Genomic safe harbor region of long clam for stable integration of exogenous genes and screening method

By screening oyster genome regions with low methylation and high PAM density, and combining them with CRISPR/Cas9 technology, the problem of unstable integration of exogenous genes in oysters was solved, enabling stable expression of exogenous genes and precise breeding applications.

CN122303247APending Publication Date: 2026-06-30OCEAN UNIV OF CHINA

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
OCEAN UNIV OF CHINA
Filing Date
2026-02-12
Publication Date
2026-06-30

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention belongs to the field of molecular genetics and shellfish genome engineering, and particularly relates to a safe harbor region of the oyster genome for stable integration of exogenous genes and a screening method. The safe harbor region is a region for stable integration and expression of exogenous genes, located in different chromosomal regions of the oyster genome, in a non-open chromatin state, and meeting the following conditions: (1) the region is located on chromosomes and scaffolds, and has no coding genes / lncRNAs; (2) the region has no ATAC-seq signal; (3) the region length is 5.25–14.84 kb; (4) the average methylation level of the region is 0–0.161765; (5) the PAM (NGG) density of the region is 38.68–81.35 PAM / kb. This invention provides a reproducible and scalable general technical platform for the stable expression of oyster gene knock-in fragments and the study of their gene function.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular genetics and shellfish genome engineering, and particularly relates to a Genomic Safe Harbor (GSH) region for stable integration of exogenous genes in the Pacific oyster and a screening method therefor. Background Technology

[0002] Gene knock-in (KI) technology refers to the precise integration of exogenous DNA fragments into specific sites in the genome through site-directed gene editing, thereby achieving stable expression of exogenous genes, precise modification of endogenous genes, or in-situ markers of reporter genes. Compared with traditional random integration transgenic methods, gene knock-in can significantly reduce the risk of insertional mutations and improve the predictability and genetic stability of expression, making it an important development direction in the fields of functional genomics and precision breeding. In recent years, with the maturity of programmable nuclease technologies such as CRISPR / Cas9 and TALEN, gene knock-in has been widely used in various model organisms and mammalian systems. For example, in mouse, zebrafish, and human cell lines, researchers have been able to achieve site-directed integration of exogenous genes through homology-directed repair (HDR) or non-homologous end joining (NHEJ) mediated strategies for gene function analysis, disease model construction, and the establishment of genetic marker lines. In these species, a number of widely used genomic safe harbor (GSH) sites have also been systematically identified, such as the AAVS1 site in humans, the ROSA26 site in mice, and the H11 site in pigs. These sites share the following common characteristics: (1) they are located in non-critical gene regions or functionally redundant regions; (2) after integration of exogenous genes, they do not affect the host's growth, development, and reproduction; and (3) they can support the stable expression of exogenous genes in different tissues or developmental stages. Knock-in systems based on the above-mentioned safe harbor sites have achieved high efficiency and reproducibility at the mammalian cell line and adult levels, greatly promoting the development of gene therapy, synthetic biology, and molecular breeding.

[0003] In stark contrast to the aforementioned model organisms, gene knock-in technology has not yet been systematically developed in oysters and other economically important shellfish. On the one hand, oysters lack standardized and mature germline modification technologies that have been validated over a long period, similar to those used in mice and humans. On the other hand, the oyster genome differs significantly from that of mammals in terms of structure and regulation, and exhibits rich genetic variation among different populations. These differences make it difficult to directly transfer or homologously map established "safe harbor sites" from existing species into the oyster genome, thus hindering the rapid and reliable localization of safe integration regions suitable for the long-term stable expression of exogenous genes based on existing records.

[0004] Meanwhile, current research on marine economic shellfish mainly focuses on gene knockout, while the stabilization and site-specific integration of exogenous genes still face multiple technical bottlenecks. Oysters, as a typical marine economic shellfish, play an important role in the global aquaculture industry, but their genome structure has the following significant characteristics: (1) a high proportion of repetitive sequences in the genome; (2) high heterozygosity at the population level, with high density of allelic variations; (3) a generally low level of DNA methylation, which is highly dynamic in development and environmental response; and (4) complex chromatin states, with regulatory regions showing obvious species specificity.

[0005] The aforementioned characteristics make it difficult to achieve ideal results in shellfish by directly applying gene knock-in strategies established in mammals or model organisms. Traditional random integration methods of exogenous genes in oysters generally have the following problems: (1) the insertion site is uncontrollable and easily damages endogenous genes or key regulatory elements; (2) the expression level of exogenous genes varies greatly and the stability between individuals is poor; (3) transcriptional silencing or methylation inhibition is easy to occur, making it difficult to achieve long-term expression; (4) the trait is difficult to be stably inherited, which is not conducive to breeding applications. More importantly, at present, no safe harbor sites in oysters and other shellfish have been systematically identified and verified. Existing safe harbor screening criteria are mostly based on mammalian or insect models, such as empirical rules such as "far from protein-coding genes" or "near high expression regions". However, in the genomes of shellfish with high methylation regulatory background and unique chromatin structure, these criteria are not necessarily applicable and may even lead to unstable or abnormal regulation of exogenous gene expression.

[0006] Therefore, in oysters and other shellfish, there is an urgent need to establish a gene knock-in framework that conforms to the characteristics of the shellfish genome. The core of this framework lies in systematically identifying safe genomic regions suitable for the stable integration of exogenous genes. This is not only a key prerequisite for advancing shellfish functional genomics research, but also an important technological foundation for achieving precise genetic modification, providing a new technological pathway for the precise genetic modification of oysters and other shellfish. Summary of the Invention

[0007] The purpose of this invention is to provide a Genomic Safe Harbor (GSH) region in oysters suitable for stable integration of exogenous genes and its application in precise gene knock-in genetic modification.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows: Figure 1 ): A genome safe harbor region in oysters suitable for stable integration of exogenous genes, wherein the region of stable integration and expression of exogenous genes is located in different chromosomal regions of the oyster genome, is in a closed state, and meets the following conditions; (1) This region is located on the chromosome and scaffold, and contains no coding genes / lncRNAs; (2) There is no ATAC-seq signal in this area; (3) The region length is 5.25–14.84 kb; (4) The regional average methylation level was 0–0.161765; (5) The PAM (NGG) density in this region is 38.68–81.35 PAM / kb.

[0009] This refers to the genome safe harbor region recorded in Table 1.

[0010] Furthermore, the oyster is suitable for a genomic safe harbor region for stable integration of exogenous genes. Considering both PAM density ( / kb) and methylation level (mean_mCG), the PAM density ( / kb) is greater than 50 PAM / kb, and the methylation level in the region is less than 0.03.

[0011] Specifically, firstly, intervals with mