Application of transcription factor BnC05.PLATZ04 gene in regulating resistance to sclerotinia stem rot in rapeseed
By cloning and validating the rapeseed transcription factor BnC05.PLATZ04 gene, and constructing overexpression and gene knockout vectors, we achieved genetic engineering improvement of rapeseed against sclerotinia stem rot, enhanced the disease resistance of rapeseed, and provided new breeding resources.
Patent Information
- Application Number
- CN202610396857.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-30
- Publication Date
- 2026-06-26
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering, specifically involving the transcription factor BnC05.PLATZ04 gene that regulates rapeseed resistance to sclerotinia stem rot and its application. Background Technology
[0002] Rapeseed (Brassica napus L.) is an important oilseed crop in my country. Sclerotinia stem rot, caused by Sclerotinia sclerotiorum, is the most significant disease in my country's major rapeseed-producing areas. Currently, breeding resistant varieties is the fundamental control method, but existing rapeseed germplasm lacks highly resistant or immune materials, making it difficult to significantly improve resistance using traditional breeding methods. Genetic engineering can utilize gene resources across species and precisely improve traits; therefore, using gene editing and other technologies to discover and verify functional genes related to Sclerotinia sclerotiorum resistance has significant theoretical and applied value for creating new resistant germplasm, advancing rapeseed disease-resistant breeding, and ensuring safe production.
[0003] PLATZ (Plant AT-rich sequence and zinc-binding protein) is a novel zinc finger transcription factor unique to plants. It can specifically bind to A / T-rich sequences and inhibit the transcription of downstream genes. The PLATZ family contains a highly conserved PLATZ domain of approximately 82 amino acids. It is a zinc-dependent DNA-binding protein and is widely involved in plant growth and development, starch synthesis, endosperm development, and responses to abiotic stresses. Whether BnC05.PLATZ04 is involved in the regulation of sclerotinia stem rot resistance remains unclear. Identifying key genes in the rapeseed PLATZ family that respond to stress, clarifying their biological functions and molecular mechanisms of disease resistance, can provide important gene resources and theoretical basis for the genetic improvement of rapeseed resistance, and has significant application value in ensuring stable and high yields of rapeseed. Summary of the Invention
[0004] This invention aims to overcome the shortcomings of existing technologies by isolating and obtaining a transcription factor gene, BnC05.PLATZ04, that regulates resistance to Sclerotinia stem rot in rapeseed, and clarifying its application in rapeseed resistance to Sclerotinia stem rot. Simultaneously, it verifies the function of this gene and performs preliminary genetic transformation applications. This invention clones the BnC05.PLATZ04 gene, constructs its overexpression vector and gene knockout vector, and achieves overexpression and knockout expression of the gene in Brassica napus Westar using Agrobacterium-mediated genetic transformation. After identification by Sclerotinia stem rot inoculation, the disease resistance of transgenic plants, the inhibitory effect of leaf extracts on Sclerotinia stem rot growth, and the accumulation characteristics of endogenous reactive oxygen species in leaves are systematically analyzed. This rapidly clarifies the function of this gene in regulating rapeseed resistance to Sclerotinia stem rot, providing new genetic resources for breeding rapeseed with resistance to Sclerotinia stem rot.
[0005] The technical solution of the present invention is as follows:
[0006] The applicant cloned a transcription factor BnC05.PLATZ04 gene that regulates resistance to sclerotinia stem rot in rapeseed, the nucleotide sequence of which is shown in SEQ ID NO:1.
[0007] The protein sequence encoded by the above-mentioned rapeseed transcription factor BnC05.PLATZ04 gene, which regulates resistance to sclerotinia stem rot in rapeseed, is shown in SEQ ID NO:2.
[0008] The present invention relates to the application of the BnC05.PLATZ04 gene in regulating the resistance of Brassica napus to Sclerotinia stem rot.
[0009] The more detailed technical solution is as follows:
[0010] The expression pattern of the PLATZs gene family in rapeseed induced by Sclerotinia sclerotiorum was analyzed by RT-qPCR. Based on the gene expression, the target gene BnC05.PLATZ04 was finally identified.
