Monoclonal antibodies against monkey immunoglobulin d, antibody conjugates and uses thereof

Abstract

This invention belongs to the field of antibody preparation technology, and particularly relates to monoclonal antibodies against monkey immunoglobulin D, antibody conjugates, and their applications. The amino acid sequences of CDR1-3 on the light chain variable region of the monoclonal antibody are shown in SEQ ID NO. 3-5, and the amino acid sequences of CDR1-3 on the heavy chain variable region are shown in SEQ ID NO. 8-10. The monoclonal antibody strain provided by this invention can specifically react with naturally expressed IgD in cells, exhibiting high binding sensitivity and suitable affinity. It can achieve accurate detection at the single-cell level and meets the requirements of multicolor flow cytometry detection. The detection results show a high degree of agreement with actual conditions, providing a high-performance and practical tool for the clinical diagnosis and scientific research detection of monkey IgD expression levels. It is suitable for the construction of cell or tissue immunobiopsy techniques, and particularly meets the application requirements of flow cytometry analysis.

Description

Technical Field

[0001] This invention relates to the field of antibody preparation technology, and in particular to monoclonal antibodies against simian immunoglobulin D, antibody conjugates, and their applications. Background Technology

[0002] B lymphocytes transform into plasma cells upon antigen stimulation, producing antibodies that specifically bind to the corresponding antigens, called immunoglobulins (Ig). There are five types of immunoglobulins in human blood: IgM, IgG, IgA, IgE, and IgD. IgD is mainly found on the surface of mature B lymphocytes. Immunoglobulin D (IgD) consists of two heavy chains (δ chains) and two light chains, and has a monomeric structure with a molecular weight of approximately 180-185 kDa. The molecular structure of IgD is very similar to that of IgG, with a distinct hinge region and multiple N-glycosylation sites and O-glycosylation sites, which facilitate antigen binding. However, this also makes it highly susceptible to degradation by proteases, producing Fab and Fc fragments, resulting in a very short half-life in vivo, only about 2.8 days. IgD exists mainly in two forms: transmembrane IgD (mIgD), which is expressed on the surface of mature B lymphocytes as an antigen receptor and is usually co-expressed with IgM; and secretory IgD (sIgD), which is present in very low amounts in serum, accounting for only 0.2%-0.25% of total immunoglobulins. Secretory IgD is mainly produced by plasma cells in the upper respiratory tract mucosa and can be detected in blood, saliva, tears, nasal secretions, and respiratory secretions.

[0003] As part of the B cell receptor, IgD can specifically recognize and bind to antigens, initiating B cell activation signaling pathways and thus participating in B cell recognition and activation of antigens. IgD also plays a crucial regulatory role in B cell development, influencing various stages of B cell development from progenitor cells in the bone marrow to mature B cells, and participating in the regulation of B cell survival, proliferation, and differentiation fate. IgD also participates in the formation of immune tolerance and immune regulation, helping to maintain the balance and stability of the immune system. IgD abnormalities are commonly seen in various diseases, including immune system disorders, infections, autoimmune diseases, and certain genetic diseases. Typical diseases include IgD-type multiple myeloma, chronic osteomyelitis, epidemic hemorrhagic fever, cirrhosis, allergic diseases, Hashimoto's thyroiditis, and viral infections. In summary, changes in IgD expression can be used to assess B cell activation and immune cell differentiation (such as flow cytometry sorting of IgM). + IgD + Phenotype of mature B cells or IgD - Phenotypic memory B cells are important indicators of the establishment of immune tolerance; on the other hand, they also have important diagnostic value in many diseases.

[0004] The immune systems of monkeys (especially non-human primates such as rhesus monkeys and cynomolgus monkeys) are highly homologous to those of humans, making them the most ideal animal models for studying the physiological function of human IgD in vivo and exploring potential therapeutic strategies targeting IgD or its receptors. Currently, scientific research and clinical diagnosis related to IgD are receiving increasing attention, and the demand for immunoassay of IgD in monkey-derived cells and tissue samples is steadily increasing.

[0005] In the field of cell and tissue analysis, flow cytometry (FC) is primarily used to identify cell subpopulations. FC, as a highly efficient and precise single-cell analysis technique, can accurately distinguish different immune cell subpopulations and their surface molecular expression characteristics, making it a core tool for basic immunological research, disease model monitoring, and preclinical drug evaluation. The application of flow cytometry relies on flow cytometry antibodies that specifically recognize simian IgD. However, existing technologies have limited antibodies for detecting simian IgD, especially those suitable for flow cytometry, and most are polyclonal antibodies. These antibodies generally suffer from insufficient specificity and low quantitative sensitivity. During flow cytometry detection, due to the low content of the target antigen and numerous interfering factors, low antibody specificity easily leads to non-specific binding, resulting in severe background interference and a high false positive rate. Low sensitivity prevents accurate identification of simian IgD, causing cell clustering failure (lack of specific signal). Therefore, few monoclonal antibodies on the market meet the requirements of FC analysis, and most antibodies fail to meet the precise analysis needs at the single-cell level. Therefore, developing novel IgD antibodies with high specificity and / or sensitivity has become a pressing technical problem for those skilled in the art. Summary of the Invention

[0006] To address the technical problems of existing flow cytometry antibodies targeting monkey IgD, such as tool scarcity, poor specificity, low sensitivity, and / or insufficient adaptability, this invention provides a monoclonal antibody against monkey immunoglobulin D with high specificity, good affinity, high sensitivity, and adaptability for flow cytometry detection. Furthermore, it provides an antibody-drug conjugate (ADC) between this monoclonal antibody and a detection marker, and further provides the application of this antibody and its ADC in the preparation of a monkey immunoglobulin D immunoassay kit, as well as related immunoassay kits. To achieve the aforementioned objectives, this invention specifically utilizes the following technical solutions:

[0007] The first aspect of the present invention provides a monoclonal antibody against monkey immunoglobulin D, comprising a light chain variable region and a heavy chain variable region, wherein the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region are shown in SEQ ID NO. 3-5, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO. 8-10, respectively.

[0008] Furthermore, the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7.

[0009] Furthermore, the amino acid sequence of the light chain of the monoclonal antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6.

[0010] Furthermore, the monoclonal antibody is a full-length antibody or its antigen-binding region; the antigen-binding region is selected from at least one of the Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment, and sc(Fv)2 fragment.

[0011] A second aspect of the present invention provides an antibody conjugate comprising a monoclonal antibody against simian immunoglobulin D as described above and a detection marker linked to said monoclonal antibody.

[0012] Furthermore, the detection marker is a fluorescent dye.

[0013] A third aspect of the present invention provides a nucleic acid molecule, a recombinant vector comprising the nucleic acid molecule, or a host cell comprising the nucleic acid molecule, wherein the nucleic acid molecule encodes a monoclonal antibody against simian immunoglobulin D as described above.

[0014] The fourth aspect of the present invention provides the use of the monoclonal antibody or antibody-conjugate against monkey immunoglobulin D as described above in the preparation of a monkey immunoglobulin D immunoassay kit.

[0015] Furthermore, the immunoassay kit is a flow cytometry kit.

[0016] Furthermore, the monkey immunoglobulin D is rhesus monkey or cynomolgus monkey immunoglobulin D.

[0017] The fifth aspect of the present invention provides a monkey immunoglobulin D immunoassay kit, the immunoassay kit comprising a monoclonal antibody or antibody-drug conjugate against monkey immunoglobulin D as described above.

[0018] The advantages and positive effects of this invention are as follows:

[0019] The monoclonal antibody strain provided by this invention can specifically react with naturally expressed IgD in cells, exhibiting high binding sensitivity and suitable affinity. It shows no cross-reactivity or weak non-specific binding to non-target proteins on cells, effectively ensuring that the detection signal originates from the target protein. This improves the signal-to-noise ratio of the detection results and enhances the reliability and credibility of cell and tissue biopsy results. It enables accurate detection at the single-cell level and meets the requirements of multicolor flow cytometry. The detection results show a high degree of agreement with actual conditions, providing a high-performance and practical tool for the clinical diagnosis and scientific research testing of monkey IgD expression levels. It is suitable for constructing immune biopsy techniques for cells or tissues, and is particularly suitable for flow cytometry analysis. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This is a graph showing the results of serum titer detection after immunizing New Zealand white rabbits with cynomolgus monkey immunoglobulin D in Example 1 of the present invention.

[0022] Figure 2 The flow cytometry histogram of immunoglobulin D in peripheral blood mononuclear cell samples from cynomolgus monkeys was used to detect immunoglobulin D in New Zealand white rabbits after immunization with cynomolgus monkey immunoglobulin D in Example 1 of the present invention.

[0023] Figure 3 This is a vector map of pBR322, the expression vector used to construct an anti-monkey immunoglobulin D monoclonal antibody in Example 1 of the present invention. From left to right, the vectors pre-loaded with the antibody light chain constant region and heavy chain constant region are shown.

[0024] Figure 4 This is a flow cytometry scatter plot of immunoglobulin D in peripheral blood mononuclear cell samples of cynomolgus monkeys, as shown in Example 2 of the present invention, using a combination of anti-monkey immunoglobulin D monoclonal antibody and anti-CD19 antibody.

[0025] Figure 5 The flow cytometry scatter plot for Example 2 of this invention, which uses anti-monkey immunoglobulin D monoclonal antibody in combination with anti-CD19 antibody to detect immunoglobulin D in peripheral blood mononuclear cell samples of rhesus monkeys. Detailed Implementation

[0026] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0027] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0028] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0029] Additionally, it should be noted that, unless otherwise defined, the scientific and technical terms used in the context of this invention should have the meanings commonly understood by those skilled in the art.

[0030] The terms “including,” “contains,” “includes,” “has,” and similar words are non-restrictive and can include other steps and other components that do not affect the result.

[0031] The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0032] The terms "rabbit monoclonal antibody," "monoclonal antibody," "rabbit-derived antibody," and "monoclonal antibody" have the same meaning; unless otherwise specified, they all refer to antibodies that specifically bind to monkey immunoglobulin D. The terms "Immunoglobulin D," "IgD," and "immunoglobulin D" also have the same meaning. The modifier "rabbit" indicates that the antibody's complementarity-determining region (CDR) is derived from a rabbit-derived immunoglobulin sequence.

[0033] An antibody is an immunoglobulin molecule that specifically binds to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In this invention, the term "antibody" should be interpreted in the broadest sense and includes various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, provided they exhibit the desired antigen-binding activity. An antibody fragment may be one or more portions or fragments of a full-length antibody, retaining the antibody's ability to specifically bind to a target antigen.

[0034] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be classified into two types: κ chains and λ chains; heavy chains can be classified into five types: μ, δ, γ, α, and ε chains, with antibodies defined as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of both the heavy and light chains vary considerably, while the amino acid sequences of other parts remain relatively constant. The regions of the light and heavy chains with significant amino acid sequence variation near the N-terminus are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and light chain (VL) are typically the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable region, also known as the complementarity-determining region (CDR), is a ring structure. Heavy chain CDRs and light chain CDRs are tightly joined together by the FR region and cooperate to form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the antibody's specificity and serving as the site for antibody recognition and antigen binding. The FR regions are the more conserved parts of the VH and VL, generally exhibiting a β-sheet configuration, linked by three CDRs forming a connecting loop. Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0035] CDRs and FRs can be identified according to Kabat definitions, Chothia definitions, the sum of Kabat and Chothia definitions, AbM definitions, contact definitions, IMGT unique numbering definitions and / or conformational definitions, or any CDR determination method known in the art. As used in this invention, they are defined by the Kabat numbering system.

[0036] The light chain constant region (CL) and heavy chain constant region (CH) do not directly participate in antibody-antigen binding, but they exhibit different effector functions, such as participating in antibody-dependent cell-mediated cytotoxicity (ADCC). The CL lengths of different Ig types (κ or λ) are generally consistent, but the CH lengths differ among Ig classes. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well-known in the art and can be obtained by searching the IMGT database.

[0037] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-type molecular structure. Therefore, in the context of this invention, "full-length antibody," "complete antibody," and "Y-type antibody" have the same meaning and can be used interchangeably.

[0038] An antibody fragment is one or more portions or segments of a full-length antibody that substantially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR region as the full-length antibody, and more preferably the same variable region, thereby retaining complete antigen recognition and binding sites, enabling it to bind to the same antigens, especially the same epitopes, as the full-length antibody. Typical examples of antibody fragments include Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2, which can be obtained using conventional techniques in the art.

[0039] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable region and constant region) and a portion of a heavy chain (variable region and first constant region). Fragments such as Fab, F(ab')2, and Fab' can be obtained by protease digestion of a full-length antibody. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab')2 fragment and one pFc' fragment. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab possesses an antigen-binding region and a portion of a constant region, it not only has antibody-antigen affinity and excellent tissue penetration like scFv, but also has a more stable structure.

[0040] (ii) F(ab)2: contains a bivalent segment consisting of two Fabs connected by a disulfide bridge in the hinge region.

[0041] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment. It contains only the variable region and consists of a variable region of one light chain and one heavy chain. It is a non-covalently bound dimer of VH and VL (VH-VL dimer). The three CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind antigens, although the affinity is lower than that of the intact antibody.

[0042] (iv) (Fv)2: Consists of two Fv segments covalently linked together.

[0043] (v) scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) linked by a flexible linker (typically composed of 10-25 amino acids). It retains the original antibody's specificity for binding to the antigen. In this invention, the linker is not particularly limited as long as it does not interfere with the expression of the antibody variable regions linked to its two ends. Compared to full-length antibodies, scFv has a smaller molecular weight, thus exhibiting higher penetration and lower immune side effects.

[0044] (vi)sc(Fv)2 segment is formed by connecting two heavy chain variable regions and two light chain variable regions through a joint, etc.

[0045] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may include a CDR region and a FR region derived from a rabbit immunoglobulin sequence. In other embodiments, the antibody may contain amino acid residues encoded by a non-rabbit immunoglobulin sequence, such as humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection response while maintaining the desired specificity and affinity. The term "chimeric antibody" refers to an antibody in which a portion is derived from a specific source or species, while the remainder is derived from a different source or species. The term "humanized antibody" is a chimeric antibody containing the CDR region of a non-human antibody, such as a rabbit antibody, and a FR region derived from a human antibody. In some cases, the variable region of the non-human antibody binds to the constant region of a human antibody, such as in human-rabbit chimeric antibodies; in other cases, the CDR region of the non-human antibody binds to both the FR region and the constant region derived from a human antibody sequence, i.e., grafting the CDR region of the non-human antibody onto a human antibody frame (FR) sequence derived from the FR sequence of one or more other human antibody variable regions. In this invention, the CDR region in the chimeric antibody or humanized antibody is derived from the rabbit CDR region.

[0046] The terms "monoclonal antibody," "monoclonal antibody," or "antibody" are used interchangeably to refer to a homogeneous group of antibodies, meaning that the individual antibodies constituting the group are identical except for a small number of naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation). A "monoclonal antibody" is highly specific, exhibiting a single binding specificity and affinity for the same or substantially identical epitopes on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous group of antibodies and should not be interpreted as limiting the source or method of preparation of the antibody. This antibody can be prepared by a variety of methods, including but not limited to hybridoma, phage display, yeast display, recombinant DNA, single-cell screening, or single-cell sequencing.

[0047] The term “specific binding” is a well-known term in the art. A molecule exhibits “specific binding” if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity for a particular target antigen or epitope than it reacts with other target antigens or epitopes. “Specific binding”, or “preferred binding”, does not necessarily require (although may include) exclusive binding.

[0048] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0049] This invention provides a monoclonal antibody against monkey immunoglobulin D, comprising a light chain variable region and a heavy chain variable region. Both the light chain and heavy chain variable regions include three complementarity-determining regions (CDRs), named CDR1, CDR2, and CDR3, respectively. The amino acid sequences of CDR1, CDR2, and CDR3 in the light chain variable region are shown in SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 in the heavy chain variable region are shown in SEQ ID NO. 8, SEQ ID NO. 9, and SEQ ID NO. 10, respectively.

[0050] The monoclonal antibody strain provided by this invention can specifically target immunoglobulin D (IgD) in its native conformation on the cell surface, and is suitable for the construction of cell or tissue immunobiopsy techniques, especially for flow cytometry analysis. A flow cytometry detection system for monkey peripheral blood mononuclear cells (PBMCs) was constructed using the fluorescein-labeled antibody of this invention and the CD19 antibody (a B cell surface marker) as detection antibodies. The results show that the antibody of this invention can specifically react with naturally expressed IgD on cells, exhibiting high binding sensitivity and suitable affinity. It also shows no cross-reactivity or weak non-specific binding to non-target proteins on cells, effectively ensuring that the detection signal originates from the target protein. This improves the signal-to-noise ratio of the detection results and enhances the reliability and credibility of cell tissue biopsy results. It enables accurate detection at the single-cell level and meets the requirements of multicolor flow cytometry. The detection results show a high degree of agreement with actual conditions, providing a high-performance and practical tool for the clinical diagnosis and scientific research detection of monkey IgD expression levels. This fills the gap in monkey-derived IgD detection tools and has significant application value in the fields of immune cell subset typing and B cell development, mucosal immunity, autoimmune disease mechanisms, and preclinical evaluation of vaccines and antibody drugs. It is conducive to promoting the development of basic and medical research related to monkey IgD.

[0051] Optionally, both the light chain variable region and the heavy chain variable region include four frame regions (FRs), which are arranged in an alternating sequence with three core parameters (CDRs) to form the variable region. The amino acid sequence of the antibody light chain variable region (VL) of the present invention is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.7.

[0052] Optionally, the monoclonal antibody of the present invention further includes a light chain constant region (CL) and a heavy chain constant region (CH), where CL and VL constitute the complete light chain (FL), and CH and VH constitute the complete heavy chain (FH). The constant regions of the antibody are usually obtained by querying the IMGT online database, for example: by searching for rabbit-derived IgG gamma C reign in the IMGT online database (www.imgt.org) to obtain CH, and by searching for rabbit-derived IgG Kappa C reign to obtain CL.

[0053] Specifically, the amino acid sequence of the light chain of the monoclonal antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6.

[0054] It should be noted that the monoclonal antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or the antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially retains the same biological function or activity as the full-length form. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining an intact antigen recognition and binding site, capable of binding to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antigen-binding regions can be obtained by conventional techniques in the art.

[0055] Another embodiment of the present invention provides an antibody conjugate comprising a monoclonal antibody against simian immunoglobulin D as described above and a detection marker linked to the monoclonal antibody.

[0056] The detection markers are used to generate identifiable signal changes to identify the antibodies of the present invention based on these signal changes, thereby identifying the expression of IgD in the sample to be tested through a specific antigen-antibody reaction. Detection markers include, but are not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazineamine fluorescein, dansyl chloride), fluorescent proteins (such as isophycocyanin, phycoerythrin, PerCP, and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, and avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies, or combinations thereof.

[0057] It is important to emphasize that the antibodies of this invention can be used alone or linked (covalently or non-covalently) with detection markers to form antibody-conjugates. In some embodiments, the antibodies of this invention are used as antigen-binding (or capture) antibodies that specifically recognize and bind to IgD in the sample to be tested. IgD is then qualitatively or quantitatively detected by analyzing the signal of the detection marker linked to it, such as the FC detection system established in Example 2 of this invention below. In other embodiments, the anti-IgD antibody (as a primary antibody or capture antibody) is not labeled, but the detection marker is coupled to a secondary antibody (as a detection antibody) or other molecules that can bind to the primary antibody. For example, if the anti-IgD antibody is a rabbit-derived IgG antibody, then the secondary antibody can be an anti-rabbit IgG antibody. Thus, IgD is qualitatively or quantitatively detected by analyzing the change in the detection marker signal generated after the secondary antibody specifically binds to the antibody of this invention, such as the FC and ELISA detection system established in Example 1 of this invention below.

[0058] Optionally, the detection marker is a fluorescent dye.

[0059] The general preparation method of antibody conjugates includes: reacting the active group (such as isothiocyanate, NHS ester, maleimide) of fluorescent dye (such as FITC, APC, Cy3 / Cy5, PE, ABflo®647, ABflo®488, ABflo®594, PE) with the amino group of the lysine residue or the thiol group of the cysteine ​​residue of the monoclonal antibody to form a stable covalent bond, so that the antibody retains the antigen specificity while generating a detectable signal; the reaction types include but are not limited to: nucleophilic addition reaction of isothiocyanate with amino group, amidation reaction of NHS ester with amino group, for details please refer to the literature "BRINKLEY M. A brief survey of methods for preparing protein conjugates with dyes, haptens, and cross-linking reagents[J]. Bioconjugate Chemistry, 1992, 3(1): 2-13.".

[0060] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the nucleic acid molecule, or a host cell containing the nucleic acid molecule, wherein the nucleic acid molecule encodes a monoclonal antibody against monkey immunoglobulin D as described above.

[0061] Nucleic acid molecules can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be a coding strand or a non-coding strand.

[0062] The sequence of a nucleic acid molecule can be derived from the antibody AA sequence using conventional methods such as codon coding rules. The full-length sequence of a nucleic acid molecule or its fragments can usually be obtained using PCR amplification, recombination, or artificial synthesis.

[0063] For example, the nucleic acid sequence of the antibody light chain variable region is as shown in SEQ ID NO.12 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain variable region is as shown in SEQ ID NO.14 or a complementary sequence thereto.

