Modulating the tumor immune microenvironment by targeting regulatory T cells (TREG) with chimeric antigen receptor (CAR) T-cell therapy

By developing chimeric antigen receptor (CAR) immune cells that target the glycoprotein A repeat dominant protein (GARP), the immunosuppressive tumor microenvironment problem in high-grade gliomas has been solved, achieving effective treatment and extended survival for cancers such as glioblastoma.

CN122295360APending Publication Date: 2026-06-26OHIO STATE INNOVATION FOUND +1
View PDF 32 Cites 0 Cited by

Patent Information

Application Number
CN202480075674.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-08-02
Filing Date
2024-10-04
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

High-grade gliomas (HGG) have a poor prognosis, and existing treatments are insufficient to overcome their molecular heterogeneity, immunosuppressive tumor microenvironment, and treatment resistance. New treatment approaches are needed to target regulatory T cells to improve the tumor microenvironment.

Method used

Develop chimeric antigen receptor (CAR) immune cells, particularly CAR immune cells that target the dominant glycoprotein A repeat (GARP), including T cells, B cells, NK cells, NK T cells, or macrophages, and modulate immunosuppressive regulatory T cells (Tregs) in the tumor microenvironment by administering these cells to reduce or inhibit the activity of GARP+ regulatory T cells.

Benefits of technology

It significantly improved the treatment effect of cancers such as glioblastoma, reduced the immunosuppression in the tumor microenvironment, enhanced the anti-tumor immune response, and prolonged the survival of patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122295360A_ABST
    Figure CN122295360A_ABST
Patent Text Reader

Abstract

A chimeric antigen receptor targeting glycoprotein A repeat dominant protein (GARP) and its use in the treatment of cancers, including but not limited to breast cancer, bladder cancer, glioblastoma, leukemia, or other malignancies characterized by GARP+Treg, are disclosed.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Statement on Federally Funded Research

[0002] This invention was carried out with government support under license / contract numbers P01 CA186866, R01 AI077283, R01 CA213290, R01 CA255334, and R01 CA262069 granted by the National Institutes of Health (NIH). The government holds certain rights to this invention.

[0003] Cross-reference to related applications

[0004] This application claims the benefit of U.S. Provisional Application No. 63 / 678,901, filed August 2, 2024; U.S. Provisional Application No. 63 / 610,289, filed December 14, 2023; and U.S. Provisional Application No. 63 / 587,973, filed October 4, 2023; all of which are incorporated herein by reference in their entirety. Background Technology

[0005] Gliomas are the most common malignant primary tumors of the central nervous system, affecting approximately 3.19 people per 100,000 annually in the United States. The prognosis for high-grade gliomas (HGG) remains poor, with a survival of less than two years after diagnosis. Low-grade gliomas (LGG) represent an early stage of disease that will inevitably progress. The most well-studied and common form of HGG is grade IV astrocytoma, or glioblastoma (GBM), which presents significant treatment challenges due to its molecular heterogeneity, low neoantigen burden, highly immunosuppressive tumor microenvironment (TME), and inherent treatment resistance. New therapies are needed to treat glioblastoma and other cancers. Summary of the Invention

[0006] Methods and compositions relating to chimeric antigen receptor immune cells that target anti-glycoprotein A repeat dominant protein (GARP) are disclosed.

[0007] This article discloses chimeric antigen receptor (CAR) immune cells (including, but not limited to, T cells, B cells, NK cells, NK T cells, or macrophages) that contain anti-glycoprotein A repeat dominant protein (GARP) binding molecules. In some aspects, the CAR further includes CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domains.

[0008] In one aspect, this document discloses any of the foregoing CAR immune cells, wherein the anti-GARP binding molecule comprises i) variable heavy chain (VH) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 1, 2, and 3, respectively, and ii) variable light chain (VL) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 4, 5, and 6, respectively.

[0009] This document also discloses CAR immune cells in any of the foregoing aspects, wherein the anti-GARP binding molecule comprises a V-type antibody against a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The structural domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. L Structural domains. In one aspect, anti-GARP binding molecules contain V as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

[0010] In one aspect, this document discloses CAR immune cells of any of the foregoing aspects, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO: 9. H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH1VL1), as shown in SEQ ID NO: 9, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 13L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3).

[0011] In one aspect, this document discloses methods for treating, inhibiting, reducing, improving, and / or preventing cancers and / or metastases in a subject (such as, for example, GARP-positive (GARP+) cancers and / or cancers containing GARP+ regulatory T cells in the tumor microenvironment, including but not limited to glioblastoma, bladder cancer, breast cancer, or leukemia, or other malignancies characterized by GARP+ Tregs), comprising administering to the subject an effective amount of any of the aforementioned CAR immune cells (including but not limited to T cells, B cells, NK cells, NK T cells, or macrophages). For example, in one aspect, this document discloses methods for treating, inhibiting, reducing, improving, and / or preventing cancers and / or metastases in a subject (such as, for example, GARP-positive (GARP+) cancers and / or cancers containing GARP+ regulatory T cells in the tumor microenvironment, including but not limited to glioblastoma, bladder cancer, breast cancer, or leukemia, or other malignancies characterized by GARP+ Tregs), comprising administering to the subject chimeric antigen receptor (CAR) immune cells containing an anti-glycoprotein A repeat dominant protein (GARP) binding molecule. In some respects, CAR further includes CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signal transduction domains.

[0012] This document also discloses methods for treating, inhibiting, reducing, diminishing, improving, and / or preventing cancer and / or metastases in any of the foregoing aspects, wherein the anti-GARP binding molecule comprises i) variable heavy chain (VH) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 1, 2, and 3, respectively, and ii) variable light chain (VL) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 4, 5, and 6, respectively.

[0013] In one aspect, this document discloses methods for treating, inhibiting, reducing, diminishing, improving, and / or preventing cancer and / or metastases in any of the foregoing aspects, wherein the anti-GARP binding molecule comprises a V-type antibody to a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9, or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The structural domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V.L Structural domains. In one aspect, anti-GARP binding molecules contain V as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

[0014] This document also discloses methods for treating, inhibiting, reducing, diminishing, improving, and / or preventing cancer and / or metastases in any of the foregoing aspects, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO: 9. H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH1VL1), as shown in SEQ ID NO: 9, is V H The structural domain and V as shown in SEQ ID NO:13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is a V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V HThe structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3).

[0015] This article also discloses methods for modulating, reducing, inhibiting, decreasing, and / or blocking immunosuppressive regulatory T (Treg) cells (including, but not limited to, GARP+ Treg) in the tumor microenvironment (TME) of a subject’s cancer (such as, for example, GARP-positive (GARP+) cancer and / or cancers containing GARP+ regulatory T cells in the tumor microenvironment, including but not limited to glioblastoma, bladder cancer, breast cancer, or leukemia or other malignancies characterized by GARP+ Treg), which includes administering a therapeutically effective amount of any of the foregoing CAR immune cells (including but not limited to T cells, B cells, NK cells, NK T cells, or macrophages) to the subject. For example, in one aspect, this document discloses a method for regulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells (including, but not limited to, GARP+ Tregs) in the tumor microenvironment (TME) of a subject's cancer (such as, for example, GARP-positive (GARP+) cancer and / or cancers containing GARP+ regulatory T cells in the tumor microenvironment, including but not limited to glioblastoma, bladder cancer, breast cancer, or leukemia, or other malignancies characterized by GARP+ Tregs), comprising administering to the subject a therapeutically effective amount of chimeric antigen receptor (CAR) immune cells (including but not limited to T cells, B cells, NK cells, NK T cells, or macrophages), said CAR immune cells containing an anti-glycoprotein A repeat dominant protein (GARP) binding molecule. In some aspects, the CAR further comprises CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domains.

[0016] In one aspect, this document discloses methods for regulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of cancer, wherein the anti-GARP binding molecule comprises i) variable heavy chain (VH) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 1, 2, and 3, respectively, and ii) variable light chain (VL) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 4, 5, and 6, respectively.

[0017] This document also discloses methods for regulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of cancer in any of the foregoing aspects, wherein the anti-GARP binding molecule comprises a V-type antibody to a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9, or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The structural domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. L Structural domains. In one aspect, anti-GARP binding molecules contain V as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

[0018] In one aspect, this document discloses methods for regulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of cancer, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO: 9. H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH1VL1), as shown in SEQ ID NO: 9, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 LThe structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3). Attached Figure Description

[0019] The accompanying drawings, which are incorporated in and form a part of this specification, illustrate several embodiments and, together with the description, demonstrate the disclosed compositions and methods.

[0020] Figure 1A Figure 1B Figure 1C Figure 1D and Figure 1EThe results of public data mining are shown. Figure 1A shows the survival analysis of the total GBM dataset. The high GARP group is defined as the samples with the top 10% GARP expression value. The low GARP group is defined as the samples with the bottom 10% GARP expression value. Figure 1B shows the survival analysis of mesenchymal subtypes between the high and low GARP groups. Figure 1C shows GARP expression in the TCGA-GBM-2013 dataset. “M” represents the mesenchymal subtype (49 samples), and “non_M” represents the non-mesenchymal subtype (94 samples). Figure 1D shows the GSEA analysis of angiogenesis, myeloid compartments, T cell characteristics, and T cell exhaustion in the TCGA-GBM-2013 dataset. Figure 1E A heatmap is shown, illustrating the expression of myeloid compartment characteristic genes in the mesenchymal and non-mesenchymal groups.

[0021] Figure 2A Figure 2B Figure 2C Figure 2D Figure 2E Figure 2F Figure 2G Figure 2H and Figure 2I The study showed that high GARP expression in human GBM is associated with immune cell rejection. Figure 2A Figures 2B and 2C show paraffin-embedded human GBM samples stained using a multiple IF strategy to assess GARP expression and local TME findings. High GARP levels (2A) were associated with low TIL infiltration, while low GARP regions were the opposite (2B and 2C). Figure 2D Figure 2E Figure 2F Figure 2G Figure 2H and Figure 2I The quantification of tissue differences was shown. Areas with low total GARP had more cells (2D), while areas with high GARP showed similar cell density (2E). Areas with high GARP showed increased CD11b+ and CD4+. + CD8 + and FoxP3 + Decreased infiltrating lymphocytes (2F, 2G, 2H, and 2I). =p<0.05; =p<0.01; paired Student's t-test

[0022] Figure 3A Figure 3B Figure 3C and Figure 3D Visualization of (3A) public ATAC-seq data assessing GARP expression on glioma stem cells and angiogenic cells is shown. IGV illustrates the LRRC32 gene promoter region based on the hg19 human reference genome. Figure 3B Figure 3C and Figure 3D Immunofluorescence staining results for various stem cell markers and GARP in 10 LGG and HGG paired samples are shown. The percentage of GARP+ cells of each type was compared with the Wilcoxon rank-sum test.

[0023] Figure 4A Figure 4B Figure 4C and Figure 4D The in vitro efficacy of mouse and human PIIO-1 CAR-T cells against GBM in a GARP-dependent manner is shown. Figure 4A shows the proliferation assay of mouse CAR-T cells co-cultured with GL261 or CT-2A and their overexpression counterparts. Figure 4B shows a visualization of the change in the percentage of CAR-T cells in the population at the end of the experiment shown in (4A). Figure 4C shows the cytotoxicity assay of CAR-T cells of each cell line and their hGARP-overexpressing counterparts with different effector-target ratios. Figure 4D Cytokine measurements were performed via ELISA on the supernatant collected from the cytotoxicity assay shown in (4C). p<0.01; p<0.001; p<0.0001; all statistical tests were two-tailed independent Student's t-tests used to compare means.

[0024] Figure 5A Figure 5B Figure 5C Figure 5D Figure 5E and Figure 5F This study demonstrates the in vivo safety of PIIO-1 CAR-T cells in hGARP knock-in mice and the in vivo efficacy of PIIO-1 CAR-T cells in an immunodeficient mouse model. Figure 5A Figures 5B and 5C show the infusion of 1x10 6 Body weight, serum cytokine levels, and platelet counts in non-tumor-bearing hGARPKI mice after 1 PIIO-1 CAR-T cell or EGFRvIII CAR-T cell administration. Figure 5D Figure 5E and Figure 5F The image shows the implantation of 1x10 EV CAR-T or PIIO-1 CAR-T on day 8 after tumor implantation. 5Bioluminescence imaging of NSG mice with U87 hGARP OE cells was performed, followed up for 100 days. Mice receiving PIIO-1 CAR-T showed early tumor rejection and significantly improved survival and luminescence readouts (D&E). Furthermore, histological evaluation showed that mice receiving PIIO-1 CAR-T did not have identifiable tumors on H&E or GARP immunofluorescence, while EV CAR-T mice had large tumors with necrotic cores. "ns" = not significant; p<0.05; p<0.01; p<0.001; p < 0.0001. Survival outcomes were compared using a log-rank test. Luminescence and cytokine data were compared at each time point using a two-tailed independent Student's t-test.

[0025] Figure 6A Figure 6B Figure 6C Figure 6D Figure 6E Figure 6F and Figure 6G Efficacy and safety of anti-GARP chimeric antigen receptor T cells (PIIO-1CAR-T) in an immunocompetent glioblastoma model. Figure 6A shows a schematic diagram illustrating the experimental timeline. Figure 6B shows luminescence imaging of mice receiving CAR-T and empty vector (EV) T cells. Mice were imaged every 1–2 weeks. Figure 6C shows quantitative photon counts of the luminescence images. =p<0.05; assessed by two-way ANOVA. Figure 6D shows the Kaplan-Meier curves comparing mice in each group. =p<0.001. Figure 6E shows the normalized percentage of mouse body weight over time. =p<0.0001; evaluated using a mixed-effects model. Figure 6F and Figure 6G The assessment of the components of the whole blood count for each group at weekly time points is shown. No significant differences were noted in the counts.

[0026] Figure 7A Figure 7B Figure 7C Figure 7D Figure 7E Figure 7F and Figure 7G Supplementary data mining results are shown: Figure 7A Figure 7BFigures 7C and 7D show the survival analysis between the high GARP group and the low GARP group in terms of the overall TCGA-GBM-2013 dataset, classical subtype, neural subtype, and protoneurial subtype. Figure 7E shows the gene list of the GARP-TGFβ axis (GARP activators). Figure 7F shows the visualization of GARP activation scores for different GBM subtypes in the TCGA-GBM-2013 dataset. Figure 7G The results of GSEA enrichment analysis of gene lists from the other three T cell exhaustion groups are shown.

[0027] Figure 8A Figure 8B Figure 8C Figure 8D Figure 8E Figure 8F Figure 8G and Figure 8H Clustering of immune cells based on lineages within the GBM microenvironment is shown. Figure 8A Figure 8B Figures 8C and 8D show images obtained from selected stained FFPE slides of human GBM at 20x magnification, showing aggregations of CD11b+, CD8+, and CD4+ cells. Figure 8E Figure 8F Figure 8G and Figure 8H The nearest neighbor analysis of immune cells within the GBM microenvironment is shown, with each cell type serving as a reference for others. Statistical comparisons were performed using a two-tailed paired Student's t-test. NS = Not significant; =p<0.05; =p<0.01

[0028] Figure 9A Figure 9B Figure 9C Figure 9D Figure 9E and Figure 9F The study showed that GARP expression is present in a range of glioma grades. Figure 9A Figures 9B and 9C show the immunofluorescence staining results of three different LGG tissue sections, demonstrating a range of GARP expression from high (9A) to none (9C). Figure 9D shows a histogram visualization of the relative percentage of GARP-high tissue in FFPE slides paired with 12 LGG and HGG. NS = Not significant. Figure 9E shows the immunofluorescence visualization of tissue microarray sections from normal brain and glioblastoma, demonstrating the difference in GARP expression. Figure 9F A graph showing the percentage of qualitatively GARP-positive cores in four commercially available human glioma tissue microarrays (n = 180 GBMs, n = 121 low-grade gliomas, and n = 46 normal brain cores).

[0029] Figure 10 Exploring .TISCH2 single-cell RNA-seq data. This figure illustrates gene expression in different cell subtypes across four GBM datasets. For each group, the top UMAP shows a subset of cells, and the bottom violin plot shows... LRRC32 , CD44 , PROM1 and SOX2 Gene expression visualization.

[0030] Figure 11A Figure 11B Figure 11C Figure 11D and Figure 11E Additional information regarding cell line staining and CAR structure is shown. Figure 11A illustrates a description of the general structure of the CAR construct, featuring variable heavy (VH) and variable light (VL) chains, a linker (L), a CD8a transmembrane (TM) region, and 4-1BB and CD3z intracellular signaling domains. Figures 11B and 11C show the immunofluorescence evaluation of the three parental and human GARP-overexpressing cell lines used in this study. All cells were grown on sterile culture slides and directly fixed to the slides to preserve cellular structure. Figure 11D and Figure 11E This shows the LRRC32 keystroke from our human ( hLRRC32 KI Immunofluorescence assessment of GARP expression in organs of FFPE mice from a mouse model (11D) and a commercial human tissue microarray (11E). Organs with negative staining are not shown.

[0031] Figure 12A Figure 12B Figure 12C Figure 12D and Figure 12E The study showed that elevated GARP expression in human glioblastoma was associated with decreased overall survival, mesenchymal subtype, and aggressive gene signature. Figure 12A shows the overall survival analysis of the GBM cohort, which was derived from the Chinese Glioma Genome Atlas (CGGA). Left n = 636; LRRC32 Low n = 318; LRRC32 High n = 318) and glioblastoma and low-grade glioma (TCGA-GBMLGG) combined with cancer genome atlas. (Right, n = 667; LRRC32) (Low n = 333; LRRC32 High n = 334) queue, ordered by LRRC32 Median relative expression of mRNA was used for stratification; survival analysis was performed via log-rank Mantel-Cox comparisons of survival curves. Figure 12B shows the mRNA from CGGA ( Left, n = 650) and TCGA-GBMLGG ( right Relative tumor grades in the cohort (n = 620) LRRC32 Comparison of mRNA expression. Expression was compared using Brown-Forsythe one-way ANOVA with Dunnett T3 multiple comparison test (CGGA) or via one-way ANOVA with Tukey multiple comparison test (TCGA-GBMLGG). Figure 12C shows the expression from CGGA (right, n) = GBM patients stratified by subtype in the 435) and IVY GAP (left, n = 270) cohorts LRRC32 The relative mRNA expression was compared using univariate ANOVA and Tukey multiple comparison correction. Figure 12D shows the expression in a sample from a pediatric glioma patient. LRRC32 low mRNA ( LRRC32 mRNA low was designated as LRRC32 The sample with the lowest mRNA expression (n = 44) and the sample with high ( LRRC32 mRNA was highly designated as LRRC32 The mean relative mRNA expression levels of mesenchymal subtype-related genes were compared between samples in the upper quartile (n = 44) after sorting. These samples were from the Clinical Proteomics Tumor Analysis Consortium for Childhood Brain Tumors / Children's Hospital of Philadelphia (CPTAC / CHOP) cohort. Figure 12E This demonstrates the quantitative analysis of genomic variation (GSVA) ​​scores using the TCGA-GBM-2013 dataset. LRRC32 Pathway expression was used, where "M" specified samples with the mesenchymal subtype (49 samples) and "non_M" specified samples with the non-mesenchymal subtype (94 samples). Statistical analysis was performed using the Wilcoxon rank-sum test for comparison. LRRC32 Pathway expression. p<0.05 p<0.001

[0032] Figure 13A Figure 13B Figure 13C Figure 13DFigures 13E, 13F, and 13G show that GARP expression in the tumor microenvironment is associated with decreased tumor-infiltrating lymphocytes. Ten human GBM specimens collected from patients treated at Ohio State University were subjected to multiplex immunofluorescence staining. Specimens were stained with GARP and a set of immune cell markers (including CD4, CD8, FOXP3, and CD11b); whole-slide imaging and analysis were performed using InForm software. Figure 13A shows a representative tumor region with low GARP levels (“low GARP”; <250 GARP). + cells / mm 2 Figure 13B shows a representative tumor region with high GARP levels (“GARP high”; >250 GARP). + cells / mm 2 Figure 13C shows the quantification of the total number of GARP-low and GARP-high regions for each specimen, expressed as a percentage of the scanned area. GARP expression does not alter the overall cell density (data not shown). Figure 13D Figures 13E, 13F, and 13G show the quantification of immune cell subsets in the low-GARP and high-GARP regions of each GBM specimen. CD11b in the high-GARP region... + Cells significantly increased (13D), CD8 + (13E), CD4 + (13F) and CD4 + / FoxP3 + (13G) cells were significantly reduced. For statistical analysis purposes, samples were paired (e.g., regions of high AGARP in patients with regions of low AGARP in patients). p<0.05; p<0.01; Wilcoxon paired signed-rank test.

[0033] Figure 14A Figure 14B Figure 14C Figure 14D Figure 14E Figure 14F and Figure 14G This shows that GARP is expressed by glioma stem cells and new blood vessels in the tumor microenvironment. Figure 14A shows representative images of GARP (yellow) and DAPI (blue) expression by multiplex immunofluorescence staining in normal brain and glioblastoma patient samples. (Left) Quantitative analysis of the percentage of GARP-positive cores relative to tumor grade and type. (right); Whole-slide imaging and analysis were performed on specimens from four commercially acquired human glioma tissue microarrays (n = 180 GBMs, n = 121 low-grade gliomas, and n = 46 normal brain nuclei) using InForm software. Figure 14B Figure 14C Figure 14D Figure 14E Figure 14F and Figure 14G Multiplex immunofluorescence staining of paired samples from a patient diagnosed with low-grade glioma and subsequently diagnosed with HGG is shown. Specimens were stained with GARP and stem cell-like markers, including CD44, SOX2, and CD133; whole-slide imaging and analysis of the specimens were performed using InForm software. Figure 14B Figures 14C and 14D show cells containing mesenchymal-like glioma stem cells (CD44). + / SOX2 + ,14B); oligodendroglioma stem cells (CD133) + / SOX2 + ,14C); and new angiogenic cells (CD133) + / CD31 + Representative tumor regions of 14D were identified. The relative frequencies of GARP expression in oligodendrocyte-like (14E) and mesenchymal-like (14F) glioma stem cells (GSCs) in LGG and HGG specimens were compared with those in non-GSCs. The relative frequencies of GARP expression in neoantigen cells (14G) were compared between LGG and HGG specimens. LGG and HGG expressed similar levels of GARP in both GSC subtypes and neoantigen cells. Comparisons were performed within the same grade (LGG vs. LGG, HGG vs. HGG) using the Wilcoxon paired signed-rank test. HGG: high-grade glioma, LGG: low-grade glioma, ns = no significant difference.

[0034] Figure 15A Figure 15B Figure 15C Figure 15D and Figure 15E The in vitro and in vivo activity of anti-GARP CAR-T cells against murine syngeneic GBM tumors is shown in a clinically relevant human GARP knock-in mouse model. Figure 15A shows CAR expression in murine T cells transduced with a lentivirus expressing anti-GARPCAR. Representative flow cytometry histograms stained with Protein L. EV and empty vector control. Figure 15B shows cytotoxicity data from a co-culture assay containing CAR-T cells (GARP CAR-T or EV T) with an increased effective target ratio compared to GARP-overexpressing CT-2A or GL261 murine glioma cells (CT-2A-hGARP, GL261-hGARP). Figure 15C shows cytokine measurements from the co-culture supernatant in (15B) via ELISA. Figure 15D shows the cytokine measurements in immunocompetent mice. hLRRC32 KIGARP CAR-T and EV-T targeting mouse GBM in C56BL / 6 mice in vivo The experimental protocol for evaluation. Figure 15E Bioluminescent imaging and quantification of tumors in mice that received anti-GARP CAR-T and EV T cells are shown.

[0035] Figure 16A Figure 16B Figure 16C and Figure 16D The study demonstrated that systemic administration of anti-GARP-CAR-T cells to human GARP knock-in mice did not induce significant toxicity. Figure 16A shows tumor-free cells after lymph node clearance. hLRRC32 KI In mice, the percentage changes relative to baseline body weight (16B), platelet count, and serum cytokines (16C and 16D) following IV infusion of GARP-CAR-T cells or EGFRvIII-CAR-T cells.

[0036] Figure 17A Figure 17B Figure 17C Figure 17D Figure 17E Figure 17F Figure 17G and Figure 17H The data mining results are shown in addition to the above. Figure 17A shows a list of genes along the GARP-TGFβ axis (GARP-related factors). Figure 17B shows a visualization of the GARP-related pathway enrichment scores for different GBM subtypes in the TCGA-GBM-2013 dataset. Figure 17C Figure 17D Figure 17E Figures 17F and 17G show the total TCGA-GBM-2013 dataset, through... LRRC32 Overall survival analysis of mRNA expression stratification for mesenchymal, classical, neural, and proneural subtypes, including... LRRC32 The high group is defined as LRRC32 The top 10% of samples in terms of mRNA expression, and LRRC32 mRNA low group specified as LRRC32 Survival analysis was performed on the 10% of samples after mRNA expression by comparing the log-rank of the survival curves. Figure 17H GSEA analysis of angiogenesis, myeloid compartments, T cell characteristics, and T cell depletion in mesenchymal patients from the TCGA-GBM-2013 dataset is presented.

[0037] Figure 18A Figure 18B Figure 18C Figure 18D Figure 18E Figure 18F Figure 18G and Figure 18H Clustering of immune cells based on lineages within the GBM microenvironment is shown. Figure 18A Figure 18B Figures 18C and 18D show images obtained from selected stained FFPE slides of human GBM at 20x magnification, showing aggregations of CD11b+, CD8+, and CD4+ cells. Figure 18E Figure 18F Figure 18G and Figure 18H The nearest neighbor analysis of immune cells within the GBM microenvironment is shown, with each cell type serving as a reference for others. Statistical comparisons were performed using a two-tailed paired Student's t-test. NS = Not significant; =p<0.05; =p<0.01.

[0038] Figure 19A Figure 19B Figure 19C Figure 19D and Figure 19E The study showed that GARP expression is present in a range of glioma grades. Figure 19A Figures 19B and 19C show the immunofluorescence staining results of three different LGG tissue sections, demonstrating a range of GARP expression from high (19A) to none (19C). Figure 19D shows a histogram visualization of the relative percentage of GARP “high” tissue in FFPE slides with 8 pairs of LGG and HGG pairs. NS = Not significant. Figure 19E The visualization of public ATAC-seq data via Integrated GenomicsViewer (IGV) software demonstrates chromatin accessibility of the LRRC32 gene promoter region based on the hg19 human reference genome.