[0011] RNA was extracted from the leaves of *Brassica napus* Westar and reverse transcribed into cDNA using Superscript III. Amplification primers were synthesized using the *Brassica napus* genome information: forward primer BnC05.PLATZ04-full-F and reverse primer BnC05.PLATZ04-full-R, to amplify the cDNA of the BnC05.PLATZ04 gene. PCR reaction conditions: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 2 min 50 sec, 28 cycles; extension at 72℃ for 7 min. The amplified PCR product was ligated into the pGEM-T vector, positive clones were screened and sequenced to obtain the desired gene CDS. Its sequence is the nucleotide sequence shown in SEQ ID NO:1, encoding a 219 amino acid sequence, the amino acid sequence of which is shown in SEQ ID NO:2.
[0012] This invention uses pGWB418 (vector resistance to kanamycin and spectinomycin) as the overexpression vector, pCBC-DT1DT2 (vector resistance to chloramphenicol) as the intermediate gene editing vector, and pKSE401 (vector resistance to kanamycin) as the final gene editing vector to construct the overexpression vectors pGWB418-BnC05.PLATZ04 and CRISPR / Cas9-BnC05.PLATZ04 gene knockout vectors for this gene. The applicant transformed these two vectors into Brassica napus Westar using Agrobacterium-mediated hypocotyl infection until regenerated differentiated seedlings were obtained. Genomic DNA was extracted from leaves of wild-type Brassica napus as a control and from transgenic rapeseed lines using the CTAB method. The gene-edited line was named U626-IDF (5'TGTCCCAGGATTAGAATGATTAGGC). Using primers (5'AGCCCTCTTCTTTCGATCCATCAAC3') and U626-IDR (5'AGCCCTCTTCTTTCGATCCATCAAC3'), and Kan-F (5'ACTGGGCACAACAGACAATCG 3') and Kan-R (5'GCATCAGCCATGGATACTTT3') as primers for overexpression lines, PCR amplification was performed. Positive lines overexpressing this gene and CRISPR / Cas9 positive lines were screened. The expression levels of positive materials were then detected by RT-qPCR and sequenced. Among them, the transcriptional level of BnC05.PLATZ04 in materials BnC05.PLATZ04-2, BnC05.PLATZ04-3, BnC05.PLATZ04-5, BnC05.PLATZ04-10, BnC05.PLATZ04-11, and BnC05.PLATZ04-13 was significantly upregulated compared to the wild type. The gene-edited materials platz04-3 and platz04-4 were modified with multi-base mutations and single-base insertions. These transgenic materials were self-pollinated to obtain higher generations for subsequent experiments.
[0013] This invention conducted in vitro leaf inoculation experiments and leaf extract culture experiments on the BnC05.PLATZ04 transgenic material using *Sclerotinia sclerotiorum*. The results showed that, compared with the control material, the BnC05.PLATZ04 knockout lines exhibited significantly enhanced resistance to *Sclerotinia sclerotiorum*. Forty-eight hours after inoculation with *Sclerotinia sclerotiorum*, H2O2 accumulation at the inoculation sites of wild-type and various transgenic lines was observed using diaminobenzidine (DAB) staining. The results showed that knocking out BnC05.PLATZ04 enhanced the H2O2 accumulation level in rapeseed leaves infected with *Sclerotinia sclerotiorum*, while overexpression of this gene decreased H2O2 accumulation. In conclusion, BnC05.PLATZ04 negatively regulates rapeseed resistance to *Sclerotinia sclerotiorum*.
[0014] Advantages of this invention:
[0015] This invention analyzes the expression pattern of the PLATZs transcription factor gene induced by Sclerotinia stem rot in rapeseed, screens and identifies the BnC05.PLATZ04 gene, and discovers that BnC05.PLATZ04 is a negative regulator of Sclerotinia stem rot resistance in rapeseed. Knocking out BnC05.PLATZ04 can improve the disease resistance of rapeseed. Through genetic transformation, a new rapeseed line resistant to Sclerotinia stem rot was obtained by deficient expression of this gene. BnC05.PLATZ04 can serve as a potential marker gene for rapeseed resistance materials. Attached Figure Description
[0016] Figure 1 Analysis of the expression patterns of BnPLATZ family genes in wild-type Brassica napus after inoculation with Westar. Figure 1 The expression patterns of some members of the BnPLATZ gene family were analyzed at 0 h, 6 h, 12 h, 24 h, 36 h, 48 h, and 72 h after inoculation of sclerotiorum sclerotiorum on detached leaves of wild-type rapeseed Westar.
