A strain of *Pseudomonas aeruginosa* JHMC Fb2317 and its application in the control of anthracnose in cowpeas.

By using Pseudomonas aeruginosa JHMC Fb2317 as a biocontrol agent, the problems of environmental pollution and drug resistance in the control of anthracnose in cowpeas by chemical pesticides have been solved, achieving efficient control and yield increase, while reducing the use of chemical fertilizers and pesticides.

CN122278699APending Publication Date: 2026-06-26JIANGHAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610413898.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-31
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Current technologies for controlling cowpea anthracnose mainly rely on chemical pesticides, leading to environmental pollution and increased drug resistance in pathogens, and lacking effective microbial control methods.

Method used

Pseudomonas aeruginosa JHMC Fb2317 was used as a biological control agent. By spraying the live bacterial solution on cowpea leaves, the infection of Pseudomonas beanus was inhibited. This can be prepared as a biocontrol agent or agricultural agent to replace chemical agents.

Benefits of technology

It significantly reduces the incidence of anthracnose in cowpeas, increases yield, reduces the use of chemical fertilizers and pesticides, alleviates agricultural pollution, and exhibits broad-spectrum antifungal effects against a variety of plant pathogenic fungi.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122278699A_ABST
    Figure CN122278699A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of microbial control technology and provides a *Pseudomonas aeruginosa* strain JHMC Fb2317 and its application in controlling cowpea anthracnose (CCTCC NO: M 20251695). This invention involves targeted screening of functional bacteria from cowpea rhizosphere soil. Using the plate confrontation method, the most effective antagonistic bacterium against cowpea anthracnose, JHMC Fb2317, was ultimately selected, exhibiting an inhibition rate of 90.0%. Its broad-spectrum antibacterial activity indicates that this strain has varying degrees of inhibitory effects against 10 fungal pathogens, including *F. anthracnose*, *F. wilt*, *F. sclerotinia*, and *F. wilt*. Field trial results show that, compared to the control group, application of JHMC Fb2317 significantly reduced the cowpea disease index and increased cowpea yield, providing technical support for green control of legume diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial control technology, and more specifically to a Pseudomonas aeruginosa JHMC Fb2317 and its application in the control of anthracnose in cowpeas. Background Technology

[0002] Cowpea anthracnose, also known as cowpea leaf mold or cowpea leaf spot, is caused by *Pseudocercospora cruenta*. This disease is widespread and commonly occurs in summer and autumn. Severe infestations result in withered and fallen leaves, stunted plant growth, premature aging, shortened harvest time, and reduced fresh pod yield, making it a significant obstacle to cowpea production in the Yangtze River basin. Besides cowpea, *Pseudocercospora cruenta* also infects various other legumes, including common bean, soybean, broad bean, lentil, mung bean, red bean, pea, and sword bean. The pathogen is highly infectious under high temperature and humidity conditions, and repeated infections gradually worsen the leaf disease. The pathogen typically overwinters as mycelium or conidia in the soil surface. When environmental conditions are suitable, it produces a large number of conidia, which are spread by wind and rain to infect cowpea plants.

[0003] Currently, the control of cowpea anthracnose relies mainly on traditional measures, including improving field ventilation, maintaining a clean planting environment, reducing field humidity, and applying fertilizer appropriately to reduce the risk of disease. In terms of agricultural control, selecting disease-resistant varieties and rotating with non-leguminous crops can effectively reduce the accumulation of inoculum in the field; simultaneously, increasing the application of organic fertilizer and applying phosphorus and potassium fertilizers appropriately helps enhance the plant's disease resistance. For physical control, optimizing cowpea cultivation patterns and adjusting row and plant spacing can improve field light and ventilation, thereby reducing the risk of disease occurrence. Chemical control is mainly used in the early stages of disease, through foliar spraying with 70% thiophanate-methyl wettable powder at a dilution of 600 times, 55% carbendazim wettable powder at a dilution of 600 times, or 80% zinc thiophanate wettable powder at a dilution of 700 times, to inhibit the spread of lesions.

[0004] Long-term use of chemical pesticides harms the ecological environment, destroys beneficial plant microbial communities, and leads to increased pathogen resistance, exacerbating continuous cropping obstacles. Microbial control of plant diseases offers advantages such as high efficiency, low cost, and environmental compatibility. However, research on the biological control of cowpea anthracnose lags far behind that of other legume diseases, urgently requiring the screening and systematic evaluation of suitable endophytic or antagonistic microbial resources for control, providing technical support for the development of microbial pesticides. Summary of the Invention

[0005] The purpose of this invention is to provide a *Pseudomonas aeruginosa* strain JHMC Fb2317 and its application in the control of anthracnose in cowpeas, specifically targeting anthracnose caused by *Pseudocercospora cruenta*. By using an agent of the above-mentioned strain as an environmentally friendly alternative to chemical agents, the incidence of anthracnose in cowpeas can be reduced without causing any damage to the environment or the host.