[0039] Figure 20 This figure illustrates the exploration of TISCH2 single-cell RNA-seq data. It shows gene expression in different cell subtypes across four GBM datasets. For each group, a UMAP at the top displays a subset of cells, and a violin plot at the bottom visualizes the gene expression of LRRC32, CD44, PROM1, and SOX2.

[0040] Figure 21 The cytotoxicity of GARP CAR-T against the HEL erythroleukemia cell line was demonstrated. HEL cell lines with three different gene manipulations (EV, GARP-OE, and GARP-KO) were co-cultured with PIIO-1 GARP CAR-T or T-cell mimics for 24 hours. Cytotoxicity was calculated using an LDH-based assay with the following formula: %cytotoxicity = (OD CAR_T处理的样品 -OD 模拟T处理的样品 ) 100 / (OD max - OD 模拟T处理的样品 )

[0041] Figure 22 A schematic diagram of the Treg in vitro cytotoxicity assay is shown.

[0042] Figure 23 The following diagram shows the fold change in the proportion of hGARP or GARPKO Treg cells in CD45.2+ cells after co-incubation with mouse PIIO-1 GARP CAR-T cells at various effector-target ratios for 20 hours (a), and a representative dot plot from flow cytometry staining (b).

[0043] Figure 24 The percentage fold change of Treg cells (hGARP Treg on the left and GARPKO Treg on the right) in CD45.2+ cells after co-culturing with PIIO-1 CAR-T or T-mimetic cells is shown relative to baseline.

[0044] Figure 25 The bar chart represents the percentage of cytotoxicity of human PIIO-1 GARP CAR-T cells (left) or T-cell mimicry (right) against in vitro transformed hGARP (blue) or GARPKO (red) Treg cells after 18 hours of co-incubation.

[0045] Figure 26 The left panel shows a bar chart illustrating the CTV+:CTV- cell ratio, representing the fraction of target cells in the culture at the end of the assay after co-incubation with PIIO-1 GARP CAR-T or T-cell mimics. The right panel shows the cytotoxicity of human PIIO-1 GARP CAR-T cells or T-cell mimics against CD4+Foxp3+ Treg cells within CTV+ TILs.

[0046] Figure 27 This study demonstrates the treatment of immunocompetent hLrrc32KI mice (250,000 PyVT cells / mouse in situ) with GARP CAR-T therapy 10 days after tumor implantation, following a 5 Gy TBI administration. Tumors were harvested two days after CAR-T injection, and tumor-infiltrating lymphocytes were assessed by flow cytometry.

[0047] Figure 28 The proportion of Tregs within +CD4+ TILs in hGARP mice carrying breast cancer after GARP CAR-T infusion is shown, as evaluated by flow cytometry between mice treated with T-cell analogs and CAR-T cells. A representative dot plot is shown in the right figure.

[0048] Figure 29 Flow cytometry analysis of CD8+ TILs shows a significant reduction in depleted PD1+TIM3+ T cells in mice receiving GARP CAR-T cells compared to the mimic treatment. A representative dot plot is shown in the right figure. Detailed Implementation

[0049] Before disclosing and describing the compounds, compositions, articles, devices, and / or methods of the present invention, it should be understood that, unless otherwise specified, the compounds, compositions, articles, devices, and / or methods are not limited to specific synthetic methods or specific recombinant biotechnology methods, or, unless otherwise specified, are not limited to specific reagents, as the compounds, compositions, articles, devices, and / or methods can certainly vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0050] A. Definition

[0051] As used in the specification and appended claims, the singular forms “an,” “a,” and “the” include plural indicators unless the context clearly specifies otherwise. Thus, for example, a reference to “drug carrier” includes a mixture of two or more such carriers, etc.

[0052] In this document, a range may be expressed as from “about” a particular value and / or to “about” another particular value. When expressing this range, another embodiment includes from said one particular value and / or to another particular value. Similarly, when a value is expressed as an approximation using the antecedent “about,” it should be understood that said particular value forms another embodiment. It should be further understood that each endpoint of a range is significant relative to, and independently of, the other endpoint. It should also be understood that a number of values ​​are disclosed herein, and each value is also disclosed herein as “about” the particular value other than the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It should also be understood that, as will be properly understood by those skilled in the art, when a disclosed value is “less than or equal to” the value, “greater than or equal to” the value and possible ranges between said values ​​are also disclosed. For example, if the value “10” is disclosed, then “less than or equal to 10” and “greater than or equal to 10” are also disclosed. It should also be understood that throughout the application, data is provided in a variety of different formats, and that the data represents endpoints and starting points, as well as a range of any combination of data points. For example, if a specific data point "10" and a specific data point 15 are disclosed, it should be understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15, as well as between 10 and 15, are considered disclosed. It should also be understood that each unit between two specific units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0053] Throughout this specification and the following claims, reference will be made to numerous terms that should be defined to have the following meanings: "Optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes examples of the event or situation occurring and examples of the event or situation not occurring.

[0054] An "increase" can refer to any change that results in a greater quantity of symptoms, disease, composition, condition, or activity. An increase can be any individual, median, or average increase in symptoms, activity, or composition by a statistically significant amount. Therefore, an increase can be 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, as long as the increase is statistically significant.

[0055] "Reduction" can refer to any change that results in a smaller amount of symptoms, disease, composition, condition, or activity. When the genetic output of a gene product utilizing a substance is lower than the output of a gene product not utilizing the substance, the substance should also be understood as reducing the genetic output of the gene. For example, reduction can be a change in the symptoms of a disease that results in fewer symptoms than previously observed. Reduction can be any individual, median, or average reduction in symptoms, activity, or composition at a statistically significant amount. Therefore, the reduction can be 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, provided that the reduction is statistically significant.

[0056] "Inhibit," "inhibiting," and "inhibition" mean a reduction in activity, response, symptom, disease, or other biological parameters. This can include, but is not limited to, complete ablation of activity, response, symptom, or disease. It can also include, for example, a 10% reduction in activity, response, symptom, or disease compared to natural or control levels. Therefore, the reduction compared to natural or control levels can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any reduction in between.

[0057] The word "reduce" or other forms of the word, such as "reducing" or "reduction," refers to reducing an event or characteristic. For example (Tumor growth). It should be understood that this is usually related to a standard or expected value; in other words, it is relative, but it is not always necessary to cite a standard or relative value. For example, "reducing tumor growth" means reducing the rate of tumor growth relative to a standard or control.

[0058] The term "prevent" or other forms of the term (such as "preventing" or "prevention") means to prevent a particular event or characteristic in order to stabilize or delay its development or progression, or to minimize the likelihood of its occurrence. Prevention does not require comparison with a control, as it is generally more absolute than, for example, reduction. As used herein, something can be reduced but not prevented, but something reduced can also be prevented. Similarly, something can be prevented but not reduced, but something prevented can also be reduced. It should be understood that, unless otherwise expressly stated, the use of other terms is also explicitly disclosed in the context of reduction or prevention.

[0059] The term "subject" refers to any individual who is the target of administration or treatment. A subject can be a vertebrate, such as a mammal. In one aspect, a subject can be a human, a non-human primate, a cow, a horse, a pig, a dog, or a cat. A subject can also be a guinea pig, a rat, a hamster, a rabbit, a mouse, or a mole. Therefore, a subject can be a human or a veterinary patient. The term "patient" refers to a subject under the treatment of a clinician (e.g., a physician).

[0060] The term "therapeuticly effective" means that the amount of the composition used is sufficient to improve one or more causes or symptoms of the disease or ailment. Such improvement requires only reduction or alteration, not elimination.

[0061] The term "treatment" refers to the medical management of a patient aimed at curing, improving, stabilizing, or preventing a disease, pathological condition, or symptom. This term includes active treatment, which is treatment specifically aimed at improving a disease, pathological condition, or symptom, and also includes etiological treatment, which is treatment aimed at eliminating the cause of the related disease, pathological condition, or symptom. Additionally, this term includes palliative treatment, which is treatment designed to relieve symptoms rather than cure a disease, pathological condition, or symptom; preventative treatment, which involves minimizing or partially or completely suppressing the development of a related disease, pathological condition, or symptom; and supportive treatment, which is treatment used to complement another specific therapy aimed at improving a related disease, pathological condition, or symptom.

[0062] "Biocompatibility" generally refers to materials and any of their metabolites or degradation products that are generally non-toxic to recipients and do not cause significant side effects to subjects.

[0063] The word "comprising" is intended to mean that compositions and methods include the described elements, but do not exclude other elements. When used to define compositions and methods, "consisting substantially of" should mean including the described elements, but excluding other elements that are of any significance to the composition. Thus, a composition consisting substantially of the elements defined herein will not exclude trace contaminants and pharmaceutically acceptable carriers, such as phosphate-buffered saline, preservatives, etc., in methods of separation and purification. "Containing" should mean excluding other components beyond the trace elements and numerous method steps for administering the compositions provided and / or claimed in this disclosure. Examples defined by each of these transitional terms are within the scope of this disclosure.

[0064] A "control" is a surrogate subject or sample used for comparison purposes in an experiment. A control can be "positive" or "negative".

[0065] The “effective amount” of a drug refers to the amount of drug sufficient to provide the desired effect. The “effective” amount of drug will vary from subject to subject, depending on many factors such as the subject’s age and general condition, the specific drug or one or more, etc. Therefore, it is not always possible to specify a quantitative “effective amount.” However, those skilled in the art can determine the appropriate “effective amount” for any subject’s situation using routine experiments. Furthermore, as used herein and unless otherwise explicitly stated, the “effective amount” of a drug may also refer to an amount covering both therapeutic and prophylactic effective amounts. The “effective amount” of a drug necessary to achieve a therapeutic effect can vary depending on factors such as the subject’s age, sex, and weight. Dosing regimens can be adjusted to provide the optimal therapeutic response. For example, several separate doses may be administered daily, or the dose may be reduced proportionally, as indicated by the urgency of the treatment situation.

[0066] A "pharmaceutically acceptable" component can mean a component that is not biologically or otherwise undesirable, meaning that the component can be incorporated into a pharmaceutical formulation provided in this disclosure and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a harmful manner with any other component of the formulation containing the component. When intended for human use, the term generally means that the component has met the required toxicological and manufacturing testing standards, or that the component is included in the Inactive Ingredient Guide established by the U.S. Food and Drug Administration.

[0067] "Pharmaceutically acceptable carrier" (sometimes referred to as "carrier") means a carrier or excipient that can be used to prepare a generally safe and non-toxic pharmaceutical or therapeutic composition, and includes a carrier acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" may include, but are not limited to, phosphate-buffered saline solutions, water, emulsions (such as oil / water or water / oil emulsions), and / or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, or other material known in the art for pharmaceutical formulations and further described herein.

[0068] For example, "pharmacologically active" (or simply "active") in "pharmacologically active" derivatives or analogs can refer to derivatives or analogs that have the same type of pharmacological activity as the parent compound and are substantially equal in degree (e.g., salts, esters, amides, conjugates, metabolites, isomers, fragments, etc.).

[0069] "Therapeutic agent" means any composition having a beneficial biological effect. Beneficial biological effects include: therapeutic effects, such as treating a disease or other undesirable physiological condition; and preventive effects, such as preventing a disease or other undesirable physiological condition (e.g., non-immunogenic cancer). The term also covers pharmaceutically acceptable pharmacologically active derivatives of the beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, etc. When the term "therapeutic agent" is used, or when specifically identifying a particular agent, it should be understood that the term includes the agent itself as well as pharmaceutically acceptable pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0070] The "therapeutic effective amount" or "therapeutic dose" of a composition (e.g., a composition comprising a pharmaceutical agent) refers to the amount that effectively achieves the desired therapeutic outcome. In some embodiments, the desired therapeutic outcome is control of type 1 diabetes. In some embodiments, the desired therapeutic outcome is control of obesity. The therapeutically effective amount of a given therapeutic agent will generally vary depending on factors such as the type and severity of the condition or disease being treated, and the subject's age, sex, and weight. The term may also refer to the amount of therapeutic agent or the rate of delivery of the therapeutic agent (e.g., an amount that varies over time) that effectively promotes the desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary depending on the condition being treated, the subject's tolerance, the pharmaceutical agent and / or pharmaceutical formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of the pharmaceutical agent in the formulation, etc.), and various other factors understood by those skilled in the art. In some cases, the desired biological or medical response has been achieved after administering multiple doses of the composition to a subject over a period of time of days, weeks, or years.

[0071] Throughout this application, various publications have been cited. The disclosures of these publications are hereby incorporated in their entirety by reference to provide a more comprehensive description of the current state of the art to which this invention pertains. For material discussed in sentences upon which the documents are relied, the disclosed references are also individually and specifically incorporated herein by reference.

[0072] B. Composition

[0073] The components used to prepare the disclosed compositions are disclosed, as are the compositions themselves used in the methods disclosed herein. These and other materials are disclosed herein, and it should be understood that while specific references to every different individual and collective combination and arrangement of these compounds are not explicitly disclosed when combinations, subsets, interactions, groups, etc., of these materials are disclosed, each is specifically considered and described herein. For example, if a particular anti-GARP chimeric antigen receptor (CAR) immune cell is disclosed and discussed, and many modifications that may be made to many molecules including anti-GARP CAR immune cells are discussed, then each combination and arrangement of anti-GARP CAR immune cells and possible modifications are specifically considered unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C and a class of molecules D, E, and F are disclosed, and an example of the combination molecule AD is disclosed, then each combination is considered individually and collectively, even if each combination is not described separately, thus implying that combinations AE, AF, BD, BE, BF, CD, CE, and CF are disclosed. Similarly, any subsets or combinations of these are also disclosed. Thus, for example, subgroups AE, BF, and CE are considered to be disclosed. This concept applies to all aspects of this application, including but not limited to the steps in methods of preparing and using the disclosed compositions. Therefore, if multiple additional steps are available, it should be understood that each of these additional steps can be performed using any particular embodiment or combination of embodiments of the disclosed methods.

[0074] Glycoprotein A repeat dominant protein (GARP) is a type I transmembrane protein expressed by activated regulatory T cells (Tregs) and platelets. It binds to and activates multiple isoforms of latent TGFβ in the tumor microenvironment (TME), promoting cancer immune evasion and treatment resistance. Glioblastoma cells have been found to aberrantly express GARP, identifying it as a potential target for immunotherapy. In this paper, we demonstrate that elevated GARP expression in human high-grade gliomas confers a worse overall prognosis and is associated with mesenchymal gene signatures, angiogenesis, immune rejection, and CD8+ expression in the TME. + T cell exhaustion is a contributing factor. Furthermore, we developed a unique anti-GARP chimeric antigen receptor that targets tumor cells but not platelets. T cells stably expressing anti-GARPCAR were shown to be effective against various preclinical models of high-grade glioma in mice without significant toxicity. Therefore, GARP-targeting cell therapy is a promising new treatment for GBM.

[0075] 1. (CAR)-T cell platform for treating glioblastoma

[0076] Based on the expression patterns of key genes including PDGFRA, IDH1, EGFR, and NF1, GBM can be classified into classical, mesenchymal, proneurial, and neural subtypes. Compared to the proneurial or classical subtypes, the mesenchymal subtype exhibits enrichment of tumor-infiltrating immune populations, including regulatory T cells and tumor-associated macrophages. Proneurial GBM shows the highest IDH1 mutation rate and responsiveness to IDH1 inhibitors, while both the proneurial and mesenchymal subtypes have high TP53 mutation rates. The mesenchymal subtype of GBM exhibits the worst overall survival, while the proneurial subtype is associated with better survival and younger patient age. Current standard treatment for newly diagnosed GBM patients includes maximal tumor resection followed by radiotherapy and concurrent temozolomide (TMZ) chemotherapy (Stupp regimen), followed by maintenance therapy using TMZ and tumor therapeutic fields (TTF). Despite extensive research and numerous clinical trials, overall survival (OS) for patients diagnosed with GBM has not significantly improved over the past two decades, particularly for those with disease relapse. Therefore, there is an urgent need for new treatment methods and alternative strategies.

[0077] Genetic engineering of the T-cell receptor (TCR) has led to the idea and development of chimeric antigen receptor (CAR) T-cell therapy (CAR-T), which consists of antigen-specific single-chain variable fragments (scFvs) fused to the T-cell signaling domain and transduced into T cells. These cells can bind tumor-specific antigens without MHC restriction, allowing fully activated CAR-T cells to infiltrate tumors and perform anti-tumor effector functions. To date, most reported clinical successes of CAR-T cell therapy have come from hematologic malignancies; however, ongoing research aims to identify novel antigens to target a range of solid malignancies, including GBM.

[0078] Antigens targeted by CAR-T therapy in GBM include interleukin-13 receptor α2 (IL13Rα2), epidermal growth factor receptor variant III (EGFRvIII), human epidermal growth factor 2 (HER2), and erythropoietin-producing hepatocellular carcinoma A2 (EphA2). Recently, a novel T-cell modality showed a significant but transient response in a phase 1 clinical trial; this modality expresses CARs to target EGFRvIII and secretes T-cell conjugating antibody molecules against wild-type EGFR. Due to various reasons, including antigen escape, no CAR-T product has yet demonstrated a clear and robust benefit for GBM patients in large controlled trials. Because of these limitations, further investigation is needed into tumor antigens that CAR-T therapy can target in GBM.

[0079] Transforming growth factor β (TGFβ) is an important cytokine that is highly expressed in tumors and promotes cancer immune evasion through direct and indirect mechanisms. It promotes the overproduction of collagen by cancer-associated fibroblasts, trapping T cells in the periphery and limiting their ability to kill tumor cells. Furthermore, TGFβ can induce the differentiation of immunosuppressive cell populations that inhibit anti-tumor immunity, such as regulatory T cells (Tregs), M2 macrophages, and myeloid-derived suppressor cells. TGFβ can also directly inhibit CD8 by attenuating cytotoxic gene programs, restricting transport to tumors, and weakening TCR stimulation. + T cell function. Therefore, TGFβ provides an attractive target for immunotherapy. However, long-term inhibition of TGFβ has been shown to cause inflammatory, autoimmune, and cardiovascular side effects, and systemic inhibition via TGFβ traps or small molecule inhibitors of the TGFβ signaling pathway has proven unsuccessful in clinical practice. Therefore, discovering innovative approaches to target and modulate local TGFβ inhibition is of significant strategic importance.

[0080] Depend on LRRC32 The encoded glycoprotein-A repeat dominant protein (GARP) is a cell surface, non-signaling, docking, and activation receptor for latent TGFβ (LTGFβ). Expressed by platelets, activated Tregs, mesenchymal stromal cells, and tumor cells, GARP is an important post-translational regulator of TGFβ biogenesis because it associates with the LTGFβ-related peptide (LAP) to coordinate with integrin and other mechanisms activating LTGFβ. We previously demonstrated that GARP is highly expressed in various primary human solid tumors, such as prostate cancer and non-small cell lung cancer, but not in normal epithelial cells. Zimmer et al. used immunohistochemistry to find elevated GARP expression in GBM, but not in normal brain. Furthermore, we found that GARP expression in mouse Tregs or platelets (both of which infiltrate the TME) was elevated in... Lrrc32The deletion of certain genes enhanced tumor control in colitis-associated colorectal cancer and MC38 colon cancer, respectively. These findings suggest that GARP expression on various cells in the TME may increase the local concentration of active TGFβ, leading to TGFβ-dependent immune evasion. This study led to the development of a humanized anti-GARP monoclonal antibody (PIIO-1), which is currently under consideration for clinical trials. This antibody binds to the LAP binding pocket of GARP and eliminates the GARP-TGFβ signaling axis by blocking the association between LTGFβ and GARP. Since GARP is selectively expressed in GBM but not in the normal brain, we hypothesize that the single-chain variable fragment (scFv) of PIIO-1 can be used to target recurrent GBM by integrating it into a CAR-T platform. In this paper, we investigated the role of GARP in low-grade and high-grade gliomas and report a novel anti-GARP CAR-T therapy with preclinical efficacy and safety against multiple GBM models.

[0081] This article discloses chimeric antigen receptor (CAR) immune cells (including, but not limited to, T cells, B cells, NK cells, NK T cells, or macrophages) containing anti-glycoprotein A repeat dominant protein (GARP) binding molecules. In some aspects, CAR immune cells can be chimeric antigen receptor (CAR) T cells (such as, for example, CD8+). + T cells and / or CD4 + CAR B cells, CAR natural killer (NK) cells, CAR NK T cells, CAR and / or CAR macrophages (CARMA). Immune cells can be genetically engineered to express antigen receptors, such as engineered TCRs. For example, autologous T cells can be modified to express T cell receptors (TCRs) that are antigen-specific to cancer antigens.

[0082] Chimeric antigen receptor

[0083] In some embodiments, the CAR contains an extracellular antigen recognition domain that specifically binds to the antigen. In some embodiments, the antigen is a protein expressed on the cell surface. In some embodiments, the CAR is a TCR-like CAR and the antigen is a processed peptide antigen, such as a peptide antigen of an intracellular protein, which, like a TCR, recognizes on the cell surface in the context of major histocompatibility complex (MHC) molecules.

[0084] In some embodiments, chimeric antigen receptors (CARs) include activating or stimulatory CARs, co-stimulatory CARs (see WO2014 / 055668), and / or inhibitory CARs (iCARs, see Fedorov). et al. , Sci.Transl.Medicine,5(215) (2013). CARs typically include an extracellular antigen (or ligand) binding domain linked to one or more intracellular signaling components, in some respects via a linker and / or transmembrane domain. Such molecules generally mimic or approximate signaling via natural antigen receptors, signaling via such receptors in combination with co-stimulatory receptors, and / or signaling via co-stimulatory receptors alone.

[0085] In some embodiments, the CAR is constructed to be specific to a particular antigen (or marker or ligand), such as an antigen expressed in a specific cell type to be targeted by adoptive therapy. For example Cancer markers, and / or antigens designed to induce an inhibitory response, such as antigens expressed on normal or disease-free cell types. Therefore, CARs typically include one or more antigen-binding molecules in their extracellular portion, such as one or more antigen-binding fragments, domains, or portions, or one or more antibody variable domains, and / or antibody molecules. In some embodiments, a CAR includes one or more antigen-binding portions of an antibody molecule, such as a single-chain antibody fragment (scFv) derived from a variable heavy (VH) and variable light (VL) chain of a monoclonal antibody (mAb).

[0086] In some aspects, antigen-specific binding or recognition components are linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the CAR includes a transmembrane domain fused to an extracellular domain of the CAR. In one embodiment, a transmembrane domain naturally associated with one of the domains in the CAR is used. In some cases, transmembrane domains are selected or modified by amino acid substitution to prevent such domains from binding to transmembrane domains of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex.

[0087] In some embodiments, the transmembrane domain is derived from a natural or synthetic source. In some aspects, when the source is natural, the domain may be derived from any membrane-binding or transmembrane protein. Transmembrane regions include those derived from (i.e., transmembrane regions containing at least) the following: the α, β, or ζ chain of the T cell receptor; CD28, CD3ε, CD45, CD4, CD5, CD5, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154. Alternatively, in some embodiments, the transmembrane domain is synthetic. In some aspects, the synthetic transmembrane domain primarily comprises hydrophobic residues such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan, and valine will be found at each end of the synthetic transmembrane domain.

[0088] CARs typically include at least one or more intracellular signaling components. In some embodiments, a CAR includes an intracellular component of the TCR complex, such as the TCR CD3 that mediates T cell activation and cytotoxicity. + chain, For example The CAR comprises the CD3ζ chain. Therefore, in some aspects, the antigen-binding molecule is associated with one or more cell signaling modules. In some embodiments, the cell signaling module includes a CD3 transmembrane domain, a CD3 intracellular signaling domain, and / or other CD transmembrane domains. In some embodiments, the CAR further includes a portion of one or more additional molecules, such as Fc receptor γ, CD8, CD4, CD25, or CD16. For example, in some aspects, the CAR includes a chimeric molecule of CD3-ζ (CD3-Q) or Fc receptor γ with CD8, CD4, CD25, or CD16.

[0089] In some respects, CARs may further include intracellular co-stimulatory signaling motifs. As used herein, an “intracellular co-stimulatory signaling motif” is defined as a component or domain within an engineered receptor (CAR) that provides additional signaling to T cells upon binding to the target antigen of the engineered receptor. Co-stimulatory motifs are typically derived from native signaling proteins involved in T cell activation, such as CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB. The co-stimulatory motifs used herein enhance T cell proliferation, cytokine secretion, cytotoxicity, and memory formation, thereby ultimately improving the efficacy of CAR therapy. Therefore, this article discloses anti-GARP CARs that further include signaling domains of CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB.

[0090] T-cell therapy and antiplatelet agents can be administered via the same route of administration or via different routes. In some embodiments, T-cell therapy and / or antiplatelet agents are administered intratumorally, intravenously, intramuscularly, subcutaneously, topically, orally, percutaneously, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intracardiaclysm, or intranasally. Effective amounts of T-cell therapy and antiplatelet agents can be administered to prevent or treat disease. The appropriate dosage of T-cell therapy and antiplatelet agents is determined based on the type of disease to be treated, the severity and duration of the disease, the individual's clinical condition, the individual's clinical history and response to treatment, and the attending physician's discretion.

[0091] It should be understood and this article takes into account that the anti-GARP receptor of CAR may include features such as anti-GARP antibodies, antibody fragments (such as, for example, the variable heavy (VH) chain and variable light (VL) chain of ScFv, including the complementarity-determining region (CDR)), and antibody-like particles (such as, for example, GARP-bound nanobodies, biantibodies, bispecific T-cell conjugates (BiTEs), such as those described in Table 1).

[0092] Table 1. GARP CAR ScFv Heavy and Light Chains

[0093] In one aspect, this document discloses CAR immune cells, wherein the anti-GARP binding molecule comprises i) variable heavy chain (VH) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 1, 2, and 3, respectively, and ii) variable light chain (VL) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 4, 5, and 6, respectively.