[0017] Figure 2 : Vector map used to construct the BnC05.PLATZ04 overexpression vector and the CRISPR / Cas9 gene knockout vector. Figure 2 A is the pCBC-DT1DT2 vector map. Figure 2 B is the pKSE401 vector map. Figure 2 C is the pGWB418 vector map.
[0018] Figure 3: Expression levels and sequencing analysis results of transgenic materials. Figure 3A shows the expression level detection results of T0 generation BnC05.PLATZ04 overexpression materials. Figure 3B shows the sequencing alignment analysis of T0 generation BnC05.PLATZ04 gene-edited materials.
[0019] Figure 4 Statistics on lesions in T1 generation BnC05.PLATZ04 overexpressing transgenic rapeseed 48 h after inoculation. Figure 4 Figure A shows the phenotypic observation of the control material and the transgenic material 48 h after inoculation with Sclerotinia sclerotiorum. Figure 4 B represents the statistical results of plaque area.
[0020] Figure 5 : Figure 5 A shows the bacterial plaque formation after culturing Sclerotinia sclerotiorum in rapeseed leaf extract for 48 hours. Figure 5 B represents the statistical results of plaque area. Figure 5 C shows the local plaque growth of *Sclerotinia sclerotiorum* after culturing rapeseed leaf extract for 48 hours under a stereomicroscope.
[0021] Figure 6: DAB staining and hydrogen peroxide content determination of T1 generation BnC05.PLATZ04 transgenic rapeseed after inoculation with Sclerotinia sclerotiorum. Figure 6A shows DAB staining of seedlings of WT wild-type and BnC05.PLATZ04 overexpressing plants 48 h after inoculation with Sclerotinia sclerotiorum. Figure 6B shows the hydrogen peroxide content determination in leaves 0 h and 48 h after inoculation with Sclerotinia sclerotiorum. Detailed Implementation
[0022] Description of the sequences in the sequence list:
[0023] SEQ ID NO: 1 is the nucleotide sequence of the rapeseed BnC05.PLATZ04 gene isolated and cloned in this invention.
[0024] SEQ ID NO: 2 is the protein sequence encoded by the BnC05.PLATZ04 gene.
[0025] The following embodiments define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the BnC05.PLATZ04 gene, and for verifying the function of the BnC05.PLATZ04 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from the spirit and scope thereof.
[0026] Example 1: Isolation and Cloning of the BnC05.PLATZ04 Gene
[0027] 1. Rapeseed RNA extraction and reverse transcription
[0028] Westar, a type of rapeseed, was used as the experimental material, and total RNA was extracted using a plant RNA extraction kit. Check that all reagents in the kit are pre-prepared; adjust the water bath to 50°C; prepare an enzyme-free mortar, grinding rod, and small spatula (wrap them in aluminum foil, treat them in a 180°C oven for 4 hours, and then store them in a -20°C freezer for later use); place fresh samples or samples stored in a -80°C freezer in liquid nitrogen; add 400 μL of lysis buffer to a 2 mL enzyme-free EP tube and place it on ice; place the mortar on an ice pack, place the grinding rod in the mortar, and add liquid nitrogen for pre-cooling; before the liquid nitrogen evaporates completely, remove the sample and place it in the mortar, and grind carefully; replenish the liquid nitrogen each time before it evaporates completely to prevent tissue melting, and grind repeatedly until the tissue is completely powdered; use the enzyme-free spatula to scrape the sample from the mortar and grinding rod and transfer it to an enzyme-free EP tube containing lysis buffer, and pipette or shake until there are no obvious lumps of tissue in the lysate; place it in a water bath at 50°C for 3 to 5 minutes; add 400 mL of liquid nitrogen. Invert the EP tube 3-4 times to mix the RNA dilution buffer and incubate at room temperature for 3-5 minutes. Centrifuge at 12000 rpm for 5 minutes, carefully aspirate the supernatant (approximately 800 μL) and transfer it to a new enzyme-free EP tube. Add 0.5 times the volume of anhydrous ethanol and pipette to mix 3-4 times. Remove the centrifuge column and collection tube, load the mixture onto the column (if the entire volume cannot be loaded at once, load in stages), centrifuge at 12000 rpm for 1 minute, and discard the filtrate. Add 600 μL of RNA wash buffer to the column, centrifuge at 12000 rpm for 1 minute, and discard the filtrate. Add 50 μL of incubation buffer to the column and incubate at room temperature for 15 minutes. Add 600 μL of RNA wash buffer to the column, centrifuge at 12000 rpm for 1 minute, and discard the filtrate. Add another 600 μL of RNA wash buffer to the column, centrifuge at 12000 rpm for 1 minute, and discard the filtrate. Centrifuge at 12000 rpm for 2 minutes to remove all liquid. RNA lysis and elution: Transfer the column to the elution tube (provided in the kit), add 50 to 200 μL of nuclease-free water to the column membrane, incubate at room temperature for 2 minutes, and centrifuge at 12,000 rpm for 1 minute; add the elution buffer back onto the column and centrifuge at 12,000 rpm for 1 minute to improve RNA yield.
[0029] cDNA synthesis was performed using the Hiscript® II QRT SuperMix for qRNA (+gDNA wiper) kit. Using 2 μg total RNA as a template, it was mixed with 8 μL of 4×gDNA wiper Mix and DEPC-water to a total volume of 32 μL. The mixture was then incubated at 42 °C for 2 min and quenched on ice for 2–3 min. Next, 4 μL of 5×Hiscript II qRT SuperMix II was added and mixed to a total volume of 36 μL. The mixture was then incubated at 50 °C for 15 min and 85 °C for 5 sec. Each cDNA sample was diluted to 200 μL and stored at -20 °C for later use.
[0030] 2. Analysis of the expression pattern of the BnC05.PLATZ04 gene induced by Sclerotinia sclerotiorum.
[0031] To investigate whether the BnC05.PLATZ04 gene is involved in the disease resistance process of rapeseed, this invention used RT-qPCR to detect the relative expression level of the BnC05.PLATZ04 gene transcription at 0, 6, 12, 24, 36, 48, and 72 hours after inoculation with *Sclerotinia sclerotiorum* in wild-type rapeseed and rapeseed inoculated with *Sclerotinia sclerotiorum*. Wild-type *Brassica napus* was inoculated onto detached leaves. *Sclerotinia sclerotiorum* mycelia were activated in PDA plates. When the mycelia were about to spread to the edge of the plate, 6 mm mycelial blocks were punched again and placed in new PDA plates for further activation. The plates were incubated at 22 °C for approximately 40 hours. One day before inoculation, sterilized containers were cleaned and disinfected for leaf culture, with absorbent paper placed at the bottom. An equal amount of sterile water was added to each container, and the containers were sealed. Uniformly sized defatted cotton balls were also prepared and soaked in water. Take the second-to-last unfolded leaf of the same size, at the 4-8 leaf stage. Place the leaf in a sealed container with absorbent cotton to retain moisture at the petiole. Use a punch to extract a 6 mm mycelial block, place it upside down on the same location on the leaf, avoiding the main vein, and spray evenly with water to maintain humidity. Incubate in the dark at 22 ℃. After inoculation, collect samples from the inoculated leaves at different time points to extract total RNA, which is then reverse transcribed into cDNA to serve as a template. The real-time quantitative RT-qPCR analysis kit was used on a BIO-Rad CFX Connect real-time PCR instrument. The primers required for the reaction were as follows: Q-BnActin7F (5'TCTTCCTCACGCTATCCTCCG3'), internal control primers Q-BnActin7R (5'AGCCGTCTCCAGCTCTTGC3'), Q-BnC05.PLATZ04-F (5'GCAAAAGAAATGATCATGGGAGC3'), and Q-BnC05.PLATZ04-R (5'CTCTTGTGTGAATCTGCGTGT3'). The results showed that BnC05.PLATZ04 was significantly upregulated by Sclerotinia sclerotiorum, suggesting that BnC05.PLATZ04 may be involved in the resistance response of rapeseed to Sclerotinia sclerotiorum.
[0032] 3. Obtaining the BnC05.PLATZ04 gene sequence
[0033] Using the above cDNA as a template, the target gene was amplified using the forward primer BnC05.PLATZ04-full-F and the reverse primer BnC05.PLATZ04-full-R. PCR reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 56-60℃ annealing for 30 s, 72℃ extension for x min (60 sec / 1kb), 30 cycles; 72℃ extension for 10 min, and storage at 4℃. The amplified PCR product was ligated into the pGEM-T vector, positive clones were screened and sequenced, and positive strains were stored at -80℃. The open reading frame (ORF) of the desired OsELP3 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The protein sequence encoded by the BnC05.PLATZ04 gene is shown in the sequence listing SEQ ID NO: 2.