[0006] The technical objective of this invention is achieved through the following technical solution: Firstly, this invention provides a *Pseudomonas aeruginosa* strain, JHMC Fb2317, which, according to microbial classification and identification, belongs to *Pseudomonas aeruginosa*. This strain, *Pseudomonas aeruginosa* JHMC Fb2317, is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China; the deposit date is July 28, 2025, and the accession number is CCTCC NO: M 20251695. It possesses the following biological characteristics: on culture media, single colonies of this strain are yellow and opaque, with regular edges, a smooth surface structure, and accompanied by the secretion of green soluble pigment. Gram staining and microscopic morphological observation show that the cells of Fb2317 are rod-shaped and turn red after staining, thus classifying this strain as a Gram-negative bacterium.

[0007] Secondly, the present invention provides an application of Pseudomonas aeruginosa JHMC Fb2317 in the prevention and control of anthracnose in cowpeas, comprising the following steps: (1) The selected JHMC Fb2317 strain colonies in the vigorous growth period were inoculated into nutrient broth liquid medium (NB liquid medium) and cultured in a shaker at 37℃ and 180r / min for 48h to prepare live bacterial solution.

[0008] (2) Using the live bacterial solution prepared in step (1), adjust the bacterial density to 10. 7 CFU / mL, spray on both sides of the leaves, once every 7-10 days, for a total of 2-3 applications.

[0009] The method for preparing the nutrient broth liquid culture medium is as follows: 10g peptone, 5g NaCl, 5g yeast extract, 1000mL distilled water, pH 7.0-7.5, sterilized at 121℃ for 15-20min.

[0010] This invention also provides the application of Pseudomonas aeruginosa JHMC Fb2317 in the preparation of biocontrol agents or agricultural agents for the prevention and control of anthracnose in cowpeas; the agent is prepared according to existing standards or methods for agricultural agents, and the preparation method will not be described in detail, but may include the addition of agricultural excipients, flavoring agents or preservatives, etc.

[0011] Compared with the prior art, the advantages and beneficial effects of the present invention are: This invention provides a strain of *Pseudomonas aeruginosa* JHMC Fb2317 that exhibits significant antifungal effects against dozens of plant pathogenic fungi, with mycelial growth inhibition rates ranging from 50% to 80%. *Pseudomonas aeruginosa* JHMC Fb2317 possesses broad-spectrum antifungal capabilities and shows promising potential for biocontrol applications in the production of cowpeas, peas, watermelons, tomatoes, peppers, and rapeseed. After treatment with *Pseudomonas aeruginosa* JHMCFb2317 bacterial solution, the disease index of cowpeas was 28.2, and the average yield per mu (approximately 0.067 hectares) was 1220.67 kg. Compared with the control group treated with water, the disease index was significantly reduced, and the yield increased by 13.7%. There was no significant difference in disease index and cowpea yield between the live bacterial solution treatment group and the chemical pesticide treatment with carbendazim. This indicates that the live bacterial solution of this strain, as an alternative to chemical pesticides, can effectively control cowpea anthracnose, playing an important role in reducing the use of chemical fertilizers and pesticides and mitigating agricultural pollution. Attached Figure Description

[0012] Figure 1 The image shows the screening of antagonistic strains against cowpea anthracnose (Pseudocercospora cruenta); where A represents the growth of Pseudocercospora cruenta in the absence of antagonistic bacteria; and B represents the growth of Pseudocercospora cruenta after the addition of the antagonistic strain of this invention. Figure 2 Morphological identification of strain JHMC Fb2317; where A is a colony morphology of antagonistic bacterium JHMC Fb2317 on NA solid medium, and B is a Gram staining image; Figure 3 Phylogenetic tree for molecular biological identification of antagonistic strains JHMC Fb2317, JHMC Fb2333, and JHMC Fb2345; Figure 4 The study investigated the antifungal effects of strains JHMC Fb2317, JHMC Fb2333, and JHMC Fb2345 against 10 fungal diseases. The pathogens, from left to right, were: a) *Sclerotinia sclerotiorum*, b) *Fusarium oxysporum*, c) *Fungiella vesicae*, d) *Fusarium oxysporum*, e) *Gray leaf spot*, f) *Root rot*, g) *Black stem rot*, h) *Stem base canker*, i) *Fusarium oxysporum*, and j) *Rhizoctonia solani*. Detailed Implementation

[0013] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0014] 1. Materials and Methods Soil samples for the isolation of antagonistic bacteria were collected from the rhizosphere soil of cowpea in Huangzhou, Hubei Province. 300g of soil samples were collected from a depth of 5-10cm, placed in sterile sampling bags, labeled, and transferred to the laboratory for storage at 4℃.