[0064] For example, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.11 or a complementary sequence thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.13 or a complementary sequence thereto.

[0065] Those skilled in the art will understand that, due to the degeneracy of the genetic code, nucleic acid molecules other than those in the above examples can also encode the antibodies of the present invention. Therefore, the nucleic acid molecules in the above examples should not be regarded as limiting the scope of protection of the present invention.

[0066] The original vector used to construct the recombinant vector can be any vector conventional in the art, as long as it can contain the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1, and M13), viscera, and mini-chromosomes. The vector can be a cloning vector (i.e., used to transfer nucleic acid molecules into a host and multiply them in host cells) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule, which is then introduced into a host cell and cultured under specific conditions to express and obtain an antibody. This is a well-known technique in the art and will not be described in detail here.

[0067] The nucleic acid molecules encoding the monoclonal antibodies FL and FH of this invention can be inserted into two vectors, which can be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain can be isolated from the host cell expressing it, and the isolated heavy and light chains can be mixed and incubated under suitable conditions to form antibodies. In other embodiments, the nucleic acid molecules of antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence ligated downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy and light chains can be operatively ligated to different promoters, or the nucleic acid sequences encoding the heavy and light chains can be operatively ligated to a single promoter, such that both the heavy and light chains can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibodies.

[0068] Recombinant vector transfection or transformation into host cells is performed using conventional techniques. When the host is a prokaryote such as *E. coli*, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2; alternatively, microinjection, electroporation, or liposome packaging can be used. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or gene gun bombardment.

[0069] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in this invention include, but are not limited to, *Escherichia coli* (e.g., DH5α, JM109, BL21, W3110), *Bacillus* spp. (e.g., *Bacillus subtilis*, *Bacillus thuringiensis*), *Enterobacterium* strains (e.g., *Salmonella typhimurium*, *Serratia marcescens*), and *Pseudomonas* spp. Examples of eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining host cells transfected or transformed with the recombinant vector described above, they can be cultured under suitable conditions to express antibodies, which can then be isolated to obtain purified antibodies.

[0070] In a preferred embodiment, the recombinant vector described above is the mammalian expression vector pBR322, and the host cell is human renal epithelial cells (293F cells).

[0071] In a typical implementation, the method for preparing the monoclonal antibody includes: tandemly loading the heavy chain gene, light chain gene, and signal peptide of the antibody onto the expression vector pBR322, co-transfecting 293F cells, culturing the 293F cells, collecting the cell culture supernatant, and purifying it to obtain the target antibody strain. The selection of the signal peptide is designed based on the host cell, and this invention does not have any particular limitations in this regard.

[0072] Another embodiment of the present invention provides the application of the monoclonal antibody or antibody-drug conjugate against monkey immunoglobulin D as described above in the preparation of a monkey immunoglobulin D immunoassay kit.

[0073] The advantages of using the monoclonal antibody or antibody-drug conjugate against monkey immunoglobulin D in the preparation of monkey immunoglobulin D immunoassay kits are the same as the advantages of the monoclonal antibody against monkey immunoglobulin D over the prior art as described above, and will not be repeated here.

[0074] Based on the same inventive concept, embodiments of the present invention also provide a monkey immunoglobulin D immunoassay kit, the immunoassay kit comprising the monoclonal antibody or antibody-drug conjugate against monkey immunoglobulin D as described above.

[0075] The aforementioned immunoassay methods include, but are not limited to: enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), Western blot (WB), immunoprecipitation (IP), and flow cytometry (FC). Immunoassay kits may be ELISA kits, ELISPOT kits, immunohistochemistry kits, immunofluorescence kits, Western blot kits, or flow cytometry kits.

[0076] Preferably, the immunoassay kit is a flow cytometry kit.

[0077] Optionally, the test samples include, but are not limited to, serum, plasma, urine, cells or cell culture medium, tissue or tissue homogenate.

[0078] The monoclonal antibody of this invention exhibits cross-reactivity with monkey immunoglobulin D. Therefore, in a preferred embodiment of this invention, monkey immunoglobulin D can be rhesus monkey or cynomolgus monkey immunoglobulin D.

[0079] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0080] Example 1: Preparation of rabbit-derived antibody against monkey immunoglobulin D (IgD)

[0081] 1.1 Immunogen Preparation: The immunogen used was the 50-368aa protein fragment of the cynomolgus immunoglobulin deltaheavy chain (IGHD). The full-length IGHD protein can be found in GenBank: ABB89460.1, and the corresponding gene sequence can be found in GenBank: DQ297178.1. The gene sequence corresponding to IGHD 50-368aa was constructed into the pYURK-Chis vector, and high-quality recombinant Monkey IgD mature protein with biological activity was expressed in 293F cells. The purity of the recombinant protein was greater than 90%.

[0082] 1.2 Animal Immunization: Two New Zealand white rabbits were immunized with recombinant Monkey IgD protein at a dose of 200 μg / rabbit. Before the first immunization, the antigen was mixed with an equal volume of complete Freund's adjuvant (purchased from Sigma) to prepare an emulsion, which was injected subcutaneously at multiple sites on the rabbit's abdomen and back. Every three weeks after the first immunization, 100 μg of immunogen was mixed with an equal volume of incomplete Freund's adjuvant (purchased from Sigma) to prepare an emulsion, which was then injected subcutaneously at multiple sites on the rabbit's abdomen and back for two booster immunizations. After three immunizations, serum was diluted 1:243000 and its titer against Monkey IgD was determined by enzyme-linked immunosorbent assay (ELISA). The OD value was then collected. 450nm Rabbits with a titer greater than 0.2 were given a booster immunization with 200 μg of immunogen. Spleens were harvested three to four days later, and the final immunized serum was diluted and the affinity and specificity of the serum for the target antigen in the positive cell sample were detected by flow cytometry (FC).