[0034] Example 2: Overexpression of BnC05.PLATZ04 and construction of CRISPR / Cas9 gene knockout vector
[0035] 1. Construction of overexpression vectors
[0036] To verify the gene function of BnC05.PLATZ04, the applicant constructed an overexpression vector to transform the hypocotyl of Brassica napus. The pGWB418 strain was activated in liquid LB medium supplemented with 50 mg / L kanamycin. After plasmid extraction, the fragment was double-digested with AfeI and SacI. The digested products were purified and recovered, and stored at -20℃ for later use. The target fragment of BnELP2 with the adapter recovered from the above digestion was infused with the linearized vector pGWB418 using a homologous recombinase to obtain the recombinant vector (pGWB418-BnELP2). The specific reaction system was as follows: 1.0 μL of double-digested linearized pGWB418 vector, 1.0 μL of 5×CE II Buffer, 0.5 μL of Exnase II homologous recombinase, 1 μL of PCR-purified product of BnELP3 with the vector adapter, and the volume was brought to 5.0 μL with sterile ddH2O. After reacting at 37℃ for 40 min, heat shock transformation of *E. coli* was performed using *E. coli* DH5α strain. The specific transformation procedure was as follows: *E. coli* DH5α competent cells stored at -80℃ were thawed in an ice bath. 50 μL of competent cells were added to 5 μL of the ligation reaction mixture, gently mixed, and placed on ice for 20 min. After the ice bath, the cells were incubated in a 42℃ water bath for 80 sec, then immediately placed on ice for 4 min. 300 μL of LB liquid medium was added, and the cells were incubated at 37℃ and 200 rpm for 50 min to recover. After recovery, the cells were centrifuged at 5000 rpm for 2 min, 300 μL of supernatant was discarded, and the cells were resuspended in the remaining supernatant. The bacterial suspension was evenly spread on LB solid medium (with 50 mg / L kanamycin added) and incubated upside down at 37℃ overnight. Single clones were picked, and 2-3 positive clones were sequenced. The strain without any mutations and the corresponding plasmid were preserved and named recombinant plasmid pGWB418-BnC05.PLATZ04. The correctly sequenced recombinant plasmid pGWB418-BnC05.PLATZ04 was transformed into Agrobacterium GV3101 competent cells using the freeze-thaw method. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium; in this example, 30 mg / L rifampin and 50 mg / L kanamycin were added). The culture was shaken at 28°C for 24-36 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.
[0037] 2. Construction of CRISPR / Cas9 gene knockout vector
[0038] Based on the BnC05.PLATZ04 gene sequence of Brassica napus obtained from the BnPIR database, two gRNAs with the highest scores and strongest specificity were screened using CRISPR-P 2.0 (CRISPR-P v2.0 (hzau.edu.cn)) developed by the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University: platz04-gRNA1 (5'TAGAACTTCTCTCGAAGCAG 3') and platz04-gRNA2 (5'ATGATCCTTGTGGAAAGAG 3').
[0039] Primers for amplification based on gRNA were synthesized as follows: platz04-BsF (5'ATATATGGTCTCGATTGAGAACTTCTCTCGAAGCAGGTT 3'), platz04-BsR (5'ATTATTGGTCTCGAAACATGATCCTTGTGGAAAGAGCAA 3'), platz04-F (5'TGAGAACTTCTCTCGAAGCAGGTTTTAGAGCTAGAAATAGC 3'), and platz04-R (5'AACATGATCCTTGTGGAAAGAGCAATCTCTTAGTCGACTCTAC 3'). Using the intermediate vector pCBC-DT1T2 as a template, the four primers were mixed for amplification. The product was then preserved, digested, and ligated with enzymes for reuse. The PCR product from the previous step was then ligated with the pKSE401 vector using BsaI restriction enzyme and T4 ligase at 37°C for 12 h. The reaction product was heat-shocked and transformed into *E. coli* DH5α. Single colonies were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmids were transformed into *Agrobacterium* GV3101 competent cells. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium; in this example, 30 mg / L rifampin and 50 mg / L kanamycin were added), and cultured at 28°C with shaking for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.