[0094] This article also discloses CAR immune cells, wherein the anti-GARP binding molecule comprises a V-type antibody against a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The structural domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. L Structural domains. In one aspect, anti-GARP binding molecules contain V as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

[0095] In one aspect, this article discloses CAR immune cells, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO: 9. H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH1VL1), as shown in SEQ ID NO: 9, is V HThe structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO:13 L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3).

[0096] 2. Antibodies

[0097] (1) General antibodies

[0098] The term "antibody" is used broadly herein and includes both polyclonal and monoclonal antibodies. In addition to complete immunoglobulin molecules, the term "antibody" also includes fragments or polymers of those immunoglobulin molecules, as well as human or humanized versions of immunoglobulin molecules or fragments thereof, provided they are chosen based on their ability to interact with GARP. The terms described herein may be used... in vitro The desired activity of the antibody is tested using assays or similar methods, followed by testing according to known clinical testing methods. in vivo Therapeutic and / or prophylactic activity. Human immunoglobulins belong to five main classes: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further subdivided into subclasses (isotypes), such as IgG-1, IgG-2, IgG-3, and IgG-4; IgA-1 and IgA-2. Those skilled in the art will recognize comparable classes in mice. The heavy chain constant domains corresponding to different classes of immunoglobulins are designated α, δ, ε, γ, and μ, respectively.

[0099] As used herein, the term "monoclonal antibody" refers to an antibody derived from a substantially homogeneous population of antibodies, meaning that individual antibodies within the population are identical, except for potentially naturally occurring mutations that may be present in a smaller subset of the antibody molecules. Monoclonal antibodies in this document specifically include "chimeric" antibodies, wherein a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in an antibody derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in an antibody derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, provided they exhibit the desired antagonistic activity.

[0100] The disclosed monoclonal antibodies can be prepared using any procedure for producing monoclonal antibodies. For example, the disclosed monoclonal antibodies can be prepared using hybridoma methods (such as Kohler and Milstein). Nature The method described in 256:495 (1975) is used to prepare it. In the hybridoma method, mice or other suitable host animals are typically immunized with an immunogen to stimulate the production or ability to produce lymphocytes that will specifically bind to the immunogen. Alternatively, it can be prepared by... in vitro Immune lymphocytes.

[0101] Monoclonal antibodies can also be prepared using recombinant DNA methods. The DNA encoding the disclosed monoclonal antibody can be readily isolated and sequenced using conventional methods, such as by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of mouse antibodies. Libraries of antibodies or active antibody fragments can also be generated and screened using phage display technologies, such as those described in U.S. Patent No. 5,804,440 to Burton et al. and U.S. Patent No. 6,096,441 to Barbas et al.

[0102] in vitro The method is also applicable to the preparation of monovalent antibodies. Digesting the antibody to produce its fragments, particularly the Fab fragment, can be accomplished using conventional techniques known in the art. For example, digestion can be performed using papain. Examples of papain digestion are described in WO 94 / 29348, published December 22, 1994, and U.S. Patent No. 4,342,566. Papain digestion of antibodies typically yields two identical antigen-binding fragments (called Fab fragments, each having one antigen-binding site) and a residual Fc fragment. Pepsin treatment yields a fragment with two antigen-binding sites that is still capable of cross-linking the antigen.

[0103] As used herein, the term "antibody or a fragment thereof" encompasses chimeric and hybrid antibodies having dual or multiple antigen or epitope specificity, as well as fragments such as F(ab')2, Fab', Fab, Fv, sFv, scFv, etc., including hybrid fragments. Thus, antibody fragments are provided that retain the ability to bind to a specific antigen. For example, antibody fragments that retain GARP-binding activity are included within the meaning of the term "antibody or a fragment thereof." Such antibodies and fragments can be prepared using techniques known in the art, and specificity and activity can be screened according to the methods described in examples and general methods for generating antibodies and screening for antibody specificity and activity (see Harlow and Lane). Antibodies, A Laboratory Manual .Cold Spring Harbor Publications, New York, (1988)).

[0104] The meaning of "antibody or fragment thereof" also includes conjugates of antibody fragments and antigen-binding proteins (single-chain antibodies).

[0105] Fragments, whether or not attached to other sequences, may also include insertions, deletions, substitutions, or other selected modifications to specific regions or amino acid residues, provided that the activity of the antibody or antibody fragment is not significantly altered or impaired compared to the unmodified antibody or antibody fragment. These modifications can provide additional properties, such as the removal / addition of amino acids capable of forming disulfide bonds, increasing its biological lifespan, altering its secretion characteristics, etc. In any case, the antibody or antibody fragment must possess biologically active properties, such as specific binding to its homologous antigen. The functional or active region of the antibody or antibody fragment can be identified by mutagenesis of a specific region of a protein, followed by expression and testing of the expressed peptide. Such methods are readily apparent to those skilled in the art and may include site-specific mutagenesis of the nucleic acid encoding the antibody or antibody fragment. (Zoller, MJ) Curr.Opin.Biotechnol .3:348-354, 1992).

[0106] As used herein, the term "antibody" can also refer to human antibodies and / or humanized antibodies. Many non-human antibodies (e.g., antibodies derived from mice, rats, or rabbits) are naturally antigenic in humans and may therefore elicit undesirable immune responses when administered to humans. Therefore, the use of human or humanized antibodies in methods reduces the chance of unwanted immune responses induced by antibodies administered to humans.

[0107] (2) Human antibodies

[0108] The disclosed human antibodies can be prepared using any technique. They can also be obtained from transgenic animals. For example, transgenic mutant mice capable of generating a complete human antibody library in response to immunity have been described (see, for example, Jakobovits et al.). Proc.Natl.Acad.Sci.USA , 90:2551-255 (1993); Jakobovits et al., Nature , 362:255-258 (1993); Bruggermann et al., Year in Immunol ., 7:33(1993)). Specifically, antibody reconnection regions (J) in these chimeric and germline mutant mice. (H) Homozygous deletion of the gene resulted in complete suppression of endogenous antibody production, and successful transfer of the human germline antibody gene array into such germline mutant mice led to the production of human antibodies after antigen challenge. Antibodies with the desired activity were selected using the Env-CD4-co-receptor complex as described herein.

[0109] (3) Humanized antibodies

[0110] Antibody humanization techniques typically involve using recombinant DNA technology to manipulate the DNA sequence encoding one or more polypeptide chains of an antibody molecule. Therefore, the humanized form of a non-human antibody (or fragment thereof) is a chimeric antibody or antibody chain (or fragment thereof, such as sFv, Fv, Fab, Fab', F(ab')2, or other antigen-binding portions of an antibody) containing a portion of the antigen-binding site of a non-human (donor) antibody integrated into the framework of the human (recipient) antibody.

[0111] To generate humanized antibodies, residues in one or more complementarity-determining regions (CDRs) of a recipient (human) antibody molecule are replaced with residues from one or more CDRs of a donor (non-human) antibody molecule known to have the desired antigen-binding characteristics (e.g., a certain level of specificity and affinity for the target antigen). In some cases, Fv frame (FR) residues of the human antibody are replaced with corresponding non-human residues. Humanized antibodies may also contain residues that are not present in either the recipient antibody or in the introduced CDR or frame sequence. Generally, humanized antibodies have one or more amino acid residues introduced from a non-human source. In practice, humanized antibodies are often human antibodies, with some CDR residues and possibly some FR residues replaced by residues at similar sites in rodent antibodies. Humanized antibodies typically contain at least a portion of the antibody constant region (Fc), which is typically the constant region of human antibodies (Jones et al.). Nature , 321:522-525 (1986), Reichmann et al., Nature , 332:323-327 (1988) and Presta, Curr.Opin.Struct.Biol .,2:593-596 (1992)).

[0112] Methods for humanizing nonhuman antibodies are well known in the art. For example, they can be derived from the methods of Winter and colleagues (Jones et al.). Nature , 321:522-525 (1986), Riechmann et al., Nature , 332:323-327 (1988), Verhoeyen et al., Science(239:1534-1536 (1988)), humanized antibodies are generated by replacing the CDR or CDR sequence of a rodent with the corresponding sequence of a human antibody. Methods that can be used to generate humanized antibodies are also described in U.S. Patent Nos. 4,816,567 (Cabilly et al.), 5,565,332 (Hoogenboom et al.), 5,721,367 (Kay et al.), 5,837,243 (Deo et al.), 5,939,598 (Kucherlapati et al.), 6,130,364 (Jakobovits et al.), and 6,180,377 (Morgan et al.).

[0113] 3. Delivery of drug carriers / drug products

[0114] As mentioned above, the composition can also be in a pharmaceutically acceptable carrier. in vivo Administration. "Pharmaceutically acceptable" means that the material is not biologically or otherwise undesirable; that is, the material can be administered to a subject together with the nucleic acid or carrier without causing any undesirable biological effects or interacting in a harmful manner with any other component of the pharmaceutical composition containing it. As is well known to those skilled in the art, the carrier will be naturally selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject.

[0115] The composition can be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, in vitro, topically, etc., including topical intranasal administration or inhalation administration. As used herein, "topical intranasal administration" means delivery of the composition to the nose and nasal passages through one or both nostrils, and may include delivery via a nebulization mechanism or droplet mechanism or via aerosolization of a nucleic acid or carrier. Inhalation administration of the composition may be via a spray or droplet mechanism through the nose or mouth. Delivery may also be via intubation to any area of ​​the respiratory system (e.g., the lungs). The exact amount of composition required will vary depending on the subject's species, age, weight and general condition, the severity of the allergic condition being treated, the specific nucleic acid or carrier used, the method of administration, etc. Therefore, it is not possible to specify an exact amount for each composition. However, given the teachings herein, those skilled in the art can determine the appropriate amount using only routine experiments.

[0116] Parenteral administration of the composition (if used) is typically characterized by injection. Injectable formulations can be prepared in conventional forms (liquid solutions or suspensions, solid forms suitable for dissolving or suspending in a liquid prior to injection, or emulsions). Recently revised methods for parenteral administration involve the use of sustained-release or continuous-release systems to maintain a constant dose. See, for example, U.S. Patent No. 3,610,795, which is incorporated herein by reference.

[0117] These materials can be in solution, suspension (e.g., incorporated into microparticles, liposomes, or cells). They can target specific cell types via chimeric antigen receptors. The following references provide examples of using this technique to target specific proteins to tumor tissue (Senter et al., Bioconjugate Chem ., 2:447-451, (1991); Bagshawe, KD, Br. J. Cancer , 60:275-281, (1989); Bagshawe et al., Br. J. Cancer , 58:700-703, (1988); Senter et al., Bioconjugate Chem. , 4:3-9, (1993); Battelli et al., Cancer Immunol. Immunother ., 35:421-425, (1992); Pietersz and McKenzie, Immunolog.Reviews , 129:57-80, (1992); and Roffler et al., Biochem.Pharmacol , 42:2062-2065, (1991)). Mediators, such as "stealth" and other antibody-conjugated liposomes (containing lipid-mediated drugs targeting colon cancer), receptor-mediated DNA targeting via cell-specific ligands, lymphocyte-guided tumor targeting, and in in vivo Highly specific therapeutic retrovirus targeting of mouse glioma cells. The following references are examples of using this technique to target specific proteins to tumor tissue (Hughes et al., Cancer Research , 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). Receptors typically involve constitutive or ligand-induced endocytosis pathways. These receptors aggregate in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through acidified endosomes in which receptors are sorted, and then cycle to the cell surface, becoming stored intracellularly or degraded in lysosomes. Internalization pathways have multiple functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, ligand dissociation and degradation, and receptor-level regulation. Depending on cell type, receptor concentration, ligand type, ligand valence, and ligand concentration, many receptors follow more than one intracellular pathway. This review summarizes the molecular and cellular mechanisms of receptor-mediated endocytosis (Brown and Greene, 1104:179-187, (1992)). DNA and Cell Biology 10:6, 399-409 (1991)).

[0118] a) Pharmaceutically acceptable carrier

[0119] Compositions comprising chimeric antigen receptor immune cells (including, but not limited to, CAR T cells, CAR B cells, CAR NK cells, CAR NK T cells and / or CARMAC cells) may be used in combination with pharmaceutically acceptable carriers for therapeutic purposes.

[0120] Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th Edition) Edited by AR Gennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of pharmaceutically acceptable salt is used in the formulation to make it isotonic. Examples of pharmaceutically acceptable carriers include, but are not limited to, saline, Ringer's solution, and dextran solution. The pH of the solution is preferably from about 5 to about 8, more preferably from about 7 to about 7.5. Other carriers include sustained-release formulations, such as a semi-permeable matrix of a solid hydrophobic polymer containing CAR immune cells, in the form of a molded article, such as a membrane, liposome, or microparticle. It will be apparent to those skilled in the art that certain carriers may be preferred, depending, for example, on the route of administration and the concentration of the composition applied.

[0121] Drug carriers are known to those skilled in the art. These are most typically standard carriers used for administering drugs to humans, comprising solutions such as sterile water, saline, and buffer solutions at physiological pH. The composition can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.

[0122] In addition to the selected molecules, the pharmaceutical composition may also contain a carrier, thickener, diluent, buffer solution, preservative, surfactant, etc. The pharmaceutical composition may also contain one or more active ingredients, such as antimicrobial agents, anti-inflammatory agents, anesthetics, etc.

[0123] Depending on whether local or systemic treatment is required and the area to be treated, the pharmaceutical composition can be administered in many ways. Administration can be local (including ocular, vaginal, rectal, intranasal), oral, inhalation, or parenteral, such as by intravenous infusion, subcutaneous, intraperitoneal, or intramuscular injection. The disclosed CAR immune cells can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavitarily, or transdermally. In one aspect, methods for treating, inhibiting, reducing, diminishing, improving, and / or preventing cancer and / or metastases are disclosed herein, wherein CAR immune cells are in a pharmaceutically acceptable composition. In some specific aspects, the CAR immune cells are administered systemically. In other aspects, the CAR immune cells are administered intratumorally, intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally.

[0124] Parenteral formulations include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions, and may include saline and buffer media. Parenteral media include sodium chloride solutions, Ringer's dextran, dextran and sodium chloride, lactated Ringer's, or fixed oils. Intravenous media include fluids and nutritional supplements, electrolyte supplements (such as those based on Ringer's dextran), etc. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, and inert gases.

[0125] Formulations for topical application may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional drug carriers, aqueous, powdered, or oily bases, thickeners, etc., may be necessary or desired.

[0126] Compositions intended for oral administration comprise powders or granules, suspensions or solutions in aqueous or non-aqueous media, capsules, sacs, or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersants, or binders may be desired.

[0127] Some compositions may be administered in the form of pharmaceutically acceptable acid or base addition salts, which are formed by reacting with: inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanate, sulfuric acid, and phosphoric acid; and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid; or by reacting with: inorganic bases such as sodium hydroxide, ammonium hydroxide, and potassium hydroxide; and organic bases such as monoalkylamines, dialkylamines, trialkylamines, and arylamines, as well as substituted ethanolamines.

[0128] b) Therapeutic uses

[0129] Effective dosages and regimens for administering the composition can be determined empirically, and such determinations are within the scope of the art. The dosage range for administering the composition is sufficiently large to produce the desired effect where the symptoms of the disease are affected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, allergic reactions, etc. Typically, the dosage will vary depending on the patient's age, condition, sex, and severity of the disease, the route of administration, or whether other medications are included in the regimen, and can be determined by a person skilled in the art. In the event of any contraindications, the dosage may be adjusted by an individual physician. The dosage can be varied and may be administered once or multiple times daily for one or more days. Guidance on appropriate dosages for a given class of pharmaceutical products can be found in the literature. For example, guidance on selecting appropriate dosages of CAR immune cells can be found in the literature. Depending on the factors mentioned above, the typical daily dose range for CAR immune cells used alone can be from approximately 1 µg / kg body weight to up to 100 mg / kg body weight or more per day.

[0130] C. Methods of treating cancer

[0131] The disclosed composition can be used to treat any disease in which uncontrolled cell proliferation occurs, such as cancer. A representative but not limited list of cancers that can be treated with the disclosed compositions is as follows: lymphomas, such as B-cell lymphoma and T-cell lymphoma; mycosis fungoides; Hodgkin's disease; myeloid leukemias (including, but not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML)); bladder cancer; brain cancer; cancers of the nervous system; head and neck cancers; squamous cell carcinoma of the head and neck; kidney cancer; lung cancers, such as small cell lung cancer, non-small cell lung cancer (NSCLC), squamous cell carcinoma of the lung (LUSC), and adenocarcinoma of the lung (LUAD); neuroblastoma / glioblastoma; ovarian cancer; pancreatic cancer; prostate cancer; skin cancer; liver cancer; melanoma; squamous cell carcinoma of the oral cavity, pharynx, larynx, and lungs; cervical cancer; cervical cancer (carcinoma); breast cancer, including but not limited to triple-negative breast cancer; genitourinary cancer; lung cancer; esophageal cancer; head and neck cancer; colorectal cancer; hematopoietic system cancer; testicular cancer; and colon and rectal cancer or other malignancies characterized by GARP+ Treg.

[0132] It should be understood and considered in this paper that the disclosed CARs function not only by directing immune cells to GARP+ cancer cells, but also by interacting with Tregs in the tumor microenvironment. Essentially, CD4+ regulatory T cells, marked by the expression of the master transcription factor Foxp3, are crucial for preventing peripheral tolerance. Mice and humans carrying Foxp3 mutations suffer from severe T cell-mediated autoimmune diseases and death. The homeostatic immune tolerance function of Tregs is thought to be mediated by their ability to suppress the initiation of autoreactive T cells via CTLA4, competitive IL-2, and other yet-to-be-identified mechanisms. Under inflammatory conditions, including severe infections and cancer, regulatory T cells are further activated to confer more potent suppressive functions. These so-called activated Tregs (as opposed to resting Tregs) express a new set of molecules both intracellularly and on the cell surface. GARP has been found to be expressed by activated Tregs, not resting Tregs. GARP levels can be induced by T cell receptor activation. Furthermore, GARP+ Tregs have been shown to accumulate in the tumor microenvironment to suppress anti-cancer immunity. The difference in GARP expression between activated Tregs and resting Tregs creates an opportunity for selective targeting of the former. In fact, we have already generated the GARP-targeting antibody PIIO-1 and used PIIO-1 ScFV to prepare T cells expressing a chimeric antigen receptor (CAR) against GARP. In mice, if Tregs are genetically eliminated completely, the mice develop fatal inflammatory symptoms. However, we found that GARP-targeting CAR-T cells only deplete GARP+ Tregs in mice. These animals continue to have GARP-Tregs, which are clearly sufficient to maintain tolerance, and therefore do not develop severe autoimmune diseases. In short, the GARP-targeting approach holds promise for enhancing T cell immunity against cancer by selectively eliminating activated Tregs without impairing tolerance to self-antigens, preserving the homeostatic resting Tregs used to maintain tolerance.

[0133] In one aspect, this document discloses methods for treating, inhibiting, reducing, diminishing, improving, and / or preventing cancers and / or metastases in a subject (such as, for example, GARP-positive (GARP+) cancers and / or cancers containing GARP+ Tregs in the tumor microenvironment, including but not limited to glioblastoma, bladder cancer, breast cancer (such as, for example, triple-negative breast cancer), or leukemia (such as, for example, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML)) or other malignancies characterized by GARP+ Tregs), comprising administering to the subject an effective amount of the subject's CAR immune cells (including but not limited to T cells, B cells, NK cells, NK T cells, or macrophages), said administration comprising administering to the subject any of the anti-GARP chimeric antigen receptor immune cells disclosed herein. For example, in one aspect, this document discloses a method for treating, inhibiting, reducing, diminishing, improving, and / or preventing cancers and / or metastases in a subject (such as, for example, GARP-positive (GARP+) cancers and / or cancers containing GARP+ regulatory T cells (Tregs) in the tumor microenvironment, including but not limited to glioblastoma, bladder cancer, breast cancer (such as, for example, triple-negative breast cancer), or leukemia (such as, for example, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), and chronic myeloid leukemia (CML)) or other malignancies characterized by GARP+ Tregs), comprising administering to the subject an effective amount of the subject's CAR immune cells (including but not limited to T cells, B cells, NK cells, NK T cells, or macrophages), said administration comprising administering to the subject chimeric antigen receptor (CAR) immune cells containing an anti-glycoprotein A repeat dominant protein (GARP) binding molecule. In some respects, CAR further includes CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signal transduction domains.

[0134] As described throughout this document, a major problem with targeting GARP via CAR-T cells is the potential on-target, off-tumor toxicity, which can lead to downregulation of regulatory T cells and platelets that contribute to peripheral immune tolerance, resulting in autoimmune diseases. However, we have found that CAR-T cells targeting GARP only deplete GARP+ Tregs in mice. These animals continue to have GARP-Tregs, which are clearly sufficient to maintain tolerability and therefore do not develop severe autoimmune diseases. Furthermore, targeting Tregs in the TME is an effective therapeutic strategy for other solid tumors because it improves effector T cell infiltration and antitumor immune activity. Therefore, it should be understood and considered herein that GARP-negative cancers can be treated by modulating GARP+ Tregs in the TME using anti-GARP CAR immune cells, thereby reducing Treg immunosuppression. Therefore, in one aspect, this document discloses methods for treating, inhibiting, reducing, diminishing, improving, and / or preventing GARP-related cancers and / or malignancies in subjects, comprising administering to a subject any GARP-targeting CAR immune cells disclosed herein, wherein the TME of the cancer and / or metastatic tumor contains GARP+ Tregs within the TME.

[0135] This article also discloses methods for treating, inhibiting, reducing, decreasing, improving, and / or preventing cancer and / or metastases, wherein the anti-GARP binding molecule of the CAR comprises i) variable heavy chain (VH) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 1, 2, and 3, respectively, and ii) variable light chain (VL) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 4, 5, and 6, respectively.

[0136] In one aspect, this article discloses methods for treating, inhibiting, reducing, diminishing, improving, and / or preventing cancer and / or metastatic tumors, wherein the anti-GARP binding molecule of the CAR comprises a V-type antibody with a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9, or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The structural domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. LStructural domains. In one aspect, anti-GARP binding molecules contain V as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

[0137] This article also discloses methods for treating, inhibiting, reducing, decreasing, improving, and / or preventing cancer and / or metastases, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO: 9. H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH1VL1), as shown in SEQ ID NO: 9, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO:10, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V HThe structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3).

[0138] Similarly, as described throughout this document, a major problem with targeting GARP via CAR-T cells is the potential for targeting and detumescent toxicity, which could lead to downregulation of regulatory T cells and platelets that contribute to peripheral immune tolerance, resulting in autoimmune diseases. However, we found that CAR-T cells targeting GARP only deplete GARP+ Tregs in mice. These animals continue to have GARP-Tregs, which are clearly sufficient to maintain tolerance and therefore do not develop severe autoimmune diseases. Furthermore, targeting Tregs in the TME is an effective therapeutic strategy for other solid tumors because it improves effector T cell infiltration and antitumor immune activity. Therefore, the disclosed anti-GARP CAR immune cells can also modulate immunosuppressive Tregs in the TME.

[0139] Therefore, this article also discloses methods for regulating, reducing, inhibiting, decreasing, and / or blocking immunosuppressive regulatory T (Treg) cells (including, but not limited to, GARP+ Treg) in the tumor microenvironment (TME) of a subject’s cancer (such as, for example, GARP-positive (GARP+) cancer and / or cancers containing GARP+ regulatory T cells in the tumor microenvironment, including but not limited to glioblastoma, bladder cancer, breast cancer, or leukemia or other malignancies characterized by GARP+ Treg), which includes administering a therapeutically effective amount of CAR immune cells (including but not limited to T cells, B cells, NK cells, NK T cells, or macrophages) to the subject. For example, in one aspect, this document discloses a method for regulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells (including, but not limited to, GARP+ Tregs) in the tumor microenvironment (TME) of a subject's cancer (such as, for example, GARP-positive (GARP+) cancer and / or cancers containing GARP+ regulatory T cells in the tumor microenvironment, including but not limited to glioblastoma, bladder cancer, breast cancer, or leukemia, or other malignancies characterized by GARP+ Tregs), comprising administering to the subject a therapeutically effective amount of chimeric antigen receptor (CAR) immune cells (including but not limited to T cells, B cells, NK cells, NK T cells, or macrophages), said CAR immune cells containing an anti-glycoprotein A repeat dominant protein (GARP) binding molecule. In some aspects, the CAR further comprises CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domains.

[0140] In one aspect, this article discloses methods for regulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of cancer, wherein the anti-GARP binding molecule comprises i) variable heavy chain (VH) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 1, 2, and 3, respectively, and ii) variable light chain (VL) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 4, 5, and 6, respectively.

[0141] This article also discloses methods for regulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of cancer, wherein the anti-GARP binding molecule comprises a V-type antibody against a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9, or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The structural domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. L Structural domains. In one aspect, anti-GARP binding molecules contain V as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

[0142] In one aspect, this article discloses methods for regulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of cancer, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO: 9. H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH1VL1), as shown in SEQ ID NO:9, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO:13 L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 12L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3).

[0143] In one aspect, this document discloses methods for treating, inhibiting, reducing, diminishing, improving, and / or preventing cancer and / or metastatic tumors, as well as methods for modulating, reducing, inhibiting, diminishing, and / or blocking immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of cancer, wherein CAR immune cells are in a pharmaceutically acceptable composition. In some specific aspects, the CAR immune cells are administered systemically. In other aspects, the CAR immune cells are administered intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally.