[0015] 2. Information on the tested strains, culture media, and pathogens is shown in Table 1. Table 1 Basic information of the tested pathogens

[0016] Beef extract peptone medium (NA medium): 5g peptone, 1g beef extract, 5g NaCl, 18g agar powder, pH 7.0, bring to a final volume of 1000mL, and incubate at 30℃.

[0017] Potato glucose liquid medium (PDA liquid medium): 200g potato, 15g glucose, 1L distilled water, pH 7.0, sterilized at 121℃ for 20min. Potato glucose medium (PDA solid medium) is the aforementioned potato glucose liquid medium (PDA liquid medium) with 20g agar added.

[0018] Nutrient broth liquid culture medium (NB liquid medium): 10g peptone, 15g NaCl, 5g yeast extract, 1000mL distilled water, pH 7.0-7.5, sterilized at 121℃ for 20min.

[0019] Example 1: Isolation and purification of the antagonistic bacteria to be tested 1.1 Isolation of the antagonistic bacteria to be tested Take the soil sample prepared above and isolate the antagonistic bacteria using a serial dilution method. Weigh 5g of soil sample and add it to an Erlenmeyer flask containing 50mL of sterile water. Incubate at 28℃ and 180r·min. -1 Shake on a constant-temperature shaker for 30 minutes to fully disperse the soil sample. Mix 1 mL of the mixture with 9 mL of sterile water to obtain 10 mL of the solution. -1 Take another 1 mL of the diluted solution. -1 The diluted solution was mixed with 9 mL of sterile water to obtain 10. -2 Diluent, and so on, to prepare 10 -3 10 -4 10 -5 10-6 10 -7 Prepare a series of dilutions with varying concentrations. Spread 100 μL of each dilution onto NA medium plates and incubate at 30°C for 2 days.

[0020] 1.2 Purification of the antagonistic bacteria to be tested Select NA medium plates with appropriate gradients, pick single colonies with distinct morphological differences, streak them onto NA medium plates for purification, and store them at 4°C, numbered and stored for later use. Simultaneously, use 20% (v / v) glycerol as a protectant for long-term preservation at -80°C. A total of 10 bacterial strains were isolated and purified, numbered JHMCFb2308, JHMCFb2309, JHMCFb2311, JHMCFb2314, JHMCFb2316, JHMCFb2317, JHMCFb2324, JHMCFb2333, JHMCFb2336, and JHMCFb2345. Molecular identification of these strains was performed; the identification methods and conclusions are described in Example 3.

[0021] Example 2. Screening of antagonistic bacteria against anthracnose pathogens in cowpea A cross-shaped culture method was used to prepare PDA (Potato Dextrose Agar) plates. Using an inoculation needle, a 20 mm diameter mycelial cake was taken from the edge of *Pseudocercospora cruenta* and transplanted into the center of the plate. Four symmetrical cross-shaped inoculations were selected 15 mm from the center of each plate, and the same purified strain was inoculated at these locations using an inoculation loop. A control group inoculated only with *Pseudocercospora cruenta* was used. The plates were cultured at 28℃ for 21 days, and growth was observed. The mycelial diameter of the selected antagonistic strain was measured to calculate the inhibitory effect. Mycelial growth inhibition rate = (control group colony diameter - treatment group colony diameter) / control group colony diameter × 100%. A strain that effectively inhibited *Pseudocercospora cruenta* was screened and named *Pseudocercospora cruenta* antagonistic bacterium JHMC Fb2317, with a mycelial growth inhibition rate of 90% (Table 2).

[0022] Table 2. Screening results of antagonistic bacteria against cowpea anthracnose.

[0023] Note: Data in the table is "mean ± standard deviation".