[0040] Example 3: Genetic transformation of rapeseed
[0041] Recombinant plasmids were screened and differentiated into seedlings using Agrobacterium-mediated hypocotyl infection. The specific steps are as follows:
[0042] 1. Seedling emergence: Select plump and active Westar seeds, put them into EP tubes, add mercuric chloride to sterilize in a clean bench for 4 min, pour out and recover the mercuric chloride, add 75% ethanol to sterilize for 2 min, pour out, rinse with sterile water for 2 min, repeat 3 times, use sterile tweezers to evenly place the treated seeds in M0 medium, and culture in the dark at 24 ℃ for 5 days.
[0043] 2. Activation of Agrobacterium: Two days after inoculation, Agrobacterium was cultured on YEP medium supplemented with the appropriate antibiotic at 28°C for 48 h. A single colony was picked and transferred to 5 mL of YEP medium, and cultured with shaking at 28°C for 36 h. Subsequently, 1 mL of bacterial suspension was transferred to 45 mL of YEP medium and cultured with shaking at 28°C for 12 h. Afterward, the bacterial cells were collected by centrifugation at 4000 rpm at 4°C. Agrobacterium was then resuspended in DM medium and diluted to an OD600 of approximately 0.7.
[0044] 3. Infection and Co-culture: In a clean bench, cut cultured hypocotyls, 8-10 mm in size, keeping them moist by adding DM medium during the cutting process. Then, immerse them in the prepared Agrobacterium suspension for 20 min, gently stirring with sterile forceps to ensure thorough inoculation. Finally, aspirate the suspension, transfer the hypocotyls to filter paper to remove excess suspension, and place them on M1 medium. Incubate at 24 °C in the dark for 36 h.
[0045] 4. Selection culture: Transfer the hypocotyls from M1 to M2 medium and culture at 24 ℃ for 16 h under light for 8 h in the dark for 12 days.
[0046] 5. Differentiation culture: Remove the brown hypocotyls from M2, transfer the healthy hypocotyls to M3 medium, and culture at 24 ℃ for 16 h light and 8 h dark. Repeat once every 12 days until germination.
[0047] 6. Rooting culture: After the buds appear, remove the callus tissue from the buds and insert them into M4 medium. Culture at 24℃ for 16 hours under light and 8 hours in the dark until roots are formed.
[0048] Example 4: Identification of inoculation of transgenic material *Sclerotinia sclerotiorum*
[0049] 1. Inoculation of detached leaves with *Sclerotinia sclerotiorum*: *Sclerotinia sclerotiorum* mycelial blocks were placed in PDA plates for incubation and activation. When the mycelium was about to spread to the edge of the plate, a 6 mm section of newly formed mycelium near the edge was taken and placed in a new PDA plate for activation. The plates were then incubated in the dark at 22 °C for approximately 40 h. A clean and sterilized storage container was prepared, with absorbent paper placed at the bottom for leaf storage and incubation. An equal amount of sterile water was added to each container, and the containers were sealed. The second-to-last fully expanded 6-leaf stage leaf of the rapeseed plant was selected and placed in a storage container. A cotton ball was used to retain moisture at the petiole. A 6 mm section of newly formed mycelium near the edge of the plate, avoiding the main vein, was placed upside down in the same position as the leaf. The container was sprayed with an equal amount of water to maintain humidity and incubated in the dark at 22 °C. The infection status of *Sclerotinia sclerotiorum* was observed and recorded periodically. Three biological replicates were set up for each strain.
[0050] 2. Leaf extract anti-Sclerotinia sclerotiorum experiment: 3 g of leaves of the same size and from the same part were ground into powder and mixed with 35 mL of extraction solution. The extraction solution formula (per 1 L) was as follows: MES (195.24 g / mol) 10.65 g; Tris (121.14 g / mol) 12.14 g; EDTA (372.24 g / mol) 0.03 g; NaCl (58.44 g / mol) 1.74 g. The mixture was centrifuged at 4500 rpm for 30 min at room temperature. The supernatant was collected and sterilized using a bacterial filter membrane, then added to PDA medium at a 1:1 ratio for storage. A 5 mm mycelial block was punched along the edge of the hyphae using a puncher and placed hyphae-side down in the center of the PDA medium. The area of mycelial expansion was used as the basis for anti-Sclerotinia sclerotiorum activity.