[0144] It should be understood and considered that the disclosed treatment regimens can be used alone or in combination with any anticancer therapy known in the art, including but not limited to: abemaciclib, abiraterone acetate, abitrexate® (methotrexate), ABRAXANE® (paclitaxel albumin-stabilized nanoparticle formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, ADCETRIS® (brentuximab vedotin), ADE, ado-trastuzumab emtansine conjugate, adriamycin® (doxorubicin hydrochloride), afatinib dimaleate, afinitor® (everolimus), Akynzeo® (netupitant), and palonosetron hydrochloride. Hydrochloride), ALDARA® (Imiquimod), Aldesleukin, ALECENSA® (Alectinib), Alemtuzumab, ALIMTA® (Pemetrexed Disodium), ALIQOPA® (Copanlisib Hydrochloride), ALKERAN™ for Injection (Melphalan Hydrochloride), ALKERAN™ Tablets (Melphalan), Aloxi® (Palonosetron Hydrochloride) Hydrochloride, Alunbrig® (Brigatinib), Ambochlorin® (Chlorambucil), Amboclorin® (Chlorambucil), Amifostine, Aminolevulinic acid, Anastrozole, Aprepitant, Aredia® (Pamidronate Disodium), Arimidex® (Anastrozole), Aromasin®Exemestane, Arranon® (Nelarabine), Arsenic trioxide, Arzerra® (Ofatumumab), Asparaginase Erwinia Chrysanthemi, Atezolizumab, Avastin® (Bevacizumab), Avelumab, Axitinib, Azacitidine, Bavencio® (Avelumab), BEACOPP, Becenum® (Carmustine), Belinostat®, Bendamustine Hydrochloride, BEP, Besponsa® (Inotuzumab Ozogamicin), Bevacizumab, Bexarotene, Bexxar® (Bexxar, Tositumomab and Iodine I) 131. Tosimomumab), Bicalutamide, BiCNU® (Carmustine), Bleomycin, Blinatumomab, Blincyto®, Bortezomib, Bosulif® (Bosutinib), Bosutinib, Brentuximab Vedotin, Brigatinib, BuMel, Busulfan, Busulfex®, Cabazitaxel, Cabometyx®Cabozantinib S-Malate, CAF, Camposar® (alemuzumab), Capecitabine, CAPOX, Carac® (fluorouracil-topical), Carboplatin, Carboplatin-Taxol, Carfilzomib, Carmubris® (carmustine), Carmustine implants, Casodex® (bicalutamide), CEM, Ceritinib, Cerubidine® (daunorubicin hydrochloride) Cervarix® (recombinant bivalent HPV vaccine), Cetuximab, CEV, Chlorambucil-Prednisone, CHOP, Cisplatin, Cladribine, Clafen® (cyclophosphamide), Clofarabine, Clofarex® (clofarabine), Clolar® (clofarabine), CMF, Cobimetinib, Cometriq® (cabozotinib malate), Copanlisib hydrochloride Hydrochloride, COPDAC, COPP, COPP-ABV, Cosmegen® (actinomycin D), Cotellic® (cobimetinib), Crizotinib, CVP, Cyclophosphamide, Cyfos® (ifosfamide), Cyramza® (ramucirumab), Cytarabine, Cytarabine liposomes, Cytosar-U® (cytarabine), Cytoxan® (cyclophosphamide), Dabrafenib, Dacarbazine, Dacogen®, Decitabine, Dactinomycin, Daratumumab, Darzalex®Daratumumab, dasatinib, daunorubicin hydrochloride, daunorubicin hydrochloride and cytarabine liposome, decitabine, defibrotide sodium, Defitelio® (defibrotide sodium), Degarelix, and denileukin Diftitox, Denosumab, DepoCyt® (cytarabine liposome), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, Doxil® (doxorubicin hydrochloride liposome), Doxorubicin Hydrochloride, Dox-SL® (doxorubicin hydrochloride liposome), DTIC-Dome® (dacarbazine), Durvalumab, Efudex® (fluorouracil-topical), Elitek® (rasburicase), Ellence® (epirarubicin hydrochloride) Hydrochloride), Elotuzumab, Eloxatin® (Oxaliplatin), Eltrombopag Olamine, Emend® (Aprepitant), Empliciti® (Elotuzumab), Enasidenib Mesylate, Enzalutamide, Epirubicin Hydrochloride, EPOCH, Erbitux® (Cetuximab), Cetuximab, Eribulin Mesylate, Erivedge® (Vismodegib), Erlotinib Hydrochloride, Erwinaze® (Asparaginase Erwinia). chrysanthemi), Ethyol® (Amifostine), Etopophos®,Etoposide phosphate, Evacet® (doxorubicin hydrochloride liposome), Everolimus, Evista® (raloxifene hydrochloride), Evomela® (melphalan hydrochloride), Exemestane, 5-FU® (fluorouracil injection), 5-FU® (fluorouracil for topical use), Fareston® (toremifene), Farydak® (panobinostat), Faslodex® (fullvestrant), FEC, Femara® (letrozole), Filgrastim, Fludara® (fludarabine phosphate) Phosphate, fludarabine phosphate, Fluoroplex® (fluorouracil - topical), fluorouracil injection, fluorouracil - topical, flutamide, Foles® (methotrexate), Foles PFS® (methotrexate), irinotecan (FOLFIRI), irinotecan-bevacizumab (FOLFIRI-BEVACIZUMAB), irinotecan-cetuximab (FOLFIRI-CETUXIMAB), FOLFIRINOX, FOLFOX, Folotyn® (pralatrexate), FU-LV, fulvestrant, Gardasil® (recombinant HPV quadrivalent vaccine), Gardasil 9 (recombinant HPV nonavalent vaccine), Gazyva® (ocinutuzumab), gefitinib, gemcitabine hydrochloride. Gemcitabine-cisplatin, gemcitabine-oxaliplatin, gemtuzumab ozogamicin, Gemzar® (gemcitabine hydrochloride), Gilotrif® (afatinib maleate), Gleevec® (Gleevec®)Imatinib Mesylate, Gliadel® (Carmustine Implant), Gliadel wafer® (Carmustine Implant), Glucarpidase, Goserelin Acetate, Halaven® (Eribulin Mesylate), Hemangeol® (Propranolol Hydrochloride), Herceptin® (Trastuzumab), Bivalent HPV Vaccine, Recombinant HPV 9-valent Vaccine, Recombinant HPV 4-valent Vaccine, Recombinant Hycamtin® (Topotecan Hydrochloride), Hydroxyurea®, Hydroxyurea, Hyper-CVAD, Ibrance® (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, Iclusig® (Ponatinib Hydrochloride), Idamycin® (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Idhifa® (Enasidenib Mesylate), Ifex® (Ifosfamide), Ifosfamide, Ifosfamidum® (Ifosfamide), IL-2 (Aldesleukin), Imatinib Mesylate, Imbruvica® (Ibrutinib), Imfinzi® (Durvalumab), Imiquimod, Imlygic® (Talimogene) Laherparepvec, Inlyta® (axitinib), Inotuzumab Ozogamicin, interferon alpha-2b, recombinant interleukin-2 (aldeleukin), Intron A® (recombinant interferon alpha-2b), iodine I131, tosimomumab and tositumomab, ipilimumab, Iressa®,Gefitinib, Irinotecan Hydrochloride, Irinotecan Liposome Hydrochloride, Istodax® (Romidepsin), Ixabepilone, Ixazomib Citrate, Ixempra® (Ixabepilone), Jakafi® (Ruxolitinib Phosphate), JEB, Jevtana® (Cabazitaxel), Kadcyla® (Trastuzumab-Mestane conjugate), Keoxifene® (Raloxifene Hydrochloride) Hydrochloride), Kepivance® (Palifermin), Keytruda® (Pembrolizumab), Kisqali® (Ribociclib), Kymriah® (Tisagenlecleucel), Kyprolis® (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Lartruvo® (Olaratumab), Lenalidomide, Lenvatinib Mesylate, Lenvima® (Lenvatinib Mesylate), Letrozole, Leucovorin, Leukeran®Chloramphenicol, Leuprolide Acetate, Leustatin® (Cladribine), Levulan® (Aminolevulinic Acid), Linfolizin® (Chloramphenicol), LipoDox® (Doxorubicin Hydrochloride Liposome), Lomustine, Lonsurf® (Trifluorouridine and Tipyrimidine Hydrochloride), Lupron® (Leuprolide Acetate), Lupron Depot® (Leuprolide Acetate), Lupron Depot-Ped® (Leuprolide Acetate), Lynparza® (Olaparib), Marqibo® (Vincristine Sulfate Liposome), Procarbazine® (Procarbazine Hydrochloride) Hydrochloride, nitrogen mustard hydrochloride, medroxyprogesterone acetate, Mekinist® (trametinib), melphalan (Melphalan Hydrochloride), mercaptopurine, mesna, mesnex®, Methazolastone® (temozolomide), methotrexate, methotrexate LPF, methylnaltrexone bromide, Mexate® (methotrexate), Mexate-AQ® (methotrexate), midostaurin, mitomycin C, mitoxantrone hydrochloride. Hydrochloride, Mitozytrex® (mitomycin C), MOPP, Mozobil® (plerixafor), Mustargen® (nitrogen mustard hydrochloride), Mutamycin® (mitomycin C), Myleran® (Busulfan), Mylosar® (azacitidine), Mylotarg® (geltuzumab ozomicin), Paclitaxel Nanoparticles® (paclitaxel albumin-stabilized nanoparticle formulation), Navelbine® (Navelbine®)Vinorelbine tartrate, Necitumumab, Nelarabine, Neosar® (cyclophosphamide), Neratinib Maleate, Nerlynx® (neratinib maleate), Netupitant, Palonosetron Hydrochloride, Neulasta® (pegfilgrastim), Neupogen® (filgrastim), Nexavar® (sorafenib tosylate), Nilandron® (nilutamide), Nilotinib, Nilumet, Ninlaro® (esazozomib citrate), Niraparib tosylate Monohydrate, Nivolumab, Nolvadex® (Tamoxifen Citrate), Nplate® (Romiplostim), Obinutuzumab, Odomzo® (Sonidegib), OEPA, Ofatumumab, OFF, Olaparib, Olaratumab, Omacetaxine Mepesuccinate), Oncaspar® (pegasparase), Ondansetron Hydrochloride, Onivyde® (irinotecan hydrochloride liposome), Ontak® (deniella interleukin), Opdivo® (nivolumab), OPPA, Osimertinib, Oxaliplatin, Paclitaxel, Paclitaxel albumin-stabilized nanoparticle formulation, PAD, Palbociclib, Palivmin, Palonosetron Hydrochloride, Palonosetron Hydrochloride and Netupira, Pamidronate Disodium, Panitumumab, Pabilstat, Paraplat® (carboplatin), Paraplatin® (Paraplatin®),Carboplatin), Pazopanib Hydrochloride, PCV, PEB, Pegaspargase, PEG-FIGRAPH, PEG-Interferon Alpha-2b, PEG-Intron® (PEG-Interferon Alpha-2b), Pembrolizumab, Pemetrexed Disodium, Perjeta® (Pertuzumab), Pertuzumab, Platinol® (cisplatin), Platinol-AQ® (cisplatin), Plexafor, Pomalidomide, Pomalyst® (Pomalidomide), Panatinib Hydrochloride, Portrazza® (Nexusutuzumab), Prandtixa, Prednisone, Procarbazine Hydrochloride, Proleukin® (Adeleukin) Prolia® (denomab), Promacta® (eltrombopag), propranolol hydrochloride, Provenge® (Sipuleucel-T), Purinethol® (mercaptopurine), Purixan® (mercaptopurine), radium-223 dichloro, raloxifene hydrochloride, ramucirumab, raburicase, R-CHOP, R-CVP, recombinant human papillomavirus (HPV) bivalent vaccine, recombinant human papillomavirus (HPV) nine-valent vaccine, recombinant human papillomavirus (HPV) quadrivalent vaccine, recombinant interferon alpha-2b, regorafenib, Relistor® (methylnaltrexone bromide) Bromide, R-EPOCH, lenalidomide®, rheumatrex®, ribociclib, R-ICE, Rituxan®, Rituximab, RituxanHycela®, rituximab and human hyaluronidase, rituximab, rituximab and human hyaluronidase, rorapiram hydrochloride, romidixin, romistachytin, Rubidomycin®, rucaparib camsylate, rucaparib camsylate, ruxolitinib phosphate, ruxolitinib phosphate Phosphate, Rydapt®, Midostaurin, Sclerosol Intrapleural AerosolTalc, cetuximab, Sipuleucel-T, Somatuline Depot® (lanreotide acetate), sonigibril, sorafenib tosylate, Sprycel® (dasatinib), STANFORD V, sterile talc powder, Steritalc® (talc), Stivarga® (regorafenib), sunitinib malate, Sunitinib malate, Sylatron® (pegylated interferon alpha-2b), Sylvant® (cetuximab), Synribo® (homoharringtonine), Tabloid® (thioguanine), TAC, Tafinlar® (darafenib), Tagrisso® (ostinib), talc, Talimogene Laherparepvec, tamoxifen citrate, Tarabine PFS® (cytarabine), Tarceva® (erlotinib hydrochloride), Targretin® (bexarotene), Tasigna® (nilotinib), Taxol® (paclitaxel), Taxotere® (docetaxel), Tecentriq® (atezolizumab), Temodar® (temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid® (thalidomide), Thioguanine, Thiotepa, Tisagenlecleucel, Tolak (fluorouracil - topical), Topotecan hydrochloride, Toremifene, Torisel® (temsirolimus), Tosimomab, and Iodine I 131. Tosimomab, Totect® (dexrazoxen hydrochloride), TPF, Trabectedin, Trametinib, Trastuzumab, Treanda® (bendamustine hydrochloride), Trifluorouridine and Tipyrimidine hydrochloride, Trisenox® (arsenic trioxide), Tykerb® (lapatinib dimethylbenzenesulfonate), Unituxin® (denutuximab), Uric acid triacetate, VAC, Vandetanib, VAMP, Varubi® ( Lorapipram hydrochloride), Vectibix® (panitumumab), VeIP, Velban® (vincrine sulfate), Velcade® (bortezomib), Velsar® (vincrine sulfate), Vemurafenib, Venclexta® (venetoclax), Verzenio® (abemaciclib), Viadur® (leuprolide acetate), Vidaza® (Vidaza®).Azacitidine, Vincristine Sulfate, Vincasar PFS® (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposomes, Vinorelbine Tartrate, VIP, Vimodegi, Vistogard® (Uridine Triacetate), Voraxaze® (Glucopicase), Vorinostat, Votrient® (Pazopanib Hydrochloride), Vyxeos® (Daunorubicin Hydrochloride and Cytarabine Liposomes), Wellcovorin® (Leucovorin), Xalkori® (Crizotinib), Xeloda® (Capecitabine), XELIRI, XELOX, Xgeva® (Denoxinumab), Xofigo® (Radium-223 Dichloro), Xtandi® (Enzalutamide), Yervoy® (Ipilimumab), Yondelis® (trabectedin), Zaltrap® (Ziv-aflibercept), Zarxio® (filgrastim), Zejula® (niraparib tosylate monohydrate), Zelboraf® (vemurafenib), Zevalin® (teimomab), Zinecard® (dexrazoxan hydrochloride), Ziv-aflibercept, Zofran® (ondansetron hydrochloride), Zoladex® (goserelin acetate), Zoledronic Acid, Zolinza® (vorinostat), Zometa® (zoledronic acid), Zydelig® (ederaris), Zykadia® (ceritinib), and / or Zytiga® (abiraterone acetate). Treatment methods may include, or further include, checkpoint inhibitors, including but not limited to, antibodies that block: PD-1 (such as, for example, nivolumab (BMS-936558 or MDX1106), pembrolizumab, cimiprimab, CT-011, MK-3475), PD-L1 (such as, for example, atezolizumab, avelumab, durvalumab, MDX-1105). (BMS-936559), MPDL3280A or MSB0010718C), PD-L2 (such as, for example, rHIgM12B7), CTLA-4 (such as, for example, ipilimumab (MDX-010), trimemumab (CP-675,206)), IDO, B7-H3 (such as, for example, MGA271, MGD009, avorimab), B7-H4, B7-H3, T cell immune receptors with Ig and ITIM domains (TIGIT) (such as, for example, BMS-986207, OMP-313M32, MK-7684, AB-154, ASP-8374, MTIG7192A or PVSRIPO), CD96, B- and T-lymphocyte attenuating factors (BTLA), T cell activation V-domain Ig repressor (VISTA) (such as, for example,JNJ-61610588, CA-170), TIM3 (such as, for example, TSR-022, MBG453, Sym023, INCAGN2390, LY3321367, BMS-986258, SHR-1702, RO7121661), LAG-3 (such as, for example, BMS-986016, LAG525, MK-4280, REGN3767, TSR-033, BI754111, Sym022, FS118, MGD013, and Immutep).

[0145] In some respects, other anticancer agents include TGFβ inhibitors (such as, for example, LY2157299, trabedersen, fresolimumab, LY2382770, lucanix, or PF-03446962).

[0146] Other factors that cause DNA damage and have been widely used to treat cancer include what are commonly referred to as gamma rays, X-rays, and / or the targeted delivery of radioactive isotopes to tumor cells. Other forms of DNA damage have also been considered, such as microwaves, proton beam irradiation (US Patents 5,760,395 and 4,870,287), and UV irradiation. All of these factors are likely to cause extensive damage to DNA, DNA precursors, DNA replication and repair, and chromosome assembly and maintenance. X-ray doses range from long-term (3 to 4 weeks) daily doses of 50 to 200 roentgens to single doses of 2,000 to 6,000 roentgens. Radioactive isotope dose ranges vary considerably and depend on the isotope's half-life, the intensity and type of irradiation emitted, and the uptake by tumor cells.

[0147] Those skilled in the art will understand that additional immunotherapies can be used in combination with or in conjunction with the methods of the embodiments. In the context of cancer treatment, immunotherapy typically relies on the use of immune effector cells and molecules to target and destroy cancer cells. Rituximab (RITUXAN®) is such an example. Immune effectors can be, for example, antibodies specific to certain markers on the surface of tumor cells. An antibody alone can act as an effector of the therapy, or it can recruit other cells to actually influence cell killing. Antibodies can also be conjugated with drugs or toxins (chemotherapeutic agents, radionuclides, ricin A chain, cholera toxin, pertussis toxin, etc.) to act as a target. Alternatively, effectors can be lymphocytes carrying surface molecules that interact directly or indirectly with tumor cell targets. Various effector cells include cytotoxic T cells and NK cells.

[0148] Antibody-drug conjugates have emerged as a breakthrough approach for developing cancer therapies. Cancer is one of the leading causes of death worldwide. Antibody-drug conjugates (ADCs) consist of monoclonal antibodies (MAbs) covalently linked to cytotoxic drugs. This approach combines the high specificity of MAbs against their antigenic targets with highly potent cytotoxic drugs, resulting in "armed" MAbs (carriers) that deliver the payload (drug) to tumor cells with enriched antigen levels. et al. , 2008; Teicher 2014; Leal et al. Targeted drug delivery can also minimize its exposure to normal tissues, thereby reducing toxicity and improving the therapeutic index. The FDA's approval of two ADC drugs—ADCETRIS® (brentuximab vedotin) in 2011 and KADCYLA® (trastuzumab bemtansine or T-DM1) in 2013—validates this approach. Currently, more than 30 ADC candidates are in various phases of clinical trials for cancer treatment (Leal, 2014). et al. (Teicher, 2014). As antibody engineering and adaptor-payload optimization become increasingly sophisticated, the discovery and development of new ADCs increasingly rely on the identification and validation of novel targets suitable for this approach (Teicher 2009) and the generation of targeting MAbs. Two criteria for ADC targets are upregulated / high-level expression in tumor cells and robust internalization.

[0149] In one aspect of immunotherapy, tumor cells must carry some easily targeted markers. Right now Most other cell markers are absent in this study. Numerous tumor markers exist, and any of these markers can be suitable for targeting in the context of this example. Common tumor markers include CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, sialic acid Lewis antigen, MucA, MucB, PLAP, laminin receptor, erb B, and p155. An alternative aspect of immunotherapy is combining anticancer effects with immunostimulatory effects. Immunostimulatory molecules also exist, including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, and γ-IFN; chemokines such as MIP-1, MCP-1, and IL-8; and growth factors such as FLT3 ligand.

[0150] An example of immunotherapy currently under research or in use is immune adjuvants. For exampleMycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (US Patents 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides). et al. (1998); Cytokine therapy, For example Interferon α, β, and γ, IL-1, GM-CSF, and TNF (Bukowski) et al. , 1998; Davidson et al. , 1998; Hellstrand et al. (1998); gene therapy, For example , TNF, IL-1, IL-2 and p53 (Qin et al. Austin-Ward and Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945); and monoclonal antibodies, For example Anti-CD20, anti-ganglioside GM2 and anti-p185 (Hollander, 2012; Hanibuchi) et al. (US Patent 5,824,311, 1998). It is anticipated that one or more anticancer therapies can be used in conjunction with the antibody therapies described herein.

[0151] In some embodiments, immunotherapy may be an immune checkpoint inhibitor. Immune checkpoints are signals in the immune system that are upregulated (…). For example Inhibitory checkpoint molecules that may be targeted by immune checkpoint blockade include adenosine A2A receptor (A2AR), B7-H3 (also known as CD276), B and T lymphocyte attenuation factor (BTLA), cytotoxic T lymphocyte-associated protein 4 (CTLA-4, also known as CD152), indoleamine 2,3-dioxygenase (IDO), cytotoxic cell immunoglobulin (KIR), lymphocyte activation gene 3 (LAG3), programmed cell death 1 (PD-1), T cell immunoglobulin domain and mucin domain 3 (TIM-3), and T cell activation V domain Ig inhibitor (VISTA). In particular, immune checkpoint inhibitors target the PD-1 axis and / or CTLA-4.

[0152] Immune checkpoint inhibitors can be drugs, such as small molecules, recombinant forms of ligands or receptors, or particularly antibodies, such as human antibodies (…). For example International Patent Publication WO2015016718; Pardoll, Nat Rev Cancer,12(4):252-64, 2012; both references are incorporated herein by reference. Known immune checkpoint protein inhibitors or analogues thereof may be used, particularly chimeric, humanized, or human antibodies. As those skilled in the art will appreciate, alternative and / or equivalent names may be used for certain antibodies mentioned in this disclosure. Such alternative and / or equivalent names are interchangeable in the context of this invention. For example, pembrolizumab is also known by the alternative and equivalent names MK-3475 and pembrolizumab.

[0153] In some embodiments, a PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its ligand-binding partner. Specifically, the PD-1 ligand-binding partner is PDL1 and / or PDL2. In another embodiment, a PDL1 binding antagonist is a molecule that inhibits the binding of PDL1 to its binding partner. Specifically, the PDL1 binding partner is PD-1 and / or B7-1. In another embodiment, a PDL2 binding antagonist is a molecule that inhibits the binding of PDL2 to its binding partner. Specifically, the PDL2 binding partner is PD-1. The antagonist may be an antibody, its antigen-binding fragment, an immunoadhesin, a fusion protein, or an oligopeptide. Exemplary antibodies are described in U.S. Patent Nos. US8735553, US8354509, and US8008449, all of which are incorporated herein by reference. Other PD-1 axis antagonists used in the methods provided herein are known in the art, such as those described in U.S. Patent Applications Nos. US20140294898, US2014022021 and US20110008369, all of which are incorporated herein by reference.

[0154] In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody ( For example (Human antibodies, humanized antibodies, or chimeric antibodies). In some embodiments, the anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and CT-011. In some embodiments, the PD-1 binding antagonist is an immunoadhesive (IAD). For example , including fusion into the constant region ( For example The PD-1 binding antagonist is an immunoadhesin (the extracellular or PD-1 binding region of PDL1 or PDL2, which is an immunoadhesin of the Fc region of the immunoglobulin sequence). In some embodiments, the PD-1 binding antagonist is AMP-224. Nivolumab, also known as MDX-1106-04, MDX-1106, ONO-4538, BMS-936558, and OPDIVO ® This is an anti-PD-1 antibody described in WO2006 / 121168. Pembrolizumab, also known as MK-3475, Merck 3475, pembrolizumab, or KEYTRUDA. ®SCH-900475 is an anti-PD-1 antibody described in WO2009 / 114335. CT-011, also known as hBAT or hBAT-1, is an anti-PD-1 antibody described in WO2009 / 101611. AMP-224, also known as B7-DCIg, is a PD-L2-Fc fusion soluble receptor described in WO2010 / 027827 and WO2011 / 066342.

[0155] Another immune checkpoint that can be targeted using the methods presented herein is cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), also known as CD152. The complete cDNA sequence of human CTLA-4 has Genbank accession number L15006. CTLA-4 is found on the surface of T cells and acts as an “off” switch when it binds to CD80 or CD86 on the surface of antigen-presenting cells. CTLA4 is a member of the immunoglobulin superfamily, expressed on the surface of helper T cells, and delivers inhibitory signals to T cells. CTLA4 is similar to the T cell costimulatory protein CD28, and both molecules bind to CD80 and CD86 on antigen-presenting cells, also known as B7-1 and B7-2, respectively. CTLA4 delivers inhibitory signals to T cells, while CD28 delivers stimulatory signals. Intracellular CTLA4 is also found in regulatory T cells and is likely important for their function. T cell activation via T cell receptors and CD28 leads to increased expression of the inhibitory receptor CTLA-4 of the B7 molecule.

[0156] In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody ( For example (human antibodies, humanized antibodies or chimeric antibodies), their antigen-binding fragments, immunoadhesins, fusion proteins or oligopeptides.

[0157] Approximately 60% of cancer patients will undergo some type of surgery, including preventative, diagnostic or staging, curative, and palliative surgeries. Curative surgeries include resection, in which all or part of the cancerous tissue is physically removed, excised, and / or destroyed, and can be used in combination with other therapies, such as the treatments described herein, chemotherapy, radiation therapy, hormone therapy, gene therapy, immunotherapy, and / or replacement therapy. Tumor resection refers to the physical removal of at least part of the tumor. In addition to tumor resection, surgical treatments also include laser surgery, cryosurgery, electrosurgery, and microsurgical control surgery (Moore's procedure).

[0158] After the removal of some or all of the cancerous cells, tissue, or tumor, a cavity may form in the body. Treatment can be performed by perfusion, direct injection, or application of additional anticancer therapy to a localized area. Such treatments can be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. The dosage of these treatments may also vary.

[0159] D. Example

[0160] The following examples are provided to provide a complete disclosure and description of how to prepare and evaluate the compounds, compositions, articles, apparatus, and / or methods claimed herein, and are intended merely as examples and not to limit this disclosure. Efforts have been made to ensure the accuracy of figures (e.g., amounts, temperatures, etc.), but some errors and deviations should be taken into account. Unless otherwise specified, parts are parts by weight, temperatures are in °C or at ambient temperature, and pressures are at or near atmospheric pressure.

