heat-induced enzyme production characteristics, with enzyme activity increasing stepwise with fermentation time, reaching 7.44 U / mL on the 7th day of fermentation, which was about 1.55 times higher than the control group at room temperature during the same period.

[0065] This result demonstrates that the FBKL2.9-G53 strain not only tolerates extreme heat stress, but its esterase secretion system also exhibits significant high-temperature adaptability and robustness. This further confirms the application value of this strain as a core ester-producing microorganism in enhancing the quality of high-temperature Daqu (a type of starter culture) and during the high-temperature fermentation stage of Baijiu (Chinese liquor). It provides a highly valuable microbial resource for the biofortification of high-temperature Daqu and the improvement of ester production efficiency in Baijiu, offering significant industrial application potential.

[0066] Finally, it should be noted that the above embodiments are merely representative examples of the present invention. Obviously, the technical solution of the present invention is not limited to the above embodiments, and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the content disclosed in this invention should be considered within the scope of protection of this invention.

Claims

1. A thermoresistant, high-esterase-producing *Lymnaeidae* species (… Lodderomyces elongisporus ), characterized in that, The strain, designated FBKL2.9-G53, was deposited at the China Center for Type Culture Collection (CCTCC) on December 29, 2025, with accession number CCTCC M 20253046.

2. The thermoresistant, high-esterase-producing *Lycospora* yeast according to claim 1, characterized in that, The heat-resistant, high-esterase-producing *Lepiota cephalosporin* has white or milky-white colonies with a smooth or slightly wrinkled surface and neat edges.

3. The thermoresistant, high-esterase-producing *Lycospora* yeast according to claim 1, characterized in that, The heat-resistant, high-esterase-producing *Lepiota cerevisiae* cells are oval or oblong.

4. The thermoresistant, high-esterase-producing *Lycospora* yeast according to claim 1, characterized in that, The heat-resistant, high-esterase-producing *Lymphaerocephalosporium* strain exhibits heat resistance.

5. The thermoresistant, high-esterase-producing *Lycospora* yeast according to claim 1, characterized in that, The strain exhibited excellent metabolic robustness and enhanced enzyme production under heat stress.

6. The thermoresistant, high-esterase-producing *Lycospora longissimum* yeast according to claim 5, characterized in that, The heat stress environment is 45°C.

7. The application of the heat-resistant, high-esterase-producing *Leptospora longifolia* as described in claim 1 in koji making and brewing.

8. The application according to claim 7, characterized in that, The aforementioned koji making and brewing process involves the preparation of high-temperature koji and the fermentation of baijiu (Chinese liquor).

9. A primer set for the specific identification of the thermostable, high-esterase-producing *Leptococcus longicornis* of claim 1, characterized in that, It contains any one or more of the following four primer pairs: Targeting mitochondrial chaperone protein genes SSC1 The primer pair (L.elongisporusSSC1) is used to identify the gene that ensures the correct folding and transport of mitochondrial proteins at high temperatures. The upstream sequence is GAGGCGAACAATACTCACCA, and the downstream sequence is CTCCAAACCATAAGCCAAAG. Targeting heat shock protein gene SSA1 The primer pair (L.elongisporusSSA1) is used to identify the gene responsible for depolymerization proteins to maintain cellular thermal homeostasis. The upstream sequence is TCATCACCAGAGCCAGA, and the downstream sequence is AGCAGCAACCATAAGCAAC. Targeting heat shock protein gene SSA2 The primer pair (L.elongisporusSSA2) is used to identify structural heat shock genes that ensure the continuity of cellular physiological functions under heat stress. The upstream sequence is AACGACTCACAAAGACAAGC, and the downstream sequence is GACAAGAGGGAGACATCAAA. Targeting key genes in carbon metabolism PDA1 The primer pair (L.elongisporusPDA1) is used to identify genes that ensure cellular energy supply and ester precursor synthesis under high-temperature metabolism. The upstream sequence is CGACCCAGGTACTACTTACA, and the downstream sequence is ATACTTTCTTGCGGCTTT.

10. A specific identification method for the thermostable, high-esterase-producing *Leptobacillus longifolia* as described in claim 1, characterized in that, Identification was performed using the primer set described in claim 9.

Images