[0051] 3. DAB staining: Select leaves inoculated for 48 h with hyphal expansion edges of equal size and place them in 50 mL of 1 mg / mL diaminobenzidine solution. Vacuum the solution, let it stand for 20 minutes, and then incubate it in a 28 ℃ incubator for 8 h. Then, immerse the leaves in an acetone:methanol 1:1 solution for decolorization for 8 h, changing the acetone:methanol mixture 1-2 times during this period. Prepare slides, and finally photograph and record them using a stereomicroscope. The depth of brown color is used as the basis for the content of reactive oxygen species. Three biological replicates are set up for each strain.
[0052] 4. H2O2 content determination: The hydrogen peroxide content detection kit (purchased from Solarbio Science, Beijing) was used for determination. Weigh approximately 0.1 g of tissue (weighed using a 0.01 g balance). The homogenate was sterilized beforehand or the homogenate beads were heated with anhydrous ethanol for sterilization. After cooling on ice, the homogenate beads were added to an EP tube. 1 mL of Reagent 1 (pre-cooled acetone) was added. The sample was homogenized using a homogenizer at 70 Hz for 60 seconds, then centrifuged at 8000 rpm / 10 min at 4 ℃. 800 μL of the supernatant was collected and placed on ice. 80 μL of Reagent 2 and 160 μL of Reagent 3 were added. A new EP tube was prepared, labeled as a standard tube, and a 1 μmol / mL diluted standard solution was added. 80 μL of Reagent 2 and 160 μL of Reagent 3 were added.
[0053] Prepare new EP tubes, labeled as blank tubes, and add 1000 μL of Reagent 1 (acetone); add 80 μL of Reagent 2 and 160 μL of Reagent 3. Centrifuge all samples at room temperature at 4000 rpm / 10 min, discard the supernatant, and retain the precipitate. Wash the sample plant pigments with 500 μL of acetone, centrifuge at 8000 rpm for 2 min, discard the supernatant, and repeat the washing 3-5 times. After washing, add 800 μL of Reagent 4 to all samples to dissolve the precipitate. After standing at room temperature for 5 min, pour into a cuvette, measure the wavelength at 415 nm, zero the tube with distilled water, and record the absorbance of the measurement tube. Calculate: ΔAmeasured = Ameasured tube - Ablank tube, ΔAstandard = Astandard tube - Ablank tube. H2O2 content in tissue (umol / g mass) = ΔA determination ÷ (ΔA standard ÷ C standard solution) × V sample ÷ (V sample ÷ V extraction × W) = ΔA determination ÷ ΔA standard ÷ W, Note: C standard solution: H2O2 standard solution concentration, 1umol / mL; V sample: sample volume added, 1 mL; W: tissue mass, g; V extraction: volume used in the extraction process, 1 mL; Cpr: sample protein concentration.
[0054] The embodiments of the present invention involve the following: a specialized culture medium, antibiotic and hormone formulations, and their preparation.
[0055] Culture medium formulation and preparation method:
[0056] 1. M0 seedling culture medium
[0057] MS 4.405g;
[0058] 7.0g of agar;
[0059] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL, adjust the pH to 5.8-6.0, dispense 50 mL into each seedling box, and sterilize in an autoclave at 121℃ for 20 min.
[0060] 2. M1 co-culture medium
[0061] MS 4.405 g;
[0062] 30 g of sucrose;
[0063] Mannitol 18 g;
[0064] 2,4-D (1 mg / mL) 1000 μL;
[0065] KT (1 mg / mL) 300 μL;
[0066] 7.0 g of agar;
[0067] AS (100 mM / mL) 1000 μL;
[0068] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added, and the pH was adjusted to 5.8-6.0. The mixture was then placed in an autoclave at 121 °C for 20 min to sterilize. After sterilization, AS (100 mM / mL) was added in a clean bench and the mixture was dispensed into petri dishes.
[0069] 3. M2 screening medium
[0070] MS 4.405 g;
[0071] 30 g of sucrose;
[0072] Mannitol 18 g;
[0073] 2,4-D (1 mg / mL) 1000 μL;
[0074] KT (1 mg / mL) 300 μL;
[0075] 7.0 g of agar;
[0076] AgNO3 1500 μL;
[0077] TMT (50 mg / mL) 1000 μL;
[0078] Kan (50 mg / mL) 500 μL;
[0079] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added, and the pH was adjusted to 5.8-6.0. The mixture was then placed in an autoclave at 121 °C for 20 min to sterilize. After sterilization, TMT (50 mg / mL), Kan (50 mg / mL) and AgNO3 were added in a clean bench and then dispensed into petri dishes.