[0161] 1. Example 1: Glycoprotein A repeat dominant protein (GARP) is a key contributor to the immunosuppressive microenvironment of gliomas and can be targeted via a novel anti-GARP CAR-T cell platform.

[0162] Gliomas are the most common malignant primary tumors of the central nervous system (CNS), affecting approximately 3.19 people per 100,000 annually in the United States. The prognosis for high-grade gliomas (HGG) remains poor [survival after diagnosis is approximately 1 to 2 years], while low-grade gliomas (LGG) represent an earlier point in the disease's progression. The most well-studied and common form is grade IV astrocytoma, or glioblastoma (GBM), which presents significant challenges to physicians and researchers due to its inherent heterogeneity, low neoantigen burden, and highly immunosuppressive tumor microenvironment (TME).

[0163] Due to the relative failure of gold standard chemotherapy and radiotherapy in improving long-term survival in GBM, many centers have begun developing cell-based therapies that directly target glioma cells. Chimeric antigen receptor (CAR)-T cells have revolutionized immunotherapy research for solid tumors and have been extensively studied in brain tumors. Attempts have been made to target these molecules in GBM that express interleukin-13 receptor α2 (IL13Ra2) or epidermal growth factor receptor variant III (EGFRvIII), but patients relapse due to antigen escape. Recently, CAR-T therapy targeting disialioside ganglioside D2 (GD2) for diffuse midline gliomas has achieved some early success, but some patients still do not respond to either of the above treatments. Due to these limitations, further research is needed on targetable tumor antigens in GBM.

[0164] Glycoprotein A repeat dominant protein (GARP) is a type I transmembrane protein expressed by activated regulatory T cells, platelets, and many types of cancer cells. It is a potent regulator of latent TGFβ activation, not expressed under normal healthy conditions, and is responsible for releasing mature TGFβ from latent-related peptide (LAP) and allowing it to function. It impairs immune invasion of the tumor medulla oblongata (TME) and represents a target for anticancer immunotherapy, and is currently being investigated as a monoclonal antibody therapy in various clinical trials (NCT05822752, NCT03821935, NCT05483530, NCT05606380). Here, we demonstrate that GARP is essential for the tumor biology of both low-grade and high-grade gliomas. We also report a novel anti-GARP CAR-T therapy that demonstrates preclinical efficacy and safety against multiple GBM models.

[0165] a) Results

[0166] (1) High GARP expression in GBM is associated with mesenchymal gene characteristics, increased angiogenesis, worsened T cell depletion characteristics, and poor prognosis.

[0167] GARP is reportedly expressed in GBM cells. Given that the role of GARP in regulating the tumor microenvironment (TME) of solid tumors is well-established, we sought to determine its role in GBM tumor biology. To this end, we pooled and analyzed publicly available RNAseq data from Cancer Genome Atlas (TCGA) to determine the impact of high GARP expression on GBM survival and overall genetic phenotype. First, we explored overall survival based on GARP gene expression from the collected TCGA dataset, where we based our analysis on GARP gene expression (… Lrrc32 Patients were divided into two groups based on GARP expression levels across four GBM subtypes. We found that tumors with high GARP expression exhibited a worse prognosis (Figure 1A). Specifically, the selected TCGA dataset (TCGA-GBM-2013) consisted of 152 patients and was annotated according to five GBM genotype subtypes, including 39 classical subtypes, 49 mesenchymal subtypes, 26 neural subtypes, 29 proneurial subtypes, and 9 other subtypes. After excluding the "other" group due to the limited number of patients, our analysis showed that patients with the highest GARP expression in their tumors had a significantly shorter median overall survival than those with lower GARP expression in the mesenchymal subtype group (Figure 1B, Figures 7A-7D).

[0168] Furthermore, we implemented the previously defined GARP-activating genes (i.e., the nine GARP-TGFβ axis genes) (Fig. 7E), calculated gene activity scores using the GSVA enrichment method, and compared enrichment scores among the four GBM subtypes. Therefore (Fig. 1C and Fig. 7F), we concluded that the mesenchymal group exhibited significantly higher GARP activation function compared to the non-mesenchymal group. TGFβ signaling in gliomas is known to promote myeloid cell development, increase angiogenesis in response to tumor hypoxia, and lead to increased T cell exhaustion; therefore, we sought to evaluate these pathways in our analysis. Based on genomic enrichment analysis, we found that pathways related to angiogenesis, myeloid compartment expansion, T cell characteristics, and T cell exhaustion showed upregulated activity in mesenchymal tumors. Figure 1D and Figure 7G Furthermore, we generated heatmaps to determine the relative gene expression of myeloid compartments between mesenchymal and non-mesenchymal tumors. Figure 1E The study found that genes ITGB2, ITGAM, S100A11, and FCGR2A were upregulated in the former. These genes are associated with the enrichment of tumor-associated macrophages / microglia, the promotion of glioma cell proliferation, lack of response to immune checkpoint blockade, and overall poor prognosis.

[0169] (2) GARP expression in the tumor microenvironment leads to a decrease in CD4 and CD8 T cells and an increase in myeloid cells.

[0170] To further elucidate the role of GARP in GBM TME, we evaluated the presence of GARP in biopsy-confirmed human GBM samples obtained from our institution's pathology department. The basic patient characteristics of these samples are shown in Table 2. Ten tissue sections from these samples were first stained with a series of markers (CD4, CD8, FOXP3, CD11b, GARP) to demonstrate the relative impact of GARP on immune cells in the TME. All 10 GBM samples were found to exhibit heterogeneous GARP expression. Regions with high GARP expression showed significantly reduced lymphocyte infiltration (Fig. 2A), while regions with low GARP expression showed either high lymphocyte immune infiltration indicated by elevated CD4, FOXP3, and CD8 levels (Fig. 2B) or high myeloid infiltration indicated by CD11b expression (Fig. 2C). Based on quantitative analysis of low GARP expression regions (defined as <250 GARP-positive cells per square millimeter) and high GARP expression regions (defined as >250 GARP-positive cells per square millimeter), several differences were observed in the 10 confirmed GBM cases.

[0171] First, the percentage of tumors with high GARP expression was significantly lower, approximately 10% to 12% of the total scan area per tumor (Figure 2D). There was no significant difference in mean tumor cell density between the two categories (Figure 2E). Compared to regions expressing low GARP, regions expressing high GARP showed a higher proportion of CD4 non-Treg (CD4+) cells. - / FOXP3 - ), Treg (CD4) + / FOXP3 + ) and CD8 + The relative percentages of cells were all significantly lower (Figure 2F-). Figure 2I In contrast, CD11b in high GARP regions + The relative number of cells is elevated. Myeloid cells are known to contribute to the progression of HGG, partly due to increased TGFβ signaling in gliomas. Furthermore, as mentioned above, myeloid and T cell compartments tend to be segregated in terms of the overall TME pattern (Figs. 8A–8D). Nearest neighbor analysis of these regions identified that immune cells of the same type tend to cluster closer together than other cell types (i.e., CD4+). + or CD8 + Cells and CD11b + The distance between cells compared to other CD4 cells + or CD8 - (The cells are further apart) (Figure 8E-) Figure 8H ), especially CD8 + T cells and CD4 + T cells showed stronger aggregation in low-GARP regions of the tumor, and cells in these regions were on average closer together than in high-GARP tumors (Fig. 8B). This may be related to the attempt by immune cells to communicate with each other in the highly immunosuppressive TME of GBM.

[0172] To provide additional evidence for GARP expression in gliomas, we obtained 12 paired low-grade glioma (LGG) samples that had progressed to HGG / GBM and were resected twice at our medical center (Table 2). These samples were stained with GARP using our IF protocol. Eleven of the 12 HGG / GBM samples and 12 LGG samples had regions marked as “high GARP” by the segmentation algorithm (Figs. 9A–9C). There was a small but significant difference in the mean proportion of “high GARP” tissue regions between the HGG and LGG samples (Fig. 9D). Furthermore, GARP staining was performed on four commercially available GBM tissue microarrays (Table 2), with approximately 33% of the GBM samples and 50% of the LGG samples showing GARP positivity, compared to a very low percentage of GARP positivity in normal brain tissue. Figure 9E and Figure 9F These data provide evidence that GARP expression is present to varying degrees in the glioma lineage.

[0173] Table 2. Basic characteristics of the patient samples analyzed from Ohio State University

[0174] In summary, the data above indicate that GARP is widely expressed in both LGG and HGG / GBM. GARP also plays a role in shaping the immune compartments of the tumor microenvironment (TME), providing immune rejection signals while simultaneously promoting tumor cell proliferation and inhibiting intercellular signaling by spatially isolating immune cells. However, single antigens expressed by GBM have been known to be targeted in the past, and while initial therapies (IL13Ra2, EGFRvIII) have been successful, tumors often relapse extensively. This is partly due to the ability to downregulate targeting antigens on glioma stem cells, which are the primary cellular niche for glioma recurrence and a significant therapeutic challenge for the disease. Therefore, we sought to determine whether glioma stem cells express GARP in a significant manner.

[0175] (3) GARP expression in glioma stem cells

[0176] To explore the role of GARP in glioma stem cells (GSCs), we first examined the TISCH2 single-cell database. LRRC32 Gene-encoded GARP expression. We found that compared to other GSC markers (e.g., SOX2, CD44, and CD133), LRRC32 The expression was lower ( Figure 10 To further investigate, we evaluated using public ATAC-seq data. LRRC32 Chromatin accessibility. Based on human untreated GSC ATAC-seq data, we observed... LRRC32 The startup subregion is open, indicating that... LRRC32 It can be expressed and can be modulated (Figure 3A).

[0177] We validated the ATAC-seq results at the protein level using multiple IF assays. Using paired samples from patients with both low-grade and high-grade gliomas (Table 2), we performed a set of antibody tests against GARP, CD133, CD44, SOX2, and CD31. Using this set, oligodendrocyte precursor cell-like (OPC-like) GSCs (CD133) could be identified. + / SOX2 + ), mesenchymal sample GSC (CD44) + / SOX2 +) and neovascularization (CD31) + / CD133 + / SOX2 - GARP expression in gliomas. We found that a significant portion of both OPC-like and mesenchymal-like GSCs expressed GARP in both low-grade and high-grade glioma samples (Figures 3B and 3C). Furthermore, approximately half of the newly formed blood vessels expressed GARP. Figure 3D This indicates that anti-GARP therapy not only targets mature tumor cells, but also additionally allows targeting two major types of GSCs and angiogenesis, which is crucial for tumor recurrence.

[0178] (4) Generation and characterization of GARP-CAR T cells.

[0179] Given the data above demonstrating the importance of GARP in the tumor biology of both high- and low-grade gliomas, we hypothesize that targeting GARP is an effective approach to treating this disease and improving prognosis. Considering the relative success of other CAR-T therapies in liquid tumors and the various emerging cell therapies in gliomas and other solid tumors, we sought to focus on creating an anti-GARP chimeric antigen receptor. We first cloned single-chain variable fragments (scFv) derived from our humanized anti-GARP monoclonal antibody PIIO-1 and ligated them to the CD8α hinge / transmembrane domain and the intracellular domains of human 4-1BB and CD3ζ to create our humanized CAR construct (Figure 11A). This humanized CAR was placed in a plasmid, and this construct was used to generate CAR-T cells in mouse and human CAR-T cells via lentiviral transduction. In addition, we created human GARP overexpressing cell lines from U87-MG, CT2A, and GL261 to support experiments in immunocompromised and immunonormal models (hereinafter referred to as U87-WT, U87-hGARP OE, CT2A-WT, CT2A-hGARP OE, GL261-WT, and GL261-hGARP OE). CT2A and GL261 are known models developed from the C57 / BL6 mouse background. Stable human GARP expression was confirmed by immunofluorescence assessment (Figures 11B and 11C). Furthermore, as Li et al. 20 As stated above, we developed and bred homozygous humans from C57BL / 6 mice. Lrrc32 Knock-in mouse line (referred to in this article) hLRRC32 KI Mice), used as immune-normal hosts for tumor and CAR-T cell experiments. hLRRC32 KI The mouse line is an endogenous mouse Lrrc32 GARP was expressed under the control of the promoter (Fig. 11D), and the staining pattern in the brain was similar to that seen in microarrays of healthy, normal human tissue. Figure 11E ).

[0180] (5) PIIO-1 CAR T cells in in vitro It exhibits antigen-specific activity against GBM cells.

[0181] To confirm the effectiveness of PIIO-1 CAR-T against GARP + To investigate tumor cell function, we tested whether chronic antigen stimulation could specifically enhance the proliferation and expansion of PIIO-1 CAR-T cells (Figure 4A). To this end, mouse CAR-T cells were co-cultured in vitro with wild-type or GARP-overexpressing irradiated mouse glioma cells for 14 days, with the CAR-T cells moved to new plates every 48 hours. Repeated stimulation with GARP-expressing cells did indeed allow T cells to continue expanding, while the lack of antigen stimulation to T cells resulted in culture growth arrest. Proliferated CAR-T cells were also harvested to study GARP. + CAR enrichment upon contact with tumor cells. Compared to CAR-T cells co-cultured with antigen-negative glioma cells, CAR-T cells enriched with GARP. + Tumor cell exposure increased the CAR-T positive population from 50% to 85% on day 14 (Figure 4B).

[0182] Next, we examined whether PIIO-1 CAR-T cells could reliably recognize GARP on glioma cells to induce cytotoxicity. To this end, we cultured U87-WT (with native GARP expression) and U87-hGARP OE cells at different effector-target ratios in the presence of CAR-T cells. We also performed experiments simultaneously using empty vector-transduced T cells (hereafter referred to as EV-T cells). Tumor cell killing was significantly higher in U87-hGARP OE cells than in U87-WT cells, indicating that the CAR-T cells used were stimulated by GARP on the surface of human GBM cells (Fig. 4C). To ensure successful expression of functional CAR in our mouse T cells, we performed the same experiments in the CT2A and GL261 cell lines. Compared to target antigen-negative mouse GL261 and CT-2A cells, our mouse PIIO-1 CAR-T cells effectively eliminated only cells with high levels of GARP expression. To further confirm antigen-specific CAR-T cell activation, the six cell lines were individually co-cultured with appropriate species of PIIO-1 CAR-T cells for 24 hours. Subsequently, the levels of secreted cytokines (IL-2, IFN-γ, and TNF-α) in the cell culture medium were measured by enzyme-linked immunosorbent assay (ELISA). Both human and mouse CAR-T cells significantly produced cytokines in response to GARP-expressing GBM cells, while having no substantial effect on cell lines not expressing the target antigen. Figure 4DIn summary, PIIO-1 CAR-T cells exhibited cytolytic activity, cytokine production, and specific proliferation in response to target antigen stimulation in vitro.

[0183] (6) Anti-GARP CAR T cells are safe in relevant preclinical models and have shown efficacy against human GBM in xenograft mouse models.

[0184] Our anti-GARP PIIO-1 antibody does not recognize GARP on platelets because, unlike tumor cells and Tregs, the GARP epitopes on platelets are inaccessible to the antibody due to their pre-association with LTGFβ. To ensure the overall safety of the anti-GARP-CAR-T approach, we will next... hLRRC32 KI Any potential targeting / detumescent toxicity of PIIO-1 CAR-T was evaluated in mice (Figure 5). We evaluated the effects of 5 Gy total body irradiation (TBI) on non-tumor-bearing, lymphoblastic mice. hLRRC32 KI Infusion of 1x10 in mice 6 PIIO-1 CAR-T cells and functional control CAR-T (EGFRvIII) cells were administered to mice. Mouse body weight, mortality, and serum / tissue parameters were monitored until 60 days post-infusion. No significant weight loss or mortality was observed between the PIIO-1 CAR-T and EGFRvIII CAR-T groups (Figs. 5A and 5B), nor were changes in platelet count observed (Fig. 5C). Finally, to further ensure safety, serum cytokine levels were assessed 1–3 weeks post-infusion to assess any increase in baseline inflammation. CAR-T cell activation typically induces cytokine release syndrome (CRS) by inducing key pro-inflammatory cytokines such as interleukin-6 (IL-6) and interferon-γ (IFN-γ). As shown in Fig. 5D, serum levels of IL-6 and IFN-γ did not show significant differences between the two groups. In conclusion, PIIO-1 CAR-T cells are safe in non-tumor-bearing, syngeneic human GARP knock-in mice.

[0185] Next, in order to evaluate the efficacy of PIIO-1 CAR T cells in vivo... , We performed xenograft tumor implantation in Nod-scid-γ mice (NSG, Jackson Laboratories). Each NSG mouse received 5 × 10⁻⁶ tumor grafts. 4U87-hGARP-OE tumor cells expressing luciferase (U87-hGARP-OE) were implanted into the right hemisphere of the brain at a volume of 2 μL, as described in the method. Five to seven days post-implantation, the tumor was confirmed by in vivo chemiluminescence imaging (IVIS), and then injected intratumorally with 1 x 10-1 luciferase-expressing U87-hGARP-OE cells. 6 One PIIO-1 CAR-T (CAR-based) + Mice (n=10 / group) were treated with empty vector-transduced T cells (EV-T) at a percentage or equivalent total dose (Figure 5E). Compared with mice injected intracranially with EV-T cells, we observed a significant improvement in tumor burden in mice implanted with PIIO-1 CAR-T cells via differences in total tumor luminescence. The significant reduction in tumor burden led to a substantial improvement in survival curves; the median survival in the PIIO-1 CAR-T treatment group had not yet been reached, while it was 55 days in the EV-T group. Figure 5F We also sacrificed mice upon reaching the removal criteria or 100 days after CAR-T cell engraftment and performed H&E staining and GARP immunofluorescence to assess tumor cell burden (Figure 5G). Mice receiving EV-T cells still exhibited significant tumor burden, as indicated by GARP expression in necrotic and dilated tumor areas, while mice receiving PIIO-1 CAR-T cells showed little or no GARP expression. In summary, these experiments demonstrate that PIIO-1 CAR-T cells can effectively eliminate human GBM in an orthotopic mouse model.

[0186] (7) Anti-GARP CAR-T cells safely prolonged the survival of GBM mice in an intracranial immunocompetent model.

[0187] After confirming the successful activation and therapeutic effect of our PIIO-1 CAR-T cells on tumor cells in an immunodeficient mouse model, we sought to evaluate their efficacy in immunocompetent syngeneic mice. hLRRC32 KI Effectiveness in mouse models. We first used 1x10... 5 CT2A-hGARP cells were implanted hLRRC32 KI In mice, tumors were allowed to grow for 2 weeks. We confirmed tumor presence via IVIS and randomly assigned mice based on tumor size to receive either CAR-T or EV-T, and treated them with 5 Gy of TBI. They then received 2x10 [units of technology] on day 14 post-tumor implantation. 5 CAR + PIIO-1 CAR-T cells (total 1.3 x 10⁻⁶) 6Mice receiving PIIO-1 CAR-T therapy showed 100 T cells and were followed up weekly for IVIS measurements of complete blood cell count, body weight, and tumor volume (Figure 6A). Tumor growth in mice receiving PIIO-1 CAR-T therapy ceased, with some tumors shrinking at 1 week post-CAR-T IVIS imaging (Figure 6B). This effect persisted into the second week. This contrasts with EV-T mice, which all showed progression. At 1 and 2 weeks post-treatment, total luminescent counts differed significantly between groups, with EV-T mice showing a significantly greater increase in tumor burden than CAR-T mice (Figure 6C). Furthermore, PIIO-1 CAR-T mice exhibited significantly prolonged survival, with a median overall survival of 37 days post-treatment compared to 21 days (p<0.0001, log-rank test).

[0188] Regarding safety, compared to EV-T, PIIO-1 CAR-T mice exhibited a stable weight gain curve within 21 days post-treatment, while EV-T mice showed a sharp decline due to tumor progression (p<0.0001, mixed-effects model) [Figure 6E]. Furthermore, when measuring white blood cells and platelets in the blood, an initial decrease compared to baseline was observed due to irradiation, but the recovery rates of these two parameters were similar in both the PIIO-1 CAR-T and EV-T groups (Figure 6F and 6E). Figure 6G These data collectively demonstrate that PIIO-1 CAR-T proliferation did not adversely affect platelet count or bone marrow recovery in the post-treatment period. Finally, in an independent experiment, we isolated tumor-infiltrating immune cells from the PIIO-1 CAR-T treatment group and the control group. We also analyzed CD4... + (Including Treg) and CD8 + T cells were analyzed by high-dimensional flow cytometry. Our data showed that anti-GARP-CAR-T significantly reduced activated Tregs and increased effector CD8+ T cells [data to be included]. Overall, anti-GARP CAR-T cells are safe and can prolong survival in syngeneic, immunocompetent human GBM models.

[0189] b) Discussion

[0190] The scale and indications of cellular immunotherapy continue to expand, with solid tumor targets gaining attention in each new iteration. Optimal target antigens are those that are crucial for tumor biogenesis and promote immunosuppressive tumor microenvironments (TMEs). Glioblastoma and high-grade gliomas are excellent candidates for novel CAR-T cell therapy targeting specific antigens due to their difficult-to-treat nature and the generally poor outcomes of current therapies. Our data suggest that GARP is a suitable target antigen for CAR-T therapy in solid tumors due to its unique combination of importance for glioma immunosuppression / proliferation and low peripheral expression under healthy conditions.

[0191] A major problem with targeting GARP via CAR-T cells is the potential targeting-and-detumescent toxicity, which can lead to downregulation of regulatory T cells and platelets that contribute to peripheral immune tolerance, resulting in autoimmune diseases. However, we found that CAR-T cells targeting GARP only deplete GARP+ Tregs in mice. These animals continue to have GARP-Tregs, which are clearly sufficient to maintain tolerance and therefore do not develop severe autoimmune diseases. Furthermore, targeting Tregs in the TME is an effective therapeutic strategy for other solid tumors because it improves effector T cell infiltration and antitumor immune activity. Moreover, the scFv construct of our CAR can only target free GARP that is not bound to LAP, a conformation limited to activated Tregs and not seen in soluble GARP or platelet GARP. Additionally, in our healthy... hLRRC32 KI In mice, high-dose PIIO-1 CAR-T infusion (Figure 5) did not cause adverse tumor-reducing side effects within 6 weeks, and no significant bias was observed in platelet or white blood cell count recovery in any mouse in the CAR-T-bearing cohort (Figure 6). These data suggest that the use of anti-GARP CAR-T cells will be safe in human patients.

[0192] Due to the difficulty in crossing the blood-brain barrier, CAR-T cells initially struggled to play a role in the treatment of brain tumors. Many initial clinical experiences with anticancer therapies involved methods to open the blood-brain barrier, such as using high-intensity ultrasound or irradiation. However, patient adherence to complex treatment regimens can affect overall efficacy, and the delivery of therapeutic agents is crucial for CAR-T therapy. Therefore, the optimal delivery route for CAR-T cells used to treat brain tumors remains an open question. Although several ongoing CAR-T clinical trials for GBM treatment [e.g., NCT01109095, NCT01454596, NCT02844062, NCT02209376] deliver CAR-T cells via intravenous infusion, recent studies have shown that direct intrabrain administration of CAR-T cells demonstrates superior efficacy and excellent tolerability, with minimal off-target toxicity. This includes a significantly reduced incidence of cytokine release syndrome and CAR-T neurotoxicity when cells are delivered into the brain. Furthermore, the convenience of subcutaneous repositories and the elimination of the need for pre-infusion lymph node dissection improve patients' quality of life and reduce additional complications associated with extremely low WBC counts. Our data show that direct implantation of anti-GARP CAR-T cells into the brain does not reduce efficacy, further demonstrating the applicability of this delivery route to brain tumors.

[0193] Given the continued lack of progress in HGG / GBM therapy in recent decades, unique targets represent a new avenue that must be explored. GARP expression in glioma cells and regulatory T cells within TME suggests that CAR-T therapy can play a role in multiple ways and has a multi-pronged mechanism of action. Even more excitingly, GARP is expressed in glioma stem cells and new blood vessels, as shown by ATAC-seq and immunofluorescence (Figure 3). Figure 10 This means that targeting GARP can effectively attack the niche for glioma recurrence and the blood supply to growing tumors. Due to these characteristics, we suggest that GARP will evolve into an important target for glioma immunotherapy. Our PIIO-1 CAR-T cells possess a novel CAR structure that exhibits excellent in vivo activity against GARP on glioma cells and Tregs, representing a translationally-driven drug that can be used to improve outcomes in GBM patients.

[0194] c) Method

[0195] (1) TCGA data collection

[0196] Gene expression matrix values ​​were obtained from the Cancer Genome Atlas (TCGA) using RNA-seq data available in the cBioPortal database, specifically the TCGA-GBM-2013 dataset. LRRC32 The high group consists of the top 10% LRRC32 Expressing definition, and LRRC32 The lower group consists of the bottom 10% LRRC32 Expression definition.

[0197] (a) Downstream analysis

[0198] Regarding unstratified and stratified GBM subtypes, Kaplan-Meier curves were used to... LRRC32 High group and LRRC32 lower group Of Survival was visualized. Log-rank test was used to quantify significance. GSVA enrichment scores were performed on each sample for the GARP activation pathway defined in Figure 7E using the GSVA package (v.1.49). Wilcoxon rank-sum test was used to calculate p-values ​​to compare GARP pathway activity scores between the mesenchymal and non-mesenchymal groups. GSEA enrichment analysis of angiogenesis, myeloid compartments, T cell characteristics, and T cell exhaustion in the TCGA-GBM-2013 dataset was performed using the desktop GSEA software (v.4.3.2) at default settings.

[0199] (b) GSC ATAC-seq data collection and visualization

[0200] The human GSC ATAC-seq dataset in bigwig format aligned to the hg19 reference genome was downloaded from GSE163853, and 12 samples from individuals who had not received oncology treatment were selected, including U3005MG-1, U3005MG-2, U3008MG-1, U3008MG-2, U3046MG-1, U3046MG-2, U3056MG-1, U3056MG-2, U3164MG-1, U3164MG-2, U3085MG-1, and U3085MG-2. The collected bigwig data were visualized using the hg19 reference genome with Integrative Genomics Viewer (IGV, v.2.4.1).

[0201] (2) Cell lines and culture methods.