[0083] The ELISA method for determining the titer of immune serum includes the following steps: 1) Coating: Add 1 μg / mL of recombinant Monkey IgD protein to 25 μL / well of a 384-well microplate and coat overnight at 4°C; 2) Blocking: Wash 5 times with 75 μL / well of washing buffer (PBS containing 0.05% (v / v) Tween-20), then add 50 μL / well of blocking buffer (PBS containing 1% BSA, 0.5% gelatin, and 5% sucrose) and incubate at room temperature for 1 h; 3) Serial dilution and loading of the serum to be tested: Repeat step 2) to wash the wells, then serially dilute the serum to be tested with dilution buffer (PBS containing 1% BSA, 0.5% gelatin, and 5% sucrose). BSA) Serum was diluted 1:1000 and then tripled 8 times. 25 μL of serum dilution was added to each well of the plate and incubated at room temperature for 1 h. 4) Secondary antibody incubation: The plate was washed using step 2), and then 25 μL of horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (purchased from Jackson Immuno Research, catalog number 111-035-045) diluted 1:5000 was added to each well and incubated at room temperature in the dark for 1 h. 5) Termination of reaction and color development: The plate was washed using step 2), and then 100 μL of TMB was added to each well for color development. The reaction was terminated by adding 0.5 M oxalic acid solution to each well. The absorbance at 450 nm was measured. Rabbit serum before immunization was used as a negative control, and the detection system without immune serum was used as a blank control (NC). A ratio of ≥2.1 between the measured value and the control value was considered positive immune serum.

[0084] The FC method for determining the recognition specificity of immune serum and positive cell samples (peripheral blood mononuclear cells (PBMCs) expressing IgD protein from cynomolgus monkeys) includes the following steps: 1) UV irradiation of a clean bench for 15-20 min, followed by 5 min of ventilation to prepare for aseptic work; 2) Collection and washing of cells, determination of total cell count, and checking cell viability to be 90%-95%; 3) Resuspending cells in 1×PBS solution to approximately 3×10⁶ cells. 6 -5×10 6 4) Distribute cells at 100 μL / well into 96-well V-plates and wash once with 1×PBS; 5) Stain with L / D staining solution (Zombie NIR, Live / Dead staining solution) from the Biolegend Zombie NIR Fixable Viability Kit (catalog number 423105). Dilute the L / D staining solution with 1×PBS at a ratio of 1:1500, and distribute 100 μL / well into each well. Resuspend the cells in the wells; 6) Wrap the cells in aluminum foil, gently mix on a microplate shaker for 15 min, then centrifuge at 400g for 5 min, discard the supernatant, and wash twice with PBS containing 0.5% bovine serum albumin (0.5% BSA / PBS); 7) Distribute 100 μL / well of the solution containing 0.5% bovine serum albumin into each well. 7) Dispense the BSA / PBS diluted immune serum (dilutions 1:500 and 1:2000) into the wells and resuspend the cells in each well; 8) Repeat step 5); 9) Add 100 μL / well of the fluorescent secondary antibody Alexa Fluor® 647 AffiniPure F(ab')2 Fragment Goat Anti-Rabbit IgG, Fc fragment specific (purchased from Jackson, Cat# 111-606-046) diluted 1:200 with 0.5% BSA / PBS into the wells and resuspend the cells in the wells; 10) Repeat step 5), then resuspend the cells in each well with 200 μL of 0.5% BSA / PBS and store in the dark; 11) Perform the analysis according to the Beckman Cytoflex Flow Cytometer Operation and Maintenance SOP-105-AND-CA-008.

[0085] Serum titer test results are shown in Figure 1 Among them, WA-64415D is the project number, and N19133 and N19134 are the rabbit numbers. The results of the binding ability assay of immune serum to IgD expressed on positive cells are shown below. Figure 2(From left to right, serum dilutions are 1:500 and 1:2000), where the red curve is the negative control, the blue curve is the isotype control (used to eliminate background staining caused by non-specific antibody binding to cells), and the yellow curve is the test serum. The horizontal axis represents the relative fluorescence intensity of the channel's fluorescence signal / scattered light signal, and the vertical axis represents the corresponding number of cells, i.e., the number of cells falling within that interval. Figure 1-2 As can be seen, the rabbits produced a strong immune response during the third and fourth booster immunizations, and the immune serum produced antibodies that specifically recognize membrane-type IgD epitopes on the surface of living cells. This was evident in the immune serum showing a 10% increase in antibody levels compared to the negative and isotype controls. 4 -10 6 The small peaks between them show obvious differences in fluorescence signal transitions. Since the positive expression rate of PBMCs is not high, its peak height is lower than the negative peak (the negative group that does not express IgD), which is normal. Therefore, the four-immune serum can be used for subsequent isolation of monoclonal antibodies.

[0086] 1.3 Isolation of B cells and sorting of antigen-specific B cells in the spleen: For relevant methods, please refer to the published patents “Method for efficient isolation of single antigen-specific B lymphocytes from spleen cells (Publication No.: CN110016462A, Publication Date: 2019-07-16)” and “An in vitro culture system for B lymphocytes and its application (Publication No.: CN111518765A, Publication Date: 2020-08-11)”.