[0024] The following methods were used to molecularly identify the 10 strains in Example 2, among which JHMC Fb2333, JHMC Fb2345, and JHMC Fb2317 were all Pseudomonas aeruginosa. JHMC Fb2317 is described as an example: 3.1. Morphological identification It can be observed that when strain JHMC Fb2317 is cultured on NA medium at 30°C, the colony morphology of strain JHMCFb2317 is round. The colonies formed on the medium plate are yellow, opaque, with regular edges, smooth surface structure, and accompanied by the secretion of green soluble pigment (e.g., ...). Figure 1 As shown in the image). Gram staining and microscopic morphological observation revealed that JHMC Fb2317 cells were rod-shaped and turned red after staining, indicating that this strain belongs to Gram-negative bacteria (e.g., ...). Figure 2 (As shown).

[0025] 3.2. Molecular identification In this embodiment, strain JHMC Fb2317 was used as a template. Genomic DNA was extracted using the Bacterial Genomic DNA Extraction Kit (DP302-02 DNA Extraction Kit) from Tiangen Biotech Co., Ltd. 16S rRNA molecular identification of the strain: Total DNA of the strain was extracted using the Bacterial Genomic DNA Extraction Kit (DP302-02 DNA Extraction Kit) from Tiangen Biotech Co., Ltd. Using the total DNA as a template, PCR amplification was performed using universal bacterial primers 27F (SEQ ID NO.2): AGAGTTTGATCCTGGCTCAG and 1492R (SEQ ID NO.3): TACCTTGTTACGACTT. A 50 μL reaction system was used: 25 μL 2×mix (2×Taq PCRMix (KT201) from Tiangen Biotech Co., Ltd.), 2 μL DNA template, 2 μL primer 27F, 2 μL 1492R, and 19 μL dd H2O.

[0026] The PCR amplification program was as follows: 95℃ pre-denaturation for 2.5 min, 95℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 60 s, for 35 cycles; final extension at 72℃ for 10 min. The purity and concentration of the PCR amplification were determined by 1% agarose gel electrophoresis.

[0027] Sequencing: The PCR amplification products were sent to Tianyi Huayu Genome Research Center for sequencing, and the 16S rDNA gene sequence (SEQ ID NO.1) of the cowpea anthracnose antagonistic bacterium JHMC Fb2317 was obtained as follows: The obtained 16S rRNA sequence was submitted to the NCBI nucleic acid database for online BLAST analysis, and the bacterial species were determined based on sequence similarity. A phylogenetic tree was constructed using MEGA 11.0 based on the sequencing results (see attached). Figure 3 Phylogenetic analysis showed that the 16S rDNA gene sequence of strain JHMC Fb2317 had the highest homology (98.3%) with the sequence of Pseudomonas aeruginosa, and strain JHMC Fb2317 was identified as Pseudomonas aeruginosa.

[0028] Example 4: Determination of the broad-spectrum antibacterial activity of Pseudomonas aeruginosa strain JHMC Fb2317 The sources of the pathogenic strains used are detailed in Table 1. Ten pathogenic fungal strains, excluding *Pseudocercosporacruenta* (the cowpea anthracnose pathogen shown in Example 3), and stored at 4℃, were transferred to PDA solid medium plates and activated for 7 days. Using an inoculation needle, 20 mm diameter mycelial cakes were collected from the edge and transplanted to the center of the plate. Four positions 15 mm from the center were symmetrically selected in a cross pattern on each plate. The isolated and purified strains JHMC Fb2317, JHMC Fb2333, and JHMC Fb2345 were inoculated at these positions using an inoculation loop. A control group inoculated only with pathogenic strains served as the inoculation point. The plates were incubated at 28℃ for 21 days, and growth was observed. Colony diameter was measured using the cross-cross method. Mycelial growth inhibition rate = (control group colony diameter - treatment group colony diameter) / control group colony diameter × 100%. Figure 4 As shown in the figure, the experiment showed that the screened strain JHMC Fb2317 exhibited significant antibacterial effects against all 10 tested plant pathogenic fungi, with mycelial growth inhibition rates ranging from 50% to 80%. The results of the confrontation culture are shown in Table 3. This indicates that the Pseudomonas aeruginosa strain JHMCFb2317 possesses broad-spectrum antibacterial ability and has good potential for biocontrol applications in the production of cowpea, pea, watermelon, tomato, pepper, and rapeseed.

[0029] Table 3. Antagonistic effects of three *Pseudomonas aeruginosa* strains against different pathogens.

[0030] Note: Data in the table is "mean ± standard deviation"; " / " indicates no antibacterial effect.