[0202] Human glioblastoma U87-MG cell line was obtained from the American Type Culture Collection (ATCC® HTB-14™ Manassas, VA). Mouse glioma cell line GL261 was obtained from the NCI Tumor Resource Bank (Frederik, MD). CT-2A mouse cell line derived from malignant astrocytoma was purchased from EMD Millipore (catalog number: SCC194, Burlington, MA). All cells were cultured in Dulbecco modified Eagle medium (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin. For cell lines containing puromycin-dependent cassettes, puromycin from Gibco (catalog number: A1113803) was added to the solution at a concentration of 1 μg / mL to ensure selection of cells expressing the cassette.

[0203] (3) Construction of lentiviral vectors.

[0204] The lentiviral vector backbone plasmid (pLenti-PIIO-1-CAR in this paper) was generated by modifying Addgene's pLentiCMV / TO Hygro empty (w214-1), plasmid #17484, as follows. In short, the CMV promoter was replaced with the human elongation factor-1α (EF-1α) promoter, and the marmot hepatitis virus posttranscriptional regulatory element WPRE was replaced with a 50-mer sequence (GTGACGAACATGGGGCAGATTGCTTCCAGTGCTTGCTGGGCATTGCTGAT) (SEQ ID NO: 14) to increase transgene expression (synthesized by GeneScript, Piscataway, NJ). Finally, unnecessary selection markers (hygromycin) and their promoters were removed from the original pLenti CMV / TOHygro vector. Our lab's monoclonal antibody targeting human GARP (clone, 4D3) (anqi paper) was first humanized and renamed PIIO-1 (AbStudio, Hayward, CA 94545 USA). A synthetic oligonucleotide encoding the GGGGSGGGGSGGGGS (SEQ ID NO: 15) amino acid linker sequence was used to ligate VH and VL DNA sequences to generate PIIO-1 scFv. In short, PIIO-1 scFv is linked to the CD8a hinge and transmembrane domain, and its intracellular signaling domain contains a co-stimulatory domain composed of 4-1BB and CD3ζ domains. Subsequently, a second-generation PIIO-1 scFv CAR-encoding sequence was synthesized via GeneScript and then cloned into the XmaI / PacI site of the pLenti-EF1α vector. To generate a cell line overexpressing GARP, the human GARP gene was amplified from a shuttle plasmid and subcloned into the NheI / BstBI site of Addgenes' pLJM1-EGFP (plasmid #19319) by replacing the EGFP gene.

[0205] (4) Use lentiviruses to generate human and mouse GARP CAR T cells.

[0206] The two plasmids were a gift from Bob Weinberg (Addgene plasmids #8454 and #8455).To generate lentivirus, HEK293FT cells (ThermoFisher Scientific, Waltham, MA) were transfected with Addgene's pCMV-VSV-G (plasmid #8454), pCMV-dR8.9 (plasmid #8455), and pLenti-EF1α-scFv (PIIO-1)-CAR using TransIT-293 transfection reagent (Mirus Bio LLC, Madison, WI) or Lipofectamine 3000 (ThermoFisher Scientific, Waltham, MA). 24 hours post-transfection, the medium on the HEK293FT cells was replaced with fresh medium to remove the transfection reagent. 72 hours post-transfection, the lentivirus medium was filtered through a 0.45 μm filter. The supernatant was then concentrated using Amicon virus concentrating ultrafiltration centrifugation in 100 kDa tubes (Merck Millipore, Burlington, MA) at 1,200 g for 15 minutes at 4°C. Freshly collected concentrated viral supernatant was centrifuged at 800g for 90 minutes at 32°C for rotational transduction. For human T cell transduction, peripheral blood mononuclear cells (PBMCs, obtained from delabeled healthy donors according to an institutional review board approved protocol) were first isolated using Ficoll-Paque density gradient centrifugation in 50 ml SepMate™ tubes (Stemcell Technologies, Vancouver, Canada). Uncontaminated T cells were then enriched using the Pan T Cell Isolation Kit (Miltenyi Biotec, Auburn, CA). The isolated T cells (5 × 10⁶) were then... 6T cells were resuspended in 3 ml of medium per well of a 6-well plate and stimulated overnight with a 1:1 ratio of CD3 / CD28 beads (LifeTechnologies, Carlsbad, CA) and IL-2 (Peprotech, Rocky Hill, NJ, 100 U / ml). Next, the medium (2 ml / well) was gently removed without disturbing the aggregated T cells, and 1 ml of freshly concentrated pLenti-PIIO-1-CAR viral particles was added (finally 3 ml / well). The T cells were then cultured with the lentivirus in TexMAX cell culture medium (Miltenyi Biotec) containing 10% fetal bovine serum and IL-2 (100 U / ml) for 24 hours. For the generation of mouse CAR-T cells, mouse T cells were first isolated from the spleen of C57BL / 6 mice using a mouse T cell-specific isolation kit (Miltenyi Biotec, catalog number 130-095-130). A similar transduction procedure was followed. The generated mouse CAR-T cells were maintained in TexMAX cell culture medium (Miltenyi Biotec) containing 5% FBS (Sigma), IL-2 (100 U / ml), IL-7 (10 ng / mL), and IL-15 (10 ng / mL). Three days after transduction, the percentage of CAR-T positive cells was determined by flow cytometry.

[0207] (5) Flow cytometry analysis.

[0208] To detect CAR expression, 1 × 10⁻⁶ cells transduced with the empty pLenti-EF1α vector were first harvested. 6 CAR-T or control T cells were collected and washed twice with 1 ml of ice-cold 1× PBS containing 4% bovine serum albumin (BSA). After washing, the cells were resuspended in 0.2 ml of ice-cold wash buffer and incubated with a protein L-PE conjugate (AcroBioSystems, Newark, DE) at 4°C for 30 min. To detect CD4 and CD8 surface antigens, CD4 antibody conjugated with allophycocyanin Cyanine7 (APC-Cy7, Biolegend) and CD8 antibody conjugated with phycoerythrin Cyanine7 (PE-Cy7, eBiosciences) were added. To detect human GARP surface expression in GBM cell lines, cells were stained with a GARP antibody conjugated with phycoerythrin (PE, Biolegend). Fluorescence data for all samples were collected using a Cytek Aurora flow cytometer, and all data were analyzed using FlowJo software.

[0209] (6) Cytotoxicity and proliferation assays.

[0210] The ability of GARP-specific CAR-T cells to kill targets was tested in a luciferase-based 24-hour kill assay. All cell lines (U87, GL261, and CT-2A) were engineered to stably express firefly luciferase (Cellomics Technology, Hallethorpe, MD, USA). These engineered cell lines served as targets for the kill assay. Briefly, effector cells (CAR-T or control T cells) and luciferase-expressing target cells were mixed at a specified effector-to-target ratio and incubated in 96-well flat-bottom plates with 5 × 10⁻⁶ cells / well. 4 Target cells were cultured overnight in T-cell medium at a total volume of 200 μl per well. Target cells were seeded individually at the same cell density to determine maximum luciferase expression (relative light units; RLUmax). After 24 hours, 100 μl of supernatant was removed from each well, and 100 μl of luciferase substrate (Bright-Glo, Promega) was added to the remaining supernatant and cells. After five minutes of incubation, emission was measured using a Spectra Max ID5 plate reader (Molecular Devices, San Jose, CA). Lysis was determined as [1 – (RLU sample) / (RLUmax)] × 100. Two independent experiments were performed, and each experiment was repeated in duplicate. For proliferation assays, mouse GBM tumor cells were first irradiated (2,000 rads) and seeded at 2.5 × 10⁶ cells per well. 5 10 T cells were seeded into 24-well plates. 6 The cells were added to a medium containing 5% FBS and 100 IU / ml human IL-2 and cultured for one week. T cells were divided to maintain an appropriate density and restimulated weekly with tumor cells. T cell counts were determined every 3 or 4 days using a TC20 cell counter (Bio-Rad, Hercules, CA, USA) with trypan blue for two weeks. After two weeks, the percentage of CAR-T cells was quantified by flow cytometry.

[0211] (7) Cytokine ELISA.

[0212] In the absence of cytokines, 5 × 10⁶ cells per well were introduced into 96-well flat-bottom plates in a final volume of 200 μl of T cell culture medium. 4 CAR-T or control T cells per well, 5 × 10⁶ cells per well 4Target cells were co-cultured in triplicate for cytokine release assays. After 16–18 hours, IL-2, IFN-γ, and TNF-α in the co-culture supernatant were measured using individual ELISA kits, following the manufacturer’s instructions (R&D Systems, Minneapolis, MN).

[0213] (8) Single immunohistochemistry – cell culture

[0214] When validating GARP antibodies in an immunofluorescence imaging system, slides were prepared using freshly fixed cell cultures. Briefly, cells from each cell line (CT-2A, CT-2A-hGARP, GL261, GL261-hGARP, U87, U87-hGARP, and DBTRG) were grown on sterile cell culture plates in appropriate media, seeded at 100,000 cells / compartment. These cells were grown until they reached 80%–90% confluence, at which point they were fixed on the culture plates with 10% neutral buffered formalin for 15 minutes. The cells were then placed in permeabilization buffer (1x Tris-buffered saline (TBS) with 1% Tween-20 [TBST]) for 20 minutes, followed by blocking buffer (1x TBS, 5% normal goat serum, 2% bovine serum albumin, and 0.3% Triton-X100) for 60 minutes. Subsequently, endogenous peroxide quenching was performed with 3% H2O2 in ddH2O for 8 minutes. After surrounding the tissue with a hydrophobic barrier pen, the slide was placed on the hydration chamber. The primary antibody against GARP (Enzo ALX-804-867-C100, clone PLATO-1) was prepared at a concentration of 1:500 in Opal / Antibody dilution buffer (Akoya Biosciences, catalog number ARD1001EA) and placed on the slide for 60 minutes. The slide was then washed three times on a shaker in TBST for 2 minutes each time. The slide was returned to the hydration chamber, and the secondary antibody (SignalStain® Boost IHC assay reagent, CellSignaling Technology) was placed on the slide for 10 minutes at room temperature. The slide was then washed three times on a shaker in TBST for 2 minutes each time, and then returned to the hydration chamber. At this point, opal fluorophore 570 (Akoya Biosciences) was diluted 1:200 in 1x amplification dilution buffer (Akoya Biosciences, catalog number FP1488001KT), placed on a slide, and incubated at room temperature for 8 minutes, followed by three washes with TBST. Finally, the slide was incubated at room temperature for 7 minutes in 1:15000 nuclear counterstain (Hoechst 33342, trihydrochloride, trihydrate; Invitrogen). The slide was then washed with TBST x2 and ddH2O x2, the hydrophobic barrier pen was removed with a cotton tip applicator soaked in xylene, and the slide was mounted with Invitrogen Slow Fade Gold mounting reagent and covered with Fisher Finest coverslips.The slides were then stored overnight in the dark at room temperature and scanned on the Akoya Vectra Polaris fluorescence microscope system, with the exposure time referenced based on the U87-hGARP cell line used for all cell line images. Snapshots were taken at 20x magnification using the Akoya Phenochart image viewer (Akoya Biosciences).

[0215] (9) Multiple immunohistochemistry – FFPE slides

[0216] Paraffin-embedded slides of known low-grade gliomas, high-grade gliomas, and glioblastomas were obtained from the Department of Pathology at Ohio State University via a collaborative IRB (OSU IRB# 2020C0062). Informed consent was not required for the use of these samples due to the deidentifying, retrospective nature of the review and the fact that no identifiable health information is retained. Basic patient characteristics are listed in Table 2. They were paraffin-embedded according to standard operating procedures of the medical center's histology laboratory. Additional samples were obtained from commercially available tissue microarrays (USBiomax Inc.). Mouse samples were obtained from our in vivo experiments.

[0217] First, the slides were baked on a hot plate at 60°C for 1-2 hours, then dewaxed by immersion in xylene, rehydrated via an alcohol-water gradient, and then washed with water. Next, antigen retrieval was performed in pH 9 EDTA buffer (Leica Biosciences catalog number: AR9640) by placing the slides in an appropriate level of preheated buffer and autoclaving for 1 minute, followed by a second autoclave heating for 20 minutes. Afterward, the slides were allowed to return to room temperature on a shaker. Permeabilization was then performed via TBST incubation, followed by incubation in blocking buffer as described above. Next, endogenous peroxide quenching was performed as described above, and primary antibody, secondary antibody, and opal fluorophore were loaded in a manner similar to single IHC. After opaling, the slides were washed three times with TBST, then returned to the antigen retrieval buffer and exposed to another round of autoclaving to remove poorly bound antibodies and expose the antigen to the next antibody in the group. After each subsequent antigen retrieval, a settling period was allowed, during which each antibody was also subjected to endogenous peroxide quenching. The groups were ultimately completed (each group had a total of 6 primary antibodies), and then nuclear counterstaining was performed using Hoescht as described in the single IHC method. Cover slips and scanning were performed in a similar manner, with each slide undergoing a set of exposure times and spectral resolution schemes. After scanning, the slides were stored at room temperature in the dark for rescanning if needed. Images were stored on a lab computer and sent to an image analysis pipeline. The antibodies used in this experiment are listed in Table 3.

[0218] Table 3 Primary and secondary antibodies and diluents used for multiplex immunofluorescence (mIF)

[0219] (10) Multiple IHC image analysis

[0220] After obtaining multiplex immunofluorescence images according to the above scheme, qtiff Images in the specified format are uploaded to the InForm tissue analysis software (Akoya Biosciences). In short, this software allows for spectral segmentation, marker identification, phenotypic analysis, and quantification of cells in a sample. First, representative slices of each sample are acquired and uploaded to a training set to develop an "algorithm" for processing complete images. Each sample has one or two representative images in the training set. Then, based on input from the research team and manual labeling, the tissue is divided into "high GARP" and "low GARP" regions, and trained via the algorithm until the accuracy calculated by the program is >97%. After tissue segmentation, cell segmentation is performed based on nuclear staining (DAPI), cytoplasmic staining, and cell membrane staining, according to the available groups. Once a reliable cell segmentation algorithm is obtained, phenotypic analysis is performed. Phenotyps are determined as positive for the target marker or various combinations of "others," indicating that the cell nucleus does not conform to the protocol or is not stained for the marker in the group. This process is repeated until the algorithm reliably identifies the cell phenotype, at which point the algorithm is saved and run on the complete image of each sample. In addition to the total tissue segmentation percentages of high-GARP and low-GARP regions, this analysis also quantified the number and location of cells for each phenotypic subtype. After comprehensive quantification and analysis of each sample image, the data were integrated, summarized, and reported for easy visualization and understanding using the R4.3.0 plugin phenoptr Reports (AkoyaBiosciences). Statistical analysis was performed in GraphPad PRISM software.

[0221] (11) In vivo studies.

[0222] All animal research procedures were performed in accordance with the National Institutes of Health's guidelines for the care and use of laboratory animals and were approved by the Ohio State University Institutional Animal Care and Use Committee. For intracranial injections (5 × 10⁻⁶), 4Animals were first infected with a luciferase-expressing lentivirus (Cellomics Technology, Hallethorpe, MD) and selected with 1 µg / mL puromycin (Thermo Fisher Scientific, Waltham, MA). Bioluminescence imaging was performed using Xenogen IVIS Spectrum (Caliper Life Sciences, Waltham, MA) to confirm approximately equal tumor burden and no tumor spread into the spinal canal (data not shown). Animals not meeting these criteria were excluded from further study. CAR-T cell or control T cell therapy was administered 7 to 14 days post-tumor implantation by implantation into the same tumor site. CAR-T dose was based on the CAR dose determined by flow cytometry using Protein L-PE (AcroBioSystems). + Percentages were adjusted. All mice were observed daily and sacrificed at the onset of neurological symptoms, a decline in physical scores, or at a defined time point for histological analysis. At necropsy, the brain was collected, fixed overnight in 10% formalin, embedded in paraffin, sectioned for slide preparation, and stained as described in the IHC method. To determine the growth of the primary tumor in vivo, bioluminescence imaging was performed before treatment and then weekly. Animals received an intraperitoneal injection of 100 μL of 15 mg / mL D-fluorescein potassium (Gold Biotechnology, St. Louis, MO, USA; catalog number Luck-100) and maintained under isoflurane anesthesia. Images were acquired 5–10 minutes after fluorescein administration. Bioluminescence intensity was quantified using LivingImage software (version 3.1, Caliper, Waltham, MA). Signal intensity was quantified as the sum of photons detected per second within the target region. A lower detection threshold was set at 200 photons / second / cm² / sphericity. For survival analysis, mice were observed for up to 100 days, or until tumor endpoint criteria were met (illness, visible lameness, pain, or severe weight loss), at which point they were humanely euthanized. Mice aged between 6 and 20 weeks were tested using NOD-scid IL2Rg from Jackson Laboratory (Bar Harbor, ME, USA). null (NSG) mice were used in experiments to assess immunodeficiency. This was conducted in our laboratory. hLRRC32 KIMice with normal immune function were subjected to an experiment. These mice had a C57BL / 6 background and were stably homozygous for the human GARP allele.

[0223] (12) Statistical Analysis

[0224] Statistical analysis was performed using GraphPad PRISM software, and the significance of the experiments in this study was determined using independent samples t-test, paired samples t-test, Wilcoxon rank-sum test, and mixed-effects model / ANOVA. Survival curves were plotted using the Kaplan–Meier method, and the log-rank test was used to compare curves between groups. P-values ​​are expressed as follows: P < 0.05; P < 0.01 P < 0.001 and P < 0.0001.

[0225] 2. Example 2: Targeting the TGFβ parking receptor glycoprotein A repeat dominant protein (GARP) via a novel chimeric antigen receptor

[0226] a) Results

[0227] (1) Increased GARP expression in human glioblastoma is associated with decreased overall survival and reduced mesenchymal subtype.

[0228] Given that GARP regulates tumorigenesis by modulating the bioavailability of TGFβ in the tumor microenvironment (TME), we first sought to determine the role of GARP in several aspects of GBM clinical behavior. Specifically, we analyzed publicly available transcriptomic data from the Cancer Genome Atlas (TCGA) to determine the impact of GARP expression on overall survival in GBM and to examine whether GARP is associated with disease grade or certain GBM subtypes. Overall, we found elevated mRNA levels of GARP in the Chinese Glioma Genome Atlas (CGGA) and TCGA-GBMLGG cohorts. LRRC32 Patients with GBM (GBM) have a worse prognosis (Figure 12A). Furthermore, the prognosis varies depending on the tumor grade. LRRC32 The comparison of expression showed that GARP expression was higher in the high-level cohorts than in the low-level counterparts in both the CGGA and TCGA-GBMLGG cohorts (Figure 12B).

[0229] Furthermore, in the CGGA and IvyGap GBM cohorts, we found mesenchymal subtypes... LRRC32 Expression was significantly elevated relative to the classical and proneural counterparts of GBM (Fig. 12C). Consistent with this, elevated expression was observed in... LRRC32Tumors expressing mRNA showed upregulation of core mesenchymal subtype-related transcripts, including TGM2, S100A4, and STAT3 (Figure 12D). To further confirm the relationship between GARP and mesenchymal subtype status, we analyzed the expression of previously defined GARP-related mRNA signatures (i.e., the nine GARP-TGFβ axis genes) (Figure 17A) and compared enrichment scores among the four GBM subtypes. We found that the mesenchymal group showed significantly higher levels of GARP-related signatures compared to the non-mesenchymal group (Figure 12D). Figure 12E (and Figure 17B).

[0230] Importantly, we found that patients with the mesenchymal subtype exhibited the highest GARP expression levels had significantly shorter median overall survival compared to those with lower GARP expression levels (Figures 17C–17G). Furthermore, consistent with the effects of TGFβ, we found that pathways involving angiogenesis, myeloid compartment expansion, T cell characteristics, and T cell depletion were upregulated in mesenchymal tumors. Figure 17H ).

[0231] (2) Intratumoral regions with high GARP expression and CD4 + and CD8 + It is associated with cell reduction and myeloid cell increase.

[0232] To further elucidate the role of GARP in the TME of GBM, we used multispectral immunofluorescence to evaluate human GBM specimens obtained from the Department of Pathology at Ohio State University. Table 2 lists the basic patient characteristics of these samples. Samples from 10 unique patients were stained with GARP and immune cell markers (CD4, CD8, FOXP3, CD11b). All samples showed heterogeneous GARP expression regions, which we termed “low GARP” (Figure 13A; <250 GARP). + cells / mm 2 ) and "high GARP" (Figure 13B, >250 GARP) + cells / mm 2 High GARP regions comprised only 10%–12% of the total scan area for each tumor (Figure 13C). There was no significant difference in mean tumor cell density between the two classifications (data not shown). Within high GARP regions, CD11b... + The relative increase in cells was significant (Figure 13D). CD8 + T cells, CD4 + Non-Treg (CD4) + / FOXP3 - ), Treg (CD4) + / FOXP3 +GARP levels were significantly reduced in all high GARP regions (Fig. 13E-Fig. 13G). Therefore, we conclude that high GARP expression is significantly associated with lymphocyte exclusion and myeloid cell enrichment.

[0233] Myeloid cells are known to induce HGG progression, partly due to enhanced TGFβ signaling. Furthermore, as mentioned above, myeloid and T cell compartments tend to be segregated within the TME (Figs. 18A–18D). Nearest neighbor analysis of these regions identified that similar immune cell types tend to cluster closer together than other cell types (i.e., CD4+). + or CD8 + Cells and CD11b + The distance between cells compared to other CD4 cells + or CD8 + (The cells are further apart) (Figure 18E-) Figure 18H The tumor showed stronger aggregation in low-GARP regions, and the cells in these regions were on average closer together than in high-GARP tumors (Fig. 18B).

[0234] To examine the potential role of GARP in the malignant transformation of gliomas, we obtained paired samples from eight unique patients with low-grade gliomas (LGG) that had progressed to high-grade gliomas (HGG) (Table 4), and also utilized four commercial tissue microarrays, including gliomas of all grades and normal brain controls, to further confirm our findings. Normal brain samples showed no GARP staining or very low GARP staining, compared to the significantly high staining in GBM tissue samples (Fig. 14A). In contrast, all high-grade and low-grade samples had regions marked as “high GARP” by the segmentation algorithm (Fig. 19A–19C). There was no significant difference in the mean proportion of “high GARP” tissue regions between HGG and LGG samples (Fig. 19D). Furthermore, approximately 33% of GBM samples and approximately 50% of LGG samples were GARP positive in the four GBM tissue microarrays (Fig. 14A, ). right). In summary, these results indicate that GARP is heterogeneously expressed in LGG and HGG, and that its expression is associated with aggressive characteristics, including lymphocyte rejection.

[0235] Table 4. Basic clinical summary of the matched patient samples

[0236] (3) GARP expression in glioma stem cells.

[0237] Glioma stem cells (GSCs) are the primary cellular niche for glioma recurrence and a significant therapeutic challenge for the disease. In this article, we examined whether glioma stem cells express GARP and how this expression affects the tumor microenvironment (TME). LRRC32 Transcripts are difficult to detect by scRNA-seq, possibly due to low levels or poor mRNA stability. In fact, using the TISCH2 single-cell database, we observed similar results with other GSC markers ( For example Compared to SOX2, CD44, and CD133, LRRC32 The expression is very low ( Figure 20 However, based on the publicly available ATAC-seq dataset, we found... LRRC32 The promoter region is open in untreated human GSCs, indicating that... LRRC32 Expressed by GSC ( Figure 19E ).

[0238] We validated the ATAC-seq results at the protein level using multiple IF assays. Using paired samples from patients with both LGG and HGG (Table 4), we stained them with a set of antibodies against GARP, CD133, CD44, SOX2, and CD31 (Table 3). Using this set, we examined oligodendrocyte precursor-like (OPC-like) GSCs (CD133... + / SOX2 + ), mesenchymal sample GSC (CD44) + / SOX2 + ) and neovascularization (CD31) + / CD133 + / SOX2 - GARP expression in LGG and HGG samples was observed. We found that a significant portion of both OPC-like and mesenchymal-like GSCs expressed GARP (Fig. 14B-14C, Fig. 14E-14F). Most angiogenesis also expressed GARP (Fig. 14D). Figure 14G These data indicate that GARP is expressed by tumor cells, two major types of GSCs, and new blood vessels, all of which are crucial for tumorigenesis and cancer recurrence.

[0239] (4) Generate anti-GARP CAR-T cells and various GBM cell lines with stable human GARP expression.

[0240] Based on the above findings, we believe GARP can serve as a therapeutic target for GBM. Our team previously developed a humanized and affinity-matured monoclonal antibody (called PIIO-1) targeting human GARP (hGARP), which we tested in various mouse cancer models. This anti-GARP antibody attenuated TGFβ signaling in the TME and significantly reduced metastasis in a triple-negative breast cancer model. It demonstrated monotherapy activity against multiple cancer types and promoted CD8 in vivo. + T-cell function. It also improved the therapeutic efficacy of anti-PD-1 in a variety of mouse cancer models, including lung cancer, breast cancer, and bladder cancer.

[0241] To generate an anti-GARP CAR, we cloned a single-stranded variable fragment (scFv) of PIIO-1 into a CAR construct consisting of a CD8α hinge and transmembrane domain, as well as intracellular domains of human 4-1BB and CD3ζ (Fig. 11A). This anti-GARP CAR construct was cloned into a third-generation lentiviral vector and successfully expressed after transduction into human T cells. Furthermore, we created glioma cell lines overexpressing (OE) human GARP (hGARP) derived from parental wild-type lines (U87-WT and U87-hGARP OE [human]; C57BL / 6 syngeneic GBM lines CT2A-WT and CT2A-hGARP OE [C57BL / 6]; GL261-WT and GL261-hGARP OE [C57BL / 6]). Stable hGARP expression was confirmed by flow cytometry and immunofluorescence (Figs. 11B–11C). All parental cell lines were engineered to co-express luciferase for downstream in vivo imaging.

[0242] (5) Human GARP CAR-T cells induce GBM activity in a GARP-dependent manner.

[0243] Next, we examined the antitumor activity of human anti-GARP CAR-T cells against human glioma U87. We found that anti-GARP CAR-T cells induced tumor cell lysis in vitro (Figure 4C), and co-culture resulted in the secretion of IFNγ, TNFα, and IL-2 in a GARP-dependent manner.