[0087] 1.4 Cloning of the rabbit monoclonal antibody gene: B lymphocytes capable of recognizing and binding recombinant Monkey IgD protein were detected using antigen-coated ELISA. These cells were collected, lysed, and then processed with Quick-RNA. TM RNA was extracted using the Micro Prep kit (ZYMO, catalog number R1100-250) and reverse transcribed into cDNA. Using the cDNA as a template, PCR was employed to amplify and sequence the naturally paired rabbit antibody light chain variable region (VL) and heavy chain variable region (VH). The PCR reaction mixture consisted of: 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 12.5 μL 2×Gloria HiFi (ABclonal, catalog number RK20717), and 6.5 μL H2O. The PCR amplification program consisted of: 98℃ for 30 s, followed by 40 cycles of 98℃ for 10 s, 64℃ for 30 s, and 72℃ for 30 s, with a final induction at 72℃ for 5 min. The reaction mixture was stored at 4℃. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent the forward and reverse primers, respectively.

[0088] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (SEQ ID NO. 15);

[0089] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (SEQ ID NO. 16);

[0090] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (SEQ ID NO. 17);

[0091] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (SEQ ID NO. 18).

[0092] The amplified DNA product was sequenced to obtain the VL sequence shown in SEQ ID NO.2 and the VH sequence shown in SEQ ID NO.7. Then, the constant region sequence was obtained from the IMGT online database (www.imgt.org), yielding antibody 5C3 with the complete light chain (FL) shown in SEQ ID NO.1 and the complete heavy chain (FH) shown in SEQ ID NO.6. The amino acid (aa) and nucleic acid (DNA) sequences of antibody 5C3 are shown in Table 1-2. For ease of description, the light chain complementarity-determining regions CDR1-3 are denoted as LCDR1-3, and the heavy chain complementarity-determining regions CDR1-3 are denoted as HCDR1-3. The CDRs are based on the Kabat numbering system.

[0093] Table 1. Amino acid sequence of rabbit antibody 5C3 in this embodiment.

[0094]

[0095] Table 2. Gene sequence of rabbit-derived antibody 5C3 in this embodiment.

[0096]

[0097] 1.5 Expression and Large-Scale Production of Antibody 5C3: The amplified VL and VH genes described above were inserted in tandem with the light chain constant region (CL) and heavy chain constant region (CH) into an expression vector. Monoclonal antibodies were produced in large quantities through recombinant expression of the antibody genes. In this embodiment, the light chain constant region (CL) and heavy chain constant region (CH) genes were pre-inserted into the mammalian expression vector pBR322, and its expression profile is shown below. Figure 3In the figure, pBR322 origin and f1 origin are replication promoters, Ampcillin is the resistance gene, CMVpromoter is the transcription promoter, SV40 PA terminator is the tailing signal, the light chain constant is the nucleotide sequence of CL (left figure), and the heavy chain constant is the nucleotide sequence of CH (right figure). Then, the VL and VH genes were ligated to the expression vector pBR322 carrying the CL and CH genes, respectively linearized with XbaI and NheI restriction endonucleases, via homologous recombination to obtain the FL and FH gene expression vectors. Sequencing confirmed the successful construction of the vectors.

[0098] To facilitate antibody purification, a signal peptide is added upstream of the VL and VH genes to achieve secretory expression of the antibody. The signal peptide can be a commonly used antibody expression signal peptide in the field, such as the patent "Rabbit Monoclonal Antibody against Human Interferon α2 and its Application (Publication No.: CN116063487A, Publication Date: 2023-05-05)" and the patent "High Affinity Human..." The IL-5 rabbit monoclonal antibody and its application (Publication No.: CN115819578A, Publication Date: 2023-03-21) has a signal peptide "MDTRAPTQLLGLLLLWLPGARC (encoding gene ATGGACACGAGGGCCCCCACTCAGCTGCTGGGCCTGCTGCTGTTGTGGCTGCCTGGAGCCAGATGT)" upstream of VL and "METGLRWLLLVAVLKGVQC (encoding gene ATGGAGACTGGGCTGCGCTGGCTTCTCCTGGTCGCAGTGCTGAAAGGCGTGCAGTGC)" upstream of VH. Of course, those skilled in the art can replace the signal peptide with another after obtaining the antibody sequence of this invention for antibody expression; therefore, the signal peptide sequence is not shown in Table 1 of this embodiment.

[0099] The successfully constructed FL and FH expression vectors were co-transfected into 293F cells. After transfection and culture for 72-96 hours, the culture supernatant contained antibody 5C3, which recognizes recombinant Monkey IgD protein. The target antibody was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA015100). The antibody purity was verified to be ≥95% by 12% polyacrylamide gel electrophoresis (SDS-PAGE). The purified antibody was aliquoted and stored at -20°C for later use.

[0100] Example 2: Establishment and evaluation of the flow cytometry detection system for antibody 5C3.

[0101] This embodiment uses cynomolgus monkey (PBMC) and rhesus monkey (PBMC) as the detection subjects, and combines detection with anti-CD19 antibody (ABflo® 594 Rabbit anti-Human / Monkey CD19 mAb, purchased from ABclonal, catalog number A24191). IgD is a member of the immunoglobulin (Ig) family and is mainly expressed in naïve B cells. CD19, as a surface marker of B cells, is highly expressed on B cells. Using IgD and CD19 in combination to detect IgD expression on B cells can eliminate noise signals from other cells. ABflo® 647 rabbit IgG antibody (purchased from ABclonal, catalog number A22070) is used as an isotype control.