[0031] The experimental materials were grown in the Wuhan Douboshi Agricultural Science and Technology Ecological Park, located in Xiangkou Town, Hannan District, Wuhan City, Hubei Province (113°25'E, 30°11'N). This area is characterized by long-term continuous cropping of cowpeas and severe occurrence of cowpea anthracnose (caused by the same pathogen, Pseudocercospora cruenta). The field trial was conducted from August to October 2025 in a steel-framed greenhouse using a deep furrow and high-ridge cultivation model. The ridges were 1.3 meters wide, with two rows planted per ridge and a spacing of 20 centimeters between plants. Two seedlings were planted per plant, and bamboo frames were used for cultivation. The cowpea variety used was "Ejiangdou No. 6".

[0032] Treatment methods for Pseudomonas aeruginosa JHMC Fb2317, JHMC Fb2333, and JHMC Fb2345: (1) When the cowpeas grow to a height of 40-60cm, spray them with microbial agent. Selected Pseudomonas aeruginosa colonies JHMC Fb2317, JHMC Fb2333 and JHMC Fb2345 that are in the vigorous growth period are inoculated into nutrient broth liquid medium (NB liquid medium) and cultured on a shaker at 37℃ and 180r / min for 48h to prepare live bacterial solution.

[0033] (2) Using the live bacterial solution prepared in step (1), adjust the bacterial density to 10. 7 Spray the solution at CFU / mL onto both sides of the cowpea leaves, once every 7-10 days, for a total of 2-3 applications.

[0034] Disease index survey method: Disease survey was conducted in the field when the disease was stable and no new diseased plants were added. The standardized disease index calculation method was used to assess the resistance level of each variety. Three replicates (plots) were taken for each treatment. Ten plants were taken for each replicate. The number of plants at each disease level was recorded according to the cowpea anthracnose disease grading standard (Table 4), and the disease index was calculated.

[0035] Yield calculation method: During the cowpea harvest period, the cumulative fresh weight of pods that met the commercial standard under different treatments was counted. Each treatment was replicated three times (plots), and the yield per acre (kg / acre) was calculated based on the plot area and plant spacing.

[0036] The grading criteria for anthracnose in cowpeas are shown in Table 4. Table 4 Grading Criteria for Cowpea Anthracnose

[0037] The formula for calculating the disease index is as follows:

[0038] Table 5. Disease index and yield of cowpea in different treatment groups.

[0039] Note: Data in the table are "mean ± standard deviation". Different lowercase letters (a, b) indicate significance at the 5% level. Table 5 shows that after treatment with Pseudomonas aeruginosa JHMCFb2317 bacterial solution, the disease index of cowpea was 28.2, and the average yield per mu was 1220.67 kg. Compared with the control treatment sprayed with water, the disease index was significantly reduced, and the yield increased by 13.7%. At the same time, Pseudomonas aeruginosa JHMC Fb2333 and JHMC Fb2345 did not show significant antibacterial and yield-increasing effects.

[0040] Compared with the treatment with the chemical pesticide "carbendazim", the *Pseudomonas aeruginosa* JHMCFb2317 bacterial suspension treatment group showed no significant difference in disease index and cowpea yield. This indicates that the live bacterial suspension of this strain, as an alternative to chemical pesticides, can effectively control cowpea anthracnose and plays an important role in reducing the use of chemical fertilizers and pesticides and mitigating agricultural pollution.

[0041] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. A type of Pseudomonas aeruginosa JHMC Fb2317, characterized in that, The *Pseudomonas aeruginosa* JHMC Fb2317 is deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China. The deposit date is July 28, 2025, and the accession number is CCTCC NO: M 20251695. Its classification name is *Pseudomonas aeruginosa*.

2. The application of Pseudomonas aeruginosa JHMC Fb2317 according to claim 1 in antagonizing Pseudocercospora cruenta.

3. The application of Pseudomonas aeruginosa JHMC Fb2317 according to claim 1 in the prevention and control of anthracnose in cowpeas.

4. The application as described in claim 3, characterized in that, The pathogen causing anthracnose in cowpeas is *Pseudocercospora cruenta*.

5. The application of Pseudomonas aeruginosa JHMC Fb2317 according to claim 1 in the preparation of biocontrol agents or agricultural pesticides.

6. The application of Pseudomonas aeruginosa JHMC Fb2317 according to claim 1 in the preparation of biocontrol agents or agricultural agents for the prevention and control of anthracnose in cowpeas.

7. A biocontrol agent or agricultural agent obtained based on the application described in claim 5 or 6.

8. The application of the biocontrol agent or agricultural agent as described in claim 7 in the control of anthracnose in cowpeas.