[0244] To evaluate the in vivo antitumor efficacy of human anti-GARP CAR-T, we used a GBM orthotopic xenograft model in NOD-SCID-γ (NSG) mice (experimental protocol). We observed a significant improvement in tumor burden (via IVIS) in mice treated with anti-GARP CAR-T cells compared to controls (Fig. 5D). The significant reduction in tumor burden led to improved overall survival; the median survival in the anti-GARP CAR-T-treated group was not yet reached, while it was 59 days in the control group (Fig. 5E; p<0.0001, log-rank test). We sacrificed surviving mice at the time of removal criteria or 100 days after tumor inoculation and performed H&E staining and GARP immunofluorescence on the brain to assess tumor cell burden. Mice receiving IVIS had significant tumor burden with GARP expression in both necrotic and tumor regions; mice treated with anti-GARP CAR-T showed no signs of disease and no abnormal GARP expression in residual tumors (Figure 5D). Figure 5F These data confirm that human anti-GARP CAR-T cells effectively eliminate in situ tumors in a mouse model of human GBM.

[0245] (6) In clinically relevant personnel LRRC32 Knock-in to a mouse model, anti-GARP CAR-T cells target mouse syngeneic GBM tumors. in vitro and in vivo active.

[0246] Next, we examined the antitumor activity of murine anti-GARP CAR-T cells against murine glioma. Splenic T cells from C57BL / 6 mice were activated with an anti-CD3 / CD28 antibody, followed by lentiviral transduction of the anti-GARP CAR. GARP expression was visualized by flow cytometry (Fig. 15A). We then co-cultured CT-2A and GL-261 (wild-type and hGARP-overexpressing) at different effector-target ratios in the presence of anti-GARP CAR-T cells. Similar to human anti-GARP CAR-T cells, the murine CAR-T cells induced significant cytotoxicity against hGARP-expressing murine GBM cells (Fig. 15B) and simultaneously secreted multiple cytokines in a GARP-dependent manner (Fig. 15C).

[0247] We previously reported on the creation of homozygous humans on an immunocompetent C57BL / 6 background. Lrrc32 Knock-in plants (referred to as hLRRC32 KI (Mouse). Similar to microarrays of healthy, normal human tissue, hLRRC32 KI The mouse brain does not express GARP (Figure 11D- Figure 11E Next, we identified anti-GARP CAR-T as a highly relevant preclinical candidate. hLRRC32 KI Efficacy and safety in mouse models (Figure 15D, experimental protocol). Mice treated with anti-GARP CAR-T showed reduced luminescence, indicating tumor regression. Several mice in the anti-GARP CAR-T treatment group showed complete tumor regression with durable results for several weeks after treatment. Figure 15E (See Figure 6F). In contrast, 100% of the mice in the control group showed rapid tumor progression. Total luminescence differed significantly between the groups after treatment, with mice receiving anti-GARP CAR-T showing a significantly reduced tumor burden compared to control mice. Figure 15E (p = 0.0007, mixed-effects analysis). Furthermore, mice treated with anti-GARP CAR-T therapy had significantly prolonged survival, with a median overall survival of 51 days, compared to 35 days in the control group (Figure 6D; p < 0.0001, log-rank test). Blood samples were drawn weekly to monitor treatment tolerance. The initial decrease in WBC and platelet counts compared to baseline was likely due to TBI. Mice treated with anti-GARP CAR-T therapy did not suffer from more thrombocytopenia or other hematologic toxicities compared to the control T-cell therapy group. Figure 6G (and Figure 6F). These data collectively demonstrate that a single intracranial dose of CAR-T targeting GARP administered to gliomas specifically targets tumor cells and prolongs survival without inducing toxicity or significant immune-related adverse events.

[0248] (7) Anti-GARP CAR-T cells do not cause significant toxicity when administered systemically.

[0249] To further demonstrate the safety of this anti-GARP CAR-T method, we conducted tests by... hLRRC32 KI We evaluated the potential for targeting / tumor detoxicity by intravenous infusion of our protocol in mice. Following 5 Gy TBI, we administered 1x10 [units of something] via tail vein injection. 6 Administer anti-GARP CAR-T or control CAR-T (targeting EGFRvIII) to non-tumor-bearing, lymphoidly cleared mice. hLRRC32 KI In mice, body weight, mortality, and serum cytokine parameters were monitored for 60 days. No deaths were observed, and body weight did not change significantly (Figure 16A). Platelet counts and serum cytokine levels remained stable in both groups (Figure 16B-). Figure 16D These data further underscore the safety of our anti-GARP CAR-T.

[0250] b) Discussion

[0251] The scale and indications of cellular immunotherapy continue to expand, with solid tumor targets gaining attention in each new iteration. In addition to tumor-specific expression, optimal target antigens are those crucial to tumor biogenesis and promote immunosuppressive tumor microenvironments (TMEs). Glioblastoma and high-grade gliomas are excellent candidates for novel CAR-T cell therapy targeting antigens because they are difficult to treat locally (e.g., surgery and radiotherapy) and current therapies generally yield poor results. Our data suggest that GARP is a suitable target antigen for CAR-T therapy of GBM due to its unique combination of importance for glioma immunosuppression / proliferation and low peripheral expression under healthy conditions.

[0252] Given the persistent lack of clinical progress in HGG / GBM therapy over the past few decades, unique targets represent a new avenue that must be explored. We demonstrate that GARP is an ideal target for gliomas because: a) it is expressed by GBM cells but not by normal brain cells; b) GARP expression may drive potential oncogenic processes by activating latent TGFβ; c) even more excitingly, GARP is expressed in glioma stem cells and angiogenesis, as shown by ATAC-seq and multiplex immunofluorescence microscopy, suggesting that targeting GARP could effectively eliminate the niche for glioma recurrence and the blood supply to growing tumors; d) GARP expression induces lymphocyte rejection; and e) high GARP expression is associated with poor prognosis in GBM patients. Due to these characteristics, we assert that GARP is an important target for glioma immunotherapy.

[0253] CAR-T cells initially struggled to function effectively in the field of brain tumors due to their difficulty in crossing the blood-brain barrier (BBB) ​​and the lack of T-cell homeostatic cytokines in the brain. Many initial clinical experiences in anticancer therapies involved methods to open the BBB, such as high-intensity ultrasound or irradiation. However, the optimal delivery route for CAR-T cells in the treatment of brain tumors remains an open question. Although several ongoing CAR-T clinical trials for GBM [e.g., NCT01109095, NCT01454596, NCT02844062, NCT02209376] deliver CAR-T cells via intravenous infusion, recent studies have shown that direct intracerebral administration of CAR-T cells demonstrates superior efficacy and excellent tolerability with minimal off-target toxicity. This includes a significantly reduced incidence of cytokine release syndrome and CAR-T-mediated neurotoxicity when cells are delivered into the brain. Furthermore, the convenience of subcutaneous repositories and the elimination of the need for pre-infusion lymph node dissection improve patients' quality of life and reduce additional complications associated with extremely low WBC counts. Our data show that directly implanting anti-GARP CAR-T cells into the brain does not reduce effectiveness, further demonstrating that this delivery route is suitable for brain tumors.

[0254] Finally, a major concern regarding GARP targeting via CAR-T cells is the potential for targeting and detumescent toxicity. However, we did not observe any ominous unexpected side effects of anti-GARP CAR-T in our preclinical models. In particular, concerns that our anti-GARP CAR-T cells might cause life-threatening platelet destruction are unfounded for two key reasons: a) Platelets are the primary producers of latent TGFβ. Therefore, all de novo synthesized GARP molecules in megakaryocytes and platelets are pre-complexed with LTGFβ. LTGFβ-free GARP is essentially absent from platelets; b) Our anti-GARP antibody PIIO-1 and the anti-GARP scFv used in our CAR-T construct recognize the LTGFβ binding site of GARP. Therefore, they can only bind to LTGFβ-free GARP. Thus, from a biochemical perspective, our anti-GARP CAR T cells have absolutely no effect on megakaryocytes and platelets. In conclusion, our data suggest that the use of anti-GARP CAR-T cells may be safe in human patients, a hypothesis that will be definitively addressed in the planned Phase I clinical trial.

[0255] In summary, we have developed a unique anti-GARP CAR-T cell modality that has shown promise against a variety of preclinical GBM models without significant toxicity.

[0256] c) Materials and Methods

[0257] (1) TCGA data collection and downstream analysis

[0258] Gene expression matrix values, survival information, and subtype annotations for GBM patients were obtained from the Cancer Genome Atlas (TCGA) via the cBioPortal, BroadFirehose GDAC, and GlioVis repositories; for survival analysis LRRC32 The high group was defined as samples with relative mRNA expression higher than the median, while LRRC32 The low group was defined as samples with relative transcript expression below the median.

[0259] For the TCGA-GBM-2013 dataset, LRRC32 The high group consists of the top 10% LRRC32 Expressing definition, and LRRC32 The lower group consists of the bottom 10% LRRC32 Definitions were defined. GSVA enrichment scores for GARP-related pathways were performed on each sample using the GSVA package (v.1.49). GSEA enrichment analysis of angiogenesis, myeloid compartments, T cell characteristics, and T cell exhaustion in the TCGA-GBM-2013 dataset was performed using the desktop GSEA software (v.4.3.2) with default settings.

[0260] (2) GSC ATAC-seq data collection and visualization

[0261] The human GSC ATAC-seq dataset aligned to the hg19 reference genome in bigwig format was downloaded from GSE163853. Twelve samples from individuals who had not received oncology treatment were selected, including U3005MG-1, U3005MG-2, U3008MG-1, U3008MG-2, U3046MG-1, U3046MG-2, U3056MG-1, U3056MG-2, U3164MG-1, U3164MG-2, U3085MG-1, and U3085MG-2. The collected bigwig data was visualized using Integrative Genomics Viewer (IGV, v.2.4.1).

[0262] (3) Cell line.

[0263] Human glioblastoma U87-MG cell line was obtained from the American Type Culture Collection (ATCC® HTB-14™ Manassas, VA). Mouse glioma cell line GL261 was obtained from the NCI Tumor Resource Bank (Frederik, MD). CT-2A mouse cell line was purchased from EMD Millipore (catalog number: SCC194, Burlington, MA). All cells were cultured in Dulbecco modified Eagle medium (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin. For cell lines containing the puromycin resistance gene, puromycin (Gibco, catalog number: A1113803, 1 μg / mL) was used for selection.

[0264] (4) Construction of lentiviral vectors.

[0265] An antibody targeting human GARP (PIIO-1) has been previously reported. 38Synthetic oligonucleotides encoding the GGGGSGGGGSGGGGS (SEQ ID NO: 15) amino acid linker sequence were used to ligate VH and VL DNA sequences to generate PIIO-1 scFv. PIIO-1 scFv was then linked to the CD8a hinge and transmembrane domain, and the intracellular signal transduction domain contained a co-stimulatory domain consisting of 4-1BB and CD3ζ domains. Subsequently, the PIIO-1 scFv CAR-coding sequence was synthesized via GeneScript and then cloned into the XmaI / PacI site of the pLenti-EF1α vector to generate our anti-GARP CAR lentiviral vector (pLenti-PIIO-1-CAR). The pLenti-EF1α vector was modified from pLenti CMV / TO Hygro empty (w214-1) (Addgene, plasmid #17484) by replacing the CMV promoter with the human EF-1α promoter, deleting the hygromycin selection marker, and replacing the marmot hepatitis virus posttranscriptional regulatory element (WPRE) with a 50-mer sequence (GTGACGAACATGGGGCAGATTGCTTCCAGTGCTTGCTGGGCATTGCTGAT) (SEQ ID NO: 14) (synthesized by GeneScript, Piscataway, NJ). To generate a cell line overexpressing GARP, human GARP cDNA was amplified from the shuttle plasmid and subcloned into the NheI / BstBI site of Addgenes' pLJM1-EGFP (plasmid #19319). We also obtained pLenti CMV / TO Hygro empty (w214-1) (Addgene plasmid #17484) and pLJM1-EGFP (Addgene plasmid #19319) from Addgene.

[0266] (5) Use lentiviruses to generate human and mouse GARP CAR-T cells.

[0267] To generate lentivirus, HEK293FT cells (Thermo Fisher, Waltham, MA) were transfected using TransIT-293 transfection reagent (Mirus Bio, Madison, WI) or Lipofectamine 3000 (Thermo Fisher, Waltham, MA) with Addgene's pCMV-VSV-G (plasmid #8454), pCMV-dR8.9 (plasmid #8455), and pLenti-EF1α-scFv (PIIO-1)-CAR. 24 hours post-transfection, the culture medium on the HEK293FT cells was replaced with fresh medium. 72 hours post-transfection, the lentivirus medium was filtered through a 0.45 μm filter. The supernatant was then concentrated using Amicon virus concentrating ultrafiltration centrifugation in 100 kDa tubes (Merck Millipore, Burlington, MA) at 1,200 g for 15 minutes at 4°C. Freshly collected concentrated viral supernatant was used for rotational transduction by centrifugation at 800 g for 90 minutes at 32°C. For human T cell transduction, T cells were enriched from peripheral blood mononuclear cells (PBMCs, obtained from delabeled healthy donors) using the Pan T Cell Isolation Kit (Miltenyi Biotec, Auburn, CA). The isolated T cells (5 × 10⁶ cells / ... 6 T cells were resuspended in 3 ml of medium per well of a 6-well plate and stimulated overnight with a 1:1 ratio of CD3 / CD28 beads (LifeTechnologies, Carlsbad, CA) and IL-2 (Peprotech, Rocky Hill, NJ, 100 U / ml). Next, the medium (2 ml / well) was gently removed without disturbing the aggregated T cells, and 1 ml of freshly concentrated pLenti-PIIO-1-CAR viral particles was added (finally 3 ml / well). The T cells were then cultured with the lentivirus in TexMAX cell culture medium (Miltenyi Biotec) containing 10% fetal bovine serum and IL-2 (100 U / ml) for 24 hours. For the generation of mouse CAR-T cells, mouse T cells were first isolated from the spleen of C57BL / 6 mice using a mouse T cell-specific isolation kit (Miltenyi Biotec, catalog number 130-095-130). A similar transduction procedure was followed. Mouse CAR-T cells were maintained in TexMAX cell culture medium (Miltenyi Biotec) containing 5% FBS (Sigma), IL-2 (100 U / ml), IL-7 (10 ng / mL) and IL-15 (10 ng / mL).

[0268] (6) Flow cytometry analysis.

[0269] To detect CAR expression, 1 × 10⁻⁶ cells transduced with the empty pLenti-EF1α vector were used. 6 CAR-T or control T cells were stained with an antibody labeled with a fluorescent dye against CD4 and CD8 (eBiosciences) at 4°C for 30 min using a protein L-PE conjugate (AcroBioSystems, Newark, DE). To detect human GARP surface expression in GBM cell lines, cells were stained with an anti-GARP antibody conjugated to phycoerythrin (PE, Biolegend). Fluorescence data for all samples were collected using a Cytek Aurora flow cytometer, and all data were analyzed using FlowJo software.

[0270] (7) In vitro cytotoxicity assay.

[0271] The ability of GARP-specific CAR-T cells to kill targets was tested in 96-well flat-bottom plates in a luciferase-based 24-hour killing assay at various effector-to-target ratios. All cell lines (U87, GL261, and CT-2A) were engineered to stably express firefly luciferase (Cellomics Technology, Hallethorpe, MD, USA). Target cells were individually seeded at the same cell density to determine maximum luciferase expression (relative light units; RLUmax). After 24 hours, 100 μl of supernatant was removed from each well, and 100 μl of luciferase substrate (Bright-Glo, Promega) was added to the remaining supernatant and cells. After five minutes of incubation, emission was measured using a Spectra Max ID5 plate reader (Molecular Devices, San Jose, CA). Lysis was determined as [1 – (RLU sample) / (RLUmax)] × 100.

[0272] (8) Cytokine ELISA.

[0273] Quantify IL-2, IFN-γ, and TNF-α using a commercially available ELISA kit, following the manufacturer’s instructions (R&D Systems, Minneapolis, MN).

[0274] (9) Multiplex immunofluorescence (mIF)

[0275] Paraffin-embedded slides of known glioblastoma patients or matched LGG and HGG specimens were obtained from the Department of Pathology at Ohio State University according to the IRB-approved protocol (OSU IRB# 2020C0062). De-identified samples without identifiable health information were shared. Commercially available tissue microarrays supplemented the primary samples (USBiomax, Inc. [catalog numbers GL1002, GL803d, BS17016b]). Multiplex immunofluorescence was performed using the Vectra Polaris™ Automated Quantitative Pathology Imaging System (Akoya Biosciences) according to the manufacturer's protocol.

[0276] (10) Multiplex immunofluorescence image analysis

[0277] Will qtiff mIF images in the specified format were uploaded to the InForm tissue analysis software (Akoya Biosciences). In short, this software allows for spectral segmentation, marker identification, phenotypic analysis, and quantification of cells in samples. First, representative slices of each sample were acquired and uploaded to a training set to develop the "algorithm" for processing complete images. Based on input from the research team and manual labeling, tissue regions were categorized as "high GARP" (defined as >250 GARP-positive cells per square millimeter) and "low GARP" (defined as <250 GARP-positive cells per square millimeter), and then trained via the algorithm until the calculated accuracy was >97%. After tissue segmentation, cell segmentation was performed based on manual review of the machine learning workflow. Phenotypic analysis was performed in the same manner, with phenotype names manually entered to train the algorithm, and all data collected using the machine learning algorithm. After comprehensive quantification of each sample image, the data was analyzed using the R4.3.0 plugin phenoptr Reports (AkoyaBiosciences).

[0278] (11) In vivo studies.

[0279] NOD-scid IL2Rg in immunocompromised individuals null (NSG) mice were obtained from Jackson Laboratory (BarHarbor, ME, USA). Previously reported models with normal immune function... hLRRC32 KI C57BL / 6 mice. All animal studies were conducted in accordance with protocols approved by the Ohio State University Institutional Laboratory Animal Care and Use Committee. Intracranial injection (5 × 10⁻⁶) was administered. 4Mouse GBMs were established using U87-WT, U87-hGARP, GL261-WT, GL261-hGARP, CT2A-WT, or CT2A-hGARP cells, all of which expressed stable luciferase. Bioluminescence imaging was performed using a Xenogen IVIS Spectrum (CaliperLife Sciences, Waltham, MA). CAR-T or control T cell therapy was administered via intratumoral injection. The CAR-T dose was based on the CAR dose determined by flow cytometry using Protein L-PE (AcroBioSystems). + Percentages were adjusted. All mice were observed daily and euthanized when neurological symptoms developed, body scores declined, or at specified time points for histological analysis. For survival analysis, mice were observed for up to 100 days or until tumor endpoint criteria were met.

[0280] (12) Statistical Analysis

[0281] Statistical analysis was performed using GraphPad PRISM software, and the significance of the experiments in this study was determined using independent samples t-tests, paired samples t-tests, Wilcoxon rank-sum tests, and mixed-effects models / ANOVA. Survival curves were plotted using the Kaplan–Meier method, and the log-rank test was used to compare curves between groups. The statistical analyses and tests used are indicated in the legends of the corresponding graphs. P-values ​​are expressed as follows. P < 0.05; P < 0.01 P < 0.001 and P < 0.0001.

[0282] 3. Example 3: In vitro PIIO-1 GARP CAR-T targeting human erythroleukemia cell lines

[0283] The cytotoxic activity of PIIO-1 GARPCAR-T cells was tested in vitro using the HEL 92.1.7 erythroblast cell line endogenously expressing GARP. For this experiment, three different versions of HEL cells were used: (i) HEL cells transduced with an empty vector (EV) and thus expressing physiological levels of GARP similar to wild-type cells; (ii) HEL cells transduced to overexpress hGARP (GARP-OE); and (iii) HEL cells with GARP deleted using CRISPR (GARP-KO). Figure 21Cells were plated with CAR-T or simulated T cells at different ratios for 24 hours, and LDH-based cytotoxicity assays were performed to evaluate HEL cell killing under different conditions. At a low target-to-cell ratio (E:T), GARP CAR-T was active only against the GARP-OE cell line, while at a higher target-to-cell ratio, GARP CAR-T showed equivalent efficiency between artificially overexpressed GARP and wild-type HEL cells.

[0284] 4. Example 4: In vitro elimination of Treg cells by mouse PIIO-1 GARP CAR-T cells

[0285] To test whether PIIO-1 GARP CAR-T cells could eliminate activated Treg cells in vitro, we performed a direct Treg cytotoxicity assay. Figure 22 In short, from hLrrc32KI CD4 sorting in mouse spleen cells via immunomagnetic sorting + CD25 + Treg (hGARP Treg). As a control, Treg specificity was also analyzed. Lrrc32KO Treg cells (GARPKO Treg) were extracted from mice. After in vitro activation with aCD3 / aCD28 for 48 hours, the Treg cells were co-incubated for 20 hours with increasing proportions of PIIO CAR-T or T-cell mimics (both generated in a CD45.1 background). At the end of the incubation period, total CD45.2 was assessed by flow cytometry. + Foxp3 in target Treg cells + CD4 + The percentage of Tregs. We observed that after co-incubating CD45.1 GARP CAR-T cells with CD45.2 Tregs for 20 hours, the number of Tregs in CD45.2+ target cells decreased by 50%. This effect disappeared when GARPKO Tregs were used. Figure 23 and Figure 24 )

[0286] 5. Example 5: Treg cells transformed from human PIIO-1 GARP CAR-T cells in vitro.

[0287] To test whether human PIIO-1 GARP CAR-T cells can target peripherally transformed Treg cells, we... hLrrc32KIUnsensitized CD4+CD25- cells were isolated from spleen cells of Lrrc32KO mice and cultured in vitro for 4 days under Treg tilt conditions. Flow cytometry was then used to confirm their transformation into CD4+Foxp3+ Treg cells. The transformed Tregs were then co-incubated with increasing proportions of human PIIO CAR-T or T-mimetic cells for 18 hours. At the end of the incubation period, the percentage of Foxp3+CD4+ Tregs in total CD4+ target T cells was assessed using flow cytometry. When hGARP Treg cells were co-cultured with PIIO-1 GARP CAR-T, the proportion of hGARP Tregs decreased (…). Figure 25 ).

[0288] 6. Example 6: Human PIIO-1 GARP CAR-T cell elimination of Treg cells derived from tumor-infiltrating lymphocytes from bladder cancer patients

[0289] To test whether PIIO-1 GARP CAR-T cells could target tumor-infiltrating Tregs in patients, we expanded tumor-infiltrating lymphocytes (TILs) from tumor fragments excised from bladder cancer patients in vitro for 4 weeks. We then stained the TILs with Cell Trace Violet and co-incubated them with human PIIO-1 CAR-T cells for 20 hours. At the end of the incubation period, we assessed the CTV+:CTV- ratio and the proportion of CD4+Foxp3+ Tregs within CTV+ target cells (…). Figure 26 ).

[0290] 7. Example 7: PIIO-1 GARP CAR-T infusion in mice carrying GARP(-) PyMT tumors reduced the number of tumor-infiltrating Tregs and prevented CD8+ T cell depletion.

[0291] GARP CAR-T cells were administered intratumorally to PyVT breast cancer cells that had been orthotopically implanted. hLrrc32KI In mice (n=7). As a control, simulated T cells were injected into another group of tumor-bearing mice (n=6). Figure 27 Tumor growth in both groups was measured after inoculation, showing a significant reduction in tumor growth in GARP CAR-T cell receptor mice compared to the simulated treatment group. Figure 27 Two days later, we evaluated tumor-infiltrating lymphocytes using multidimensional flow cytometry. Figure 28 and Figure 29 We found that, compared with the control group, mice treated with GARP CAR-T had a significantly lower proportion of Tregs in their tumors ( Figure 28This is related to improved T cell function, as depleted CD8 T cells were significantly reduced in the tumors of mice treated with GARP CAR-T. Figure 29 ).

[0292] E. References

[0293] Ahmed, N. et al. HER2-specific T cells target primary glioblastomastem cells and induce regression of autologous experimental tumors. Clin Cancer Res 16, 474-485, doi:10.1158 / 1078-0432.CCR-09-1322 (2010).

[0294] Akhurst, RJ Targeting TGF-beta Signaling for Therapeutic Gain. Cold Spring Harb Perspective Biol 9, doi:10.1101 / cshperspect.a022301 (2017).

[0295] Antonios, JP et al. Immunosuppressive tumor-infiltrating myeloid cells mediate adaptive immune resistance via a PD-1 / PD-L1 mechanism inglioblastoma. Neuro-Oncology , now287, doi:10.1093 / neuonc / now287 (2017).

[0296] Azam, Z., To, ST & Tannous, BA Mesenchymal Transformation: The Rosetta Stone of Glioblastoma Pathogenesis and Therapy Resistance. Adv Sci (Weinh) 7, 2002015, doi:10.1002 / advs.202002015 (2020).

[0297] Bagley, S. J., Desai, A. S., Linette, G. P., June, C. H. & O’Rourke,D. M. CAR T-cell therapy for glioblastoma: recent clinical advances andfuture challenges. Neuro-Oncology 20, 1429-1438, doi:10.1093 / neuonc / noy032(2018).

[0298] Bao, S. et al. Glioma stem cells promote radioresistance bypreferential activation of the DNA damage response. Nature 444, 756-760, doi:10.1038 / nature05236 (2006).

[0299] Brennan, W., Cameron et al. The Somatic Genomic Landscape ofGlioblastoma. Cell 155, 462-477, doi:10.1016 / j.cell.2013.09.034 (2013).

[0300] Brown, C. E. et al. Bioactivity and Safety of IL13Ralpha2-RedirectedChimeric Antigen Receptor CD8+ T Cells in Patients with RecurrentGlioblastoma. Clin Cancer Res 21, 4062-4072, doi:10.1158 / 1078-0432.CCR-15-0428 (2015).

[0301] Brown, C. E. et al. Regression of Glioblastoma after Chimeric AntigenReceptor T-Cell Therapy. New England Journal of Medicine 375, 2561-2569, doi:10.1056 / nejmoa1610497 (2016).