[0102] Preparation of fluorescein-conjugated antibody 5C3: ABflo® 647 fluorescein (NHS ester) was prepared into an antibody solution of 1 mg / mL using PBS. The ABflo® 647 fluorescein (NHS ester) solution was added to the antibody solution, with a fluorescein:antibody molar ratio of 15:1-25:1. The pH was adjusted to 7.5-8.5, and the reaction was carried out at room temperature in the dark for 1-2 hours. Unreacted dye was removed by dialysis to obtain ABflo® 647 fluorescein-labeled antibody 5C3.

[0103] FC detection includes the following steps: 1) Sterilize the clean bench with ultraviolet light for 15-20 minutes, turn on the fan for 5 minutes, and prepare for aseptic work; 2) Collect and wash cells, determine the total cell count, and check that the cell viability is between 90% and 95%; 3) Resuspend the cells in 1×PBS solution to approximately 3×10⁻⁶ cells. 6 -5×10 6 4) Dispense 100 μL of L / D staining solution into 96-well V-plates at a ratio of 1:1500 with 1×PBS, and dispense 100 μL of the diluted L / D staining solution into each well, resuspending the cells in the wells; 5) Wrap the cells in aluminum foil, gently mix on a microplate shaker for 15 min, then centrifuge at 400g for 5 min, discard the supernatant, and wash twice with 0.5% BSA / PBS; 6) Dispense 100 μL of the fluorescently labeled 5C3 antibody (working concentration 5 μL / Test) and anti-CD19 antibody diluted with 0.5% BSA / PBS into each well, resuspending the cells in each well; 7) Repeat step 5), then resuspend the cells in each well with 200 μL of 0.5% BSA / PBS and store in the dark; 8) Follow Beckman's instructions. Perform analysis using the Cytoflex flow cytometer in accordance with Operation and Maintenance SOP-105-AND-CA-008.

[0104] The FC detection results of PBMCs in cynomolgus macaques and rhesus macaques are shown in the following figures. Figure 4-5 The left image shows a scatter plot of double staining with ABflo® 647 isotype control and ABflo® 594 CD19 antibody, while the right image shows a scatter plot of double staining with 5C3 antibody and ABflo® 594 CD19 antibody. The horizontal axis represents the fluorescence signal of ABflo® 647 isotype control or 5C3 antibody, and the vertical axis represents the fluorescence signal of CD19 antibody. PBMCs are a population of cells with single nuclei in peripheral blood, mostly lymphocytes, with the remainder being monocytes, dendritic cells, NK cells, etc. Lymphocytes include T lymphocytes (approximately 45%-75% of PBMCs) and B lymphocytes (approximately 5%-15% of PBMCs, including mature naive B cells (IgD cells)). + (Approximately 40% of B lymphocyte subsets). The detection results of this invention show that the positive expression rate of IgD in monkey PBMC samples is approximately 6%-10% (upper right quadrant Q2), which is close to 0% compared to the IgD positive rate in the isotype control (as a negative control). The 5C3 rabbit monoclonal antibody can specifically recognize the IgD antigen in monkey PBMC samples, and the detected positive results account for a significant proportion of CD19. + The 40-50% distribution of B cells is consistent with the distribution characteristics in monkey PBMCs, indicating that the 5C3 antibody can specifically target the naturally expressed IgD antigen in cells, has high sensitivity to binding to the target antigen, and has no cross-reaction with non-target antigens. The non-specific signal is low and negligible, which can effectively distinguish between positive and negative populations and improve the signal-to-noise ratio.

[0105] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A monoclonal antibody against simian immunoglobulin D, characterized in that, It includes a light chain variable region and a heavy chain variable region. The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region are shown in SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively. The amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively.

2. The monoclonal antibody against simian immunoglobulin D according to claim 1, characterized in that, The amino acid sequence of the light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

7.

3. The monoclonal antibody against simian immunoglobulin D according to claim 2, characterized in that, The amino acid sequence of the light chain of the monoclonal antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

6.

4. The monoclonal antibody against simian immunoglobulin D according to claim 1, characterized in that, The monoclonal antibody is a full-length antibody or its antigen-binding region; the antigen-binding region is selected from at least one of the Fab fragment, F(ab)2 fragment, Fv fragment, (Fv)2 fragment, scFv fragment and sc(Fv)2 fragment.

5. An antibody conjugate, characterized in that, The invention comprises a monoclonal antibody against monkey immunoglobulin D as described in any one of claims 1-4, and a detection marker linked to the monoclonal antibody.

6. The antibody conjugate according to claim 5, characterized in that, The detection marker is a fluorescent dye.

7. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes a monoclonal antibody against monkey immunoglobulin D as described in any one of claims 1-4.

8. The use of the monoclonal antibody against monkey immunoglobulin D as described in any one of claims 1-4 or the antibody conjugate as described in any one of claims 5-6 in the preparation of a monkey immunoglobulin D immunoassay kit.

9. The application of the monoclonal antibody or antibody-conjugate against simian immunoglobulin D according to claim 8 in the preparation of a simian immunoglobulin D immunoassay kit, characterized in that, The immunoassay kit is a flow cytometry kit; The monkey immunoglobulin D mentioned is rhesus monkey or cynomolgus monkey immunoglobulin D.

10. A monkey immunoglobulin D immunoassay kit, characterized in that, Includes monoclonal antibodies against monkey immunoglobulin D as described in any one of claims 1-4 or antibody conjugates as described in any one of claims 5-6.

Images