[0080] 4. M3 differentiation medium
[0081] MS 4.405 g;
[0082] 10g of glucose;
[0083] 0.25 g xylose;
[0084] Ethylenesulfonic acid 0.6 g;
[0085] 7.0 g of agar;
[0086] ZT (0.5 mg / mL) 2000 μL;
[0087] TMT (50 mg / mL) 1000 μL;
[0088] IAA (1 mg / mL) 100 μL;
[0089] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. The pH was adjusted to 5.8-6.0, and the mixture was placed in an autoclave at 115 °C for 15 min to sterilize. After sterilization, TMT (50 mg / mL), ZT (0.5 mg / mL), and IAA (1 mg / mL) were added in a clean bench and then dispensed into petri dishes.
[0090] 5. M4 rooting medium
[0091] MS 2.202 g;
[0092] 7 g of agar;
[0093] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL, adjust the pH to 5.8-6.0, dispense 50 mL into each conical flask, and sterilize in an autoclave at 121 °C for 20 min.
[0094] 6. DM culture medium
[0095] MS 4.405 g;
[0096] 30 g of sucrose;
[0097] 2,4-D (1 mg / mL) 1000 μL;
[0098] KT (1 mg / mL) 300 μL;
[0099] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added. The pH was adjusted to 5.8-6.0 and then dispensed into 50 mL portions into each culture flask. The flasks were then placed in an autoclave at 121 °C for 20 min to sterilize.
[0100] 7. YEP medium
[0101] 2 g of peptone;
[0102] 2 g of yeast powder;
[0103] 1 g of NaCl;
[0104] 15 g of agar;
[0105] Add distilled water to a final volume of 1000 mL, autoclave at 121 °C for 20 min, then dispense. Note: Liquid YEP medium does not require the addition of agar.
[0106] Antibiotic formulation:
[0107] 1. Kanamycin (Kan, 50 mg / mL): Weigh 0.5 g of kanamycin powder, add 10 mL of deionized water to dissolve it completely, filter, and dispense into sterile EP tubes. Store at -20 ℃.
[0108] 2. Ampicillin (Amp, 50 mg / mL): Weigh 0.5 g of ampicillin powder, add 10 mL of deionized water to dissolve it completely, filter to sterilize, dispense into individual containers, and store at -20 ℃.
[0109] 3. TMT (200 mg / L): Under aseptic conditions, inject 4 mL of sterile deionized water into 1.6 g of unopened bottled TMT powder using a syringe, then add 4 mL of sterile deionized water and mix thoroughly. Dispense directly into sterile EP tubes and store at -20 ℃.
[0110] 4. Rifampin (30 mg / mL): Weigh 0.5 g of rifampin powder, add 10 mL of DMSO to dissolve it completely, filter to sterilize, and dispense into sterile EP tubes. Store at -20 ℃.
[0111] 5. Spectinomycin (spec, 50 mg / mL): Weigh 0.5 g of kanamycin powder, dissolve it thoroughly in 10 mL of sterile deionized water, filter to sterilize, and then dispense into sterile EP tubes. Store at -20 ℃.
[0112] Hormone formulation:
[0113] 1. Acetyleugenone (As, 100 mM / mL): Weigh 0.196 g of acetyleugenone powder, add 10 mL of DMSO to dissolve it completely, filter to sterilize, dispense into sterile EP tubes, and finally store in a -20 ℃ refrigerator.
[0114] 2. Plant growth regulator (2,4-D, 1 mg / mL): Weigh 100 mg of 2,4-D, add 1 mL of 1N KOH and shake for 5 min. Then add 10 mL of sterile deionized water and shake until 2,4-D is fully dissolved. Finally, bring the volume to 100 mL with sterile deionized water and store at 4 ℃.
[0115] 3. Kinetin (KT, 1 mg / mL): Weigh 100 mg of KT dry powder, then add 1 mL of 1N KOH and shake until KT is completely dissolved. Then add ddH2O to make up to 100 mL and store at 4 ℃.
Claims
1. The use of overexpression of the class transcription factor BnC05.PLATZ04 gene in improving resistance to Sclerotinia sclerotiorum of Brassica napus, characterized in that: The nucleotide sequence of the rapeseed gene is shown in SEQ ID NO:1.