[0302] Brown, C. E. et al. Stem-like tumor-initiating cells isolated fromIL13Ralpha2 expressing gliomas are targeted and killed by IL13-zetakine-redirected T Cells. Clin Cancer Res 18, 2199-2209, doi:10.1158 / 1078-0432.CCR-11-1669 (2012).

[0303] Campbell, M. G. et al. Cryo-EM Reveals Integrin-Mediated TGF-betaActivation without Release from Latent TGF-beta. Cell 180, 490-501 e416, doi:10.1016 / j.cell.2019.12.030 (2020).

[0304] Carrillo-Galvez, A. B. et al. Mesenchymal stromal cells express GARP / LRRC32 on their Surface: Effects on their biology and immunomodulatorycapacity. Stem cells , doi:10.1002 / stem.1821 (2014).

[0305] Cheng, L. et al. Glioblastoma Stem Cells Generate Vascular Pericytesto Support Vessel Function and Tumor Growth. Cell 153, 139-152, doi:10.1016 / j.cell.2013.02.021 (2013).

[0306] Choi, B. D. et al. Intraventricular CARv3-TEAM-E T Cells in RecurrentGlioblastoma. N Engl J Med 390, 1290-1298, doi:10.1056 / NEJMoa2314390 (2024).

[0307] Chow, K. H. et al. S100A4 Is a Biomarker and Regulator of Glioma StemCells That Is Critical for Mesenchymal Transition in Glioblastoma. Cancer Res 77, 5360-5373, doi:10.1158 / 0008-5472.CAN-17-1294 (2017).

[0308] Cuende, J. et al. Monoclonal antibodies against GARP / TGF-beta1complexes inhibit the immunosuppressive activity of human regulatory T cellsin vivo. Sci Transl Med 7, 284ra256, doi:10.1126 / scitranslmed.aaa1983 (2015).

[0309] De Streel, G. et al. Selective inhibition of TGF-β1 produced by GARP-expressing Tregs overcomes resistance to PD-1 / PD-L1 blockade in cancer. Nature Communications 11 (2020).

[0310] Delgado-López, P. D. & Corrales-García, E. M. Survival inglioblastoma: a review on the impact of treatment modalities. Clinical and Translational Oncology 18, 1062-1071, doi:10.1007 / s12094-016-1497-x (2016).

[0311] Derynck, R., Turley, S. J. & Akhurst, R. J. TGFbeta biology in cancerprogression and immunotherapy. Nat Rev Clin Oncol 18, 9-34, doi:10.1038 / s41571-020-0403-1 (2021).

[0312] Doucette, T. et al. Immune Heterogeneity of Glioblastoma Subtypes:Extrapolation from the Cancer Genome Atlas. Cancer Immunology Research 1,112-122, doi:10.1158 / 2326-6066.cir-13-0028 (2013).

[0313] Gaignage, M. et al. Blocking GARP-mediated activation of TGF-β1 didnot alter innate or adaptive immune responses to bacterial infection orprotein immunization in mice. Cancer Immunology, Immunotherapy 71, 1851-1862(2022).

[0314] Gangoso, E. et al. Glioblastomas acquire myeloid-affiliatedtranscriptional programs via epigenetic immunoediting to elicit immuneevasion. Cell 184, 2454-2470.e2426 (2021).

[0315] Gasca-Salas, C. et al. Blood-brain barrier opening with focusedultrasound in Parkinson’s disease dementia. Nature Communications 12, doi:10.1038 / s41467-021-21022-9 (2021).

[0316] Hahn, S. A. et al. Soluble GARP has potent antiinflammatory andimmunomodulatory impact on human CD4(+) T cells. Blood 122, 1182-1191, doi:10.1182 / blood-2012-12-474478 (2013).

[0317] Han, Y. et al. TISCH2: expanded datasets and new tools for single-cell transcriptome analyses of the tumor microenvironment. Nucleic Acids Res 51, D1425-D1431, doi:10.1093 / nar / gkac959 (2023).

[0318] Hay, K. A. et al. Kinetics and biomarkers of severe cytokine releasesyndrome after CD19 chimeric antigen receptor-modified T-cell therapy. Blood 130, 2295-2306 (2017).

[0319] Hodges, T. R. et al. Mutational burden, immune checkpoint expression,and mismatch repair in glioma: implications for immune checkpointimmunotherapy. Neuro-Oncology 19, 1047-1057, doi:10.1093 / neuonc / nox026(2017).

[0320] Huang, Y. et al. A proangiogenic signaling axis in myeloid cellspromotes malignant progression of glioma. Journal of Clinical Investigation 127, 1826-1838 (2017).

[0321] June, C. H., O'Connor, R. S., Kawalekar, O. U., Ghassemi, S. &Milone, M. C. CAR T cell immunotherapy for human cancer. Science 359, 1361-1365, doi:10.1126 / science.aar6711 (2018).

[0322] Kaffes, I. et al. Human Mesenchymal glioblastomas are characterizedby an increased immune cell presence compared to Proneural and Classicaltumors. Oncoimmunology 8, e1655360, doi:10.1080 / 2162402X.2019.1655360 (2019).

[0323] Kreatsoulas, D. et al. Translational landscape of glioblastomaimmunotherapy for physicians: guiding clinical practice with basic scientificevidence. J Hematol Oncol 15, 80, doi:10.1186 / s13045-022-01298-0 (2022).

[0324] Krenciute, G. et al. Transgenic Expression of IL15 ImprovesAntiglioma Activity of IL13Ralpha2-CAR T Cells but Results in Antigen LossVariants. Cancer Immunol Res 5, 571-581, doi:10.1158 / 2326-6066.CIR-16-0376(2017).

[0325] Lee-Chang, C. et al. Myeloid-Derived Suppressive Cells Promote Bcell–Mediated Immunosuppression via Transfer of PD-L1 in Glioblastoma. Cancer Immunology Research 7, 1928-1943, doi:10.1158 / 2326-6066.cir-19-0240 (2019).

[0326] Li, A. et al. Selective targeting of GARP-LTGFbeta axis in the tumormicroenvironment augments PD-1 blockade via enhancing CD8(+) T cell antitumorimmunity. J Immunother Cancer 10, doi:10.1136 / jitc-2022-005433 (2022).

[0327] Li, A. et al. Selective targeting of GARP-LTGFβ axis in the tumormicroenvironment augments PD-1 blockade via enhancing CD8. J Immunother Cancer 10, doi:10.1136 / jitc-2022-005433 (2022).

[0328] Lienart, S. et al. Structural basis of latent TGF-beta1 presentationand activation by GARP on human regulatory T cells. Science 362, 952-956,doi:10.1126 / science.aau2909 (2018).

[0329] Liu, S., Ren, J. & Ten Dijke, P. Targeting TGFbeta signaltransduction for cancer therapy. Signal Transduct Target Ther 6, 8, doi:10.1038 / s41392-020-00436-9 (2021).

[0330] Louis, D. N. et al. The 2021 WHO Classification of Tumors of theCentral Nervous System: a summary. Neuro-Oncology 23, 1231-1251, doi:doi:10.1093 / neuonc / noab106 (2021).

[0331] Lu, X. et al. Cell-lineage controlled epigenetic regulation inglioblastoma stem cells determines functionally distinct subgroups andpredicts patient survival. Nat Commun 13, 2236, doi:10.1038 / s41467-022-29912-2 (2022).

[0332] Macaulay, I. C. et al. Comparative gene expression profiling of invitro differentiated megakaryocytes and erythroblasts identifies novelactivatory and inhibitory platelet membrane proteins. Blood 109, 3260-3269,doi:10.1182 / blood-2006-07-036269 (2007).

[0333] Majzner, R. G. et al. GD2-CAR T cell therapy for H3K27M-mutateddiffuse midline gliomas. Nature 603, 934-941 (2022).

[0334] Majzner, R. G. et al. GD2-CAR T cell therapy for H3K27M-mutateddiffuse midline gliomas. Nature 603, 934-941, doi:10.1038 / s41586-022-04489-4(2022).

[0335] Marenco-Hillembrand, L. et al. Trends in glioblastoma: outcomes overtime and type of intervention: a systematic evidence based analysis. Journal of Neuro-Oncology 147, 297-307 (2020).

[0336] Marenco-Hillembrand, L. et al. Trends in glioblastoma: outcomes overtime and type of intervention: a systematic evidence based analysis. Journal of Neuro-Oncology 147, 297-307, doi:10.1007 / s11060-020-03451-6 (2020).

[0337] Martinez-Lage, M. et al. Immune landscapes associated with differentglioblastoma molecular subtypes. Acta Neuropathologica Communications 7(2019).

[0338] Martinez-Lage, M. et al. Immune landscapes associated with differentglioblastoma molecular subtypes. Acta Neuropathologica Communications 7, doi:10.1186 / s40478-019-0803-6 (2019).

[0339] Metelli, A. et al. Immunoregulatory functions and the therapeuticimplications of GARP-TGF-β in inflammation and cancer. Journal of Hematology & Oncology 11 (2018).

[0340] Metelli, A. et al. Immunoregulatory functions and the therapeuticimplications of GARP-TGF-beta in inflammation and cancer. J Hematol Oncol 11,24, doi:10.1186 / s13045-018-0570-z (2018).

[0341] Metelli, A. et al. Immunoregulatory functions and the therapeuticimplications of GARP-TGF-β in inflammation and cancer. Journal of Hematology & Oncology 11, doi:10.1186 / s13045-018-0570-z (2018).

[0342] Metelli, A. et al. Surface Expression of TGFbeta Docking ReceptorGARP Promotes Oncogenesis and Immune Tolerance in Breast Cancer. Cancer Res 76, 7106-7117, doi:10.1158 / 0008-5472.CAN-16-1456 (2016).

[0343] Metelli, A. et al. Surface Expression of TGFβ Docking Receptor GARPPromotes Oncogenesis and Immune Tolerance in Breast Cancer. Cancer Research 76, 7106-7117 (2016).

[0344] Metelli, A. et al. Thrombin contributes to cancer immune evasion viaproteolysis of platelet-bound GARP to activate LTGF-β. Science Translational Medicine 12, eaay4860 (2020).

[0345] Metelli, A. et al. Thrombin contributes to cancer immune evasion viaproteolysis of platelet-bound GARP to activate LTGF-beta. Sci Transl Med 12,doi:10.1126 / scitranslmed.aay4860 (2020).

[0346] Miao, H. et al. EphA2 promotes infiltrative invasion of glioma stemcells in vivo through cross-talk with Akt and regulates stem cell properties. Oncogene 34, 558-567, doi:10.1038 / onc.2013.590 (2015).

[0347] Moreau, J. M., Velegraki, M., Bolyard, C., Rosenblum, M. D. & Li, Z.Transforming growth factor-beta1 in regulatory T cell biology. Sci Immunol 7,eabi4613, doi:10.1126 / sciimmunol.abi4613 (2022).

[0348] Morgan, R. A. et al. Recognition of glioma stem cells by geneticallymodified T cells targeting EGFRvIII and development of adoptive cell therapyfor glioma. Hum Gene Ther 23, 1043-1053, doi:10.1089 / hum.2012.041 (2012).

[0349] O’Rourke, D. M. et al. A single dose of peripherally infusedEGFRvIII-directed CAR T cells mediates antigen loss and induces adaptiveresistance in patients with recurrent glioblastoma. Science Translational Medicine 9, eaaa0984, doi:10.1126 / scitranslmed.aaa0984 (2017).

[0350] Obstfeld, A. E. et al. Cytokine release syndrome associated withchimeric-antigen receptor T-cell therapy: clinicopathological insights. Blood 130, 2569-2572 (2017).

[0351] Oh, T. et al. Immunocompetent murine models for the study ofglioblastoma immunotherapy. Journal of Translational Medicine 12, 107, doi:10.1186 / 1479-5876-12-107 (2014).

[0352] O'Leary, M. C. et al. FDA Approval Summary: Tisagenlecleucel forTreatment of Patients with Relapsed or Refractory B-cell Precursor AcuteLymphoblastic Leukemia. Clin Cancer Res 25, 1142-1146, doi:10.1158 / 1078-0432.CCR-18-2035 (2019).

[0353] Ollendorff, V., Noguchi, T., deLapeyriere, O. & Birnbaum, D. The GARPgene encodes a new member of the family of leucine-rich repeat-containingproteins. Cell Growth Differ 5, 213-219 (1994).

[0354] Rachidi, S. et al. Platelets subvert T cell immunity against cancervia GARP-TGFbeta axis. Sci Immunol 2, doi:10.1126 / sciimmunol.aai7911 (2017).

[0355] Rajendran, S. et al. Single-cell RNA sequencing revealsimmunosuppressive myeloid cell diversity during malignant progression in amurine model of glioma. Cell Rep 42, 112197, doi:10.1016 / j.celrep.2023.112197(2023).

[0356] Raychaudhuri, B. et al. Myeloid-derived suppressor cell accumulationand function in patients with newly diagnosed glioblastoma. Neuro-Oncology 13, 591-599, doi:10.1093 / neuonc / nor042 (2011).

[0357] Sadelain, M. CAR therapy: the CD19 paradigm. J Clin Invest 125, 3392-3400, doi:10.1172 / JCI80010 (2015).

[0358] Salem, M. et al. GARP Dampens Cancer Immunity by Sustaining Functionand Accumulation of Regulatory T Cells in the Colon. Cancer Res 79, 1178-1190, doi:10.1158 / 0008-5472.CAN-18-2623 (2019).

[0359] San-Miguel, J. et al. Cilta-cel or Standard Care in Lenalidomide-Refractory Multiple Myeloma. N Engl J Med 389, 335-347, doi:10.1056 / NEJMoa2303379 (2023).

[0360] Stock, S., Schmitt, M. & Sellner, L. Optimizing ManufacturingProtocols of Chimeric Antigen Receptor T Cells for Improved AnticancerImmunotherapy. International Journal of Molecular Sciences 20, 6223, doi:10.3390 / ijms20246223 (2019).

[0361] Stupp, R. et al. Effect of Tumor-Treating Fields Plus MaintenanceTemozolomide vs Maintenance Temozolomide Alone on Survival in Patients WithGlioblastoma: A Randomized Clinical Trial. JAMA 318, 2306-2316, doi:10.1001 / jama.2017.18718 (2017).

[0362] Stupp, R. et al. Effects of radiotherapy with concomitant andadjuvant temozolomide versus radiotherapy alone on survival in glioblastomain a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 10, 459-466, doi:10.1016 / S1470-2045(09)70025-7 (2009).

[0363] Stupp, R. et al. Radiotherapy plus concomitant and adjuvanttemozolomide for glioblastoma. N Engl J Med 352, 987-996, doi:10.1056 / NEJMoa043330 (2005).

[0364] Suvà, M. L. & Tirosh, I. The Glioma Stem Cell Model in the Era ofSingle-Cell Genomics. Cancer Cell 37, 630-636, doi:10.1016 / j.ccell.2020.04.001 (2020).

[0365] Thakkar, J. P. et al. Epidemiologic and Molecular Prognostic Reviewof Glioblastoma. Cancer Epidemiology, Biomarkers & Prevention 23, 1985-1996,doi:10.1158 / 1055-9965.epi-14-0275 (2014).

[0366] Tran, D. Q. et al. GARP (LRRC32) is essential for the surfaceexpression of latent TGF-beta on platelets and activated FOXP3+ regulatory Tcells. Proc Natl Acad Sci U S A 106, 13445-13450, doi:10.1073 / pnas.0901944106(2009).

[0367] Umemura, N. et al. Tumor-infiltrating myeloid-derived suppressorcells are pleiotropic-inflamed monocytes / macrophages that bear M1- and M2-type characteristics. Journal of Leukocyte Biology 83, 1136-1144, doi:10.1189 / jlb.0907611 (2008).

[0368] Verhaak, R. G. et al. Integrated genomic analysis identifiesclinically relevant subtypes of glioblastoma characterized by abnormalitiesin PDGFRA, IDH1, EGFR, and NF1. Cancer Cell 17, 98-110, doi:10.1016 / j.ccr.2009.12.020 (2010).

[0369] Verhaak, R. G. W. et al. Integrated Genomic Analysis IdentifiesClinically Relevant Subtypes of Glioblastoma Characterized by Abnormalitiesin PDGFRA, IDH1, EGFR, and NF1. Cancer Cell 17, 98-110, doi:10.1016 / j.ccr.2009.12.020 (2010).

[0370] Vermeersch, E. et al. The role of platelet and endothelial GARP inthrombosis and hemostasis. PLoS One 12, e0173329, doi:10.1371 / journal.pone.0173329 (2017).

[0371] Wang, H. et al. S100A11 Promotes Glioma Cell Proliferation andPredicts Grade-Correlated Unfavorable Prognosis. Technol Cancer Res Treat 20,15330338211011961 (2021).

[0372] Wang, Q. et al. Tumor Evolution of Glioma-Intrinsic Gene ExpressionSubtypes Associates with Immunological Changes in the Microenvironment. Cancer Cell 32, 42-56.e46 (2017).

[0373] Wang, Q. et al. Tumor Evolution of Glioma-Intrinsic Gene ExpressionSubtypes Associates with Immunological Changes in the Microenvironment. Cancer Cell 32, 42-56.e46, doi:10.1016 / j.ccell.2017.06.003 (2017).

[0374] Wang, R., Wan, Q., Kozhaya, L., Fujii, H. & Unutmaz, D.Identification of a regulatory T cell specific cell surface molecule thatmediates suppressive signals and induces Foxp3 expression. PLoS One 3, e2705,doi:10.1371 / journal.pone.0002705 (2008).

[0375] Xu, H. et al. ITGB2 as a prognostic indicator and a predictive markerfor immunotherapy in gliomas. Cancer Immunology, Immunotherapy 71, 645-660(2022).

[0376] Yang, X. J. et al. TGF-β1 enhances tumor-induced angiogenesis via JNKpathway and macrophage infiltration in an improved zebrafish embryo / xenograftglioma model. Int Immunopharmacol 15, 191-198 (2013).

[0377] Zhang, C. et al. TGF-β2 initiates autophagy via Smad and non-Smadpathway to promote glioma cells’ invasion. Journal of Experimental & Clinical Cancer Research 36, doi:10.1186 / s13046-017-0628-8 (2017).

[0378] Zhang, P., Xia, Q., Liu, L., Li, S. & Dong, L. Current Opinion onMolecular Characterization for GBM Classification in Guiding ClinicalDiagnosis, Prognosis, and Therapy. Front Mol Biosci 7, 562798, doi:10.3389 / fmolb.2020.562798 (2020).

[0379] Zhang, X. et al. Increased Expression of GARP in Papillary ThyroidCarcinoma. Endocrine Pathology 30, 1-7 (2019).

[0380] Zhang, Y. et al. Comprehensive transcriptomic characterizationreveals core genes and module associated with immunological changes via 1619samples of brain glioma. Cell Death Dis 12, 1140 (2021).

[0381] Zimmer, N. et al. GARP as an Immune Regulatory Molecule in the TumorMicroenvironment of Glioblastoma Multiforme. Int J Mol Sci 20, doi:10.3390 / ijms20153676 (2019).

Claims

1. A chimeric antigen receptor (CAR) immune cell comprising an anti-glycoprotein A repeat dominant protein (GARP) binding molecule.

2. The CAR immune cell according to claim 1, wherein the anti-GARP binding molecule comprises i) variable heavy chain (VH) complementarity-determining regions 1 (CDR1), 2 and 3 as shown in SEQ ID NO: 1, 2 and 3 respectively, and ii) variable light chain (VL) complementarity-determining regions 1 (CDR1), 2 and 3 as shown in SEQ ID NO: 4, 5 and 6 respectively.

3. The CAR immune cells according to claim 1 or 2, wherein the anti-GARP binding molecule comprises a V-type antibody to a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. L Structural domain.

4. The CAR immune cell of claim 3, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO:7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

5. CAR immune cells according to any one of claims 1 to 4, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO:

9. H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH1VL1), as shown in SEQ ID NO: 9, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO:11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3).

6. The CAR immune cell according to any one of claims 1 to 5, wherein the immune cell includes T cells, B cells, NK cells, NK T cells or macrophages.

7. The CAR immune cell according to claim 6, wherein the immune cell is a T cell.

8. The CAR immune cell according to any one of claims 1 to 7, wherein the CAR further comprises a CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domain.

9. A method for treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of CAR immune cells according to any one of claims 1 to 8.

10. A method of treating a subject with cancer, comprising administering to the subject a therapeutically effective amount of chimeric antigen receptor (CAR) immune cells containing an anti-glycoprotein A repeat dominant protein (GARP) binding molecule.

11. The method of treating cancer according to claim 10, wherein the anti-GARP binding molecule comprises i) variable heavy chain (VH) complementarity determination regions 1 (CDR1), CDR2, and CDR3 as shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively, and ii) variable light chain (VL) complementarity determination regions 1 (CDR1), CDR2, and CDR3 as shown in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

12. The method of treating cancer according to claim 10 or 11, wherein the anti-GARP binding molecule comprises a V-type antibody to a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. L Structural domain.

13. The method of treating cancer according to claim 12, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

14. The method of treating cancer according to any one of claims 10 to 13, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO:

9. H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH1VL1), as shown in SEQ ID NO: 9, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3).

15. The method of treating cancer according to any one of claims 10 to 14, wherein the immune cells include T cells, B cells, NK cells, NK T cells or macrophages.

16. The method of treating cancer according to claim 15, wherein the immune cell is a T cell.

17. The method of treating cancer according to any one of claims 9 to 16, wherein the CAR further comprises a CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signal transduction domain.

18. The method of treating cancer according to any one of claims 9 to 17, wherein the regulatory T cells (Tregs) in the cancer and / or tumor microenvironment (TME) are GARP positive.

19. The method of treating cancer according to any one of claims 9 to 18, wherein the cancer is glioblastoma, bladder cancer, breast cancer, or leukemia.

20. The method of treating cancer according to any one of claims 9 to 19, wherein the CAR immune cells are administered systemically.

21. The method of treating cancer according to any one of claims 9 to 20, wherein the CAR immune cells are administered intravenously, intradermally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, or locally.

22. The method of treating cancer according to any one of claims 9 to 21, wherein the CAR immune cells are administered intratumorally.

23. The method of treating cancer according to any one of claims 9 to 22, further comprising administering an anticancer therapy to the subject and / or administering an anticancer agent to the subject.

24. A method for modulating immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of a subject's cancer, comprising administering to the subject a therapeutically effective amount of CAR immune cells according to any one of claims 1 to 8.

25. A method of modulating immunosuppressive regulatory T (Treg) cells in the tumor microenvironment (TME) of a subject's cancer, comprising administering to the subject a therapeutically effective amount of chimeric antigen receptor (CAR) immune cells containing an anti-glycoprotein A repeat dominant protein (GARP) binding molecule.

26. The method of regulating immunosuppressive Treg cells in a cancer TME according to claim 25, wherein the anti-GARP binding molecule comprises i) variable heavy chain (VH) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 1, 2, and 3, respectively, and ii) variable light chain (VL) complementarity-determining regions 1 (CDR1), 2, and 3 as shown in SEQ ID NO: 4, 5, and 6, respectively.

27. The method of regulating immunosuppressive Treg cells in a cancer TME according to claim 25 or 26, wherein the anti-GARP binding molecule comprises a V-type antibody to a humanized PIIO-1 (huPIIO-1) antibody as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. H The domain and / or the V of the huPIIO-1 antibody as shown in SEQ ID NO: 11, 12 or 13 L The structural domains are at least approximately 80%, 90%, 95%, 98%, or 99% identical to V. L Structural domain.

28. The method of modulating immunosuppressive Treg cells in a cancer TME according to claim 27, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO: 7, 8, 9 or 10. H The structural domain and / or the V as shown in SEQ ID NO: 11, 12 or 13 L Structural domain.

29. The method of regulating immunosuppressive Treg cells in a cancer TME according to any one of claims 25 to 28, wherein the anti-GARP binding molecule comprises V as shown in SEQ ID NO:

9. H The structural domain and V as shown in SEQ ID NO:12 L The structural domain (VH1VL1), as shown in SEQ ID NO: 9, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH1VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH2VL1), SEQ ID NO: 9, and V as shown in SEQ ID NO: 11 L The structural domain (VH1VL3), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH2VL2), as shown in SEQ ID NO: 10, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH2VL3), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH3VL1), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH3VL2), as shown in SEQ ID NO: 8, is V H The structural domain and V as shown in SEQ ID NO: 11 L The structural domain (VH3VL3), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 12 L The structural domain (VH4VL1), as shown in SEQ ID NO: 7, is V H The structural domain and V as shown in SEQ ID NO: 13 L The structural domain (VH4VL2) or V as shown in SEQ ID NO: 7 H The structural domain and V as shown in SEQ ID NO: 11 L Structural domain (VH4VL3).

30. The method of regulating immunosuppressive Treg cells in a cancer TME according to any one of claims 25 to 29, wherein the immune cells include T cells, B cells, NK cells, NK T cells, or macrophages.

31. The method for regulating immunosuppressive Treg cells in the TME of cancer according to claim 30, wherein the immune cells are T cells.

32. The method of regulating immunosuppressive Treg cells in a cancer TME according to any one of claims 25 to 31, wherein the CAR further comprises a CD28, 41BB, OX40, Myd88, ICOS, CD2, CD226, BAFF-R, TACI, or IL2RB signaling domain.

33. The method for regulating immunosuppressive Treg cells in a tumor microenvironment (TME) according to any one of claims 24 to 32, wherein the regulatory T cells (Tregs) in the tumor microenvironment (TME) are GARP positive.

34. The method of regulating immunosuppressive Treg cells in a cancer TME according to any one of claims 24 to 33, wherein the cancer is glioblastoma, bladder cancer, breast cancer, or leukemia.

35. The method of regulating immunosuppressive Treg cells in the TME of cancer according to any one of claims 24 to 34, wherein the CAR immune cells are administered intratumorally.

Citation Information

Patent Citations

  • PD-1 binding proteins

    US20110008369A1

  • Power amplifier

    US20140022021A1

  • Macrocyclic inhibitors of the PD-1 / PD-l1 and CD80(b7-1) / PD-l1 protein / protein interactions

    US20140294898A1

  • Apparatus for continuously melting of metal

    US3610795A

  • Solid phase anti-C3 assay for detection of immune complexes

    US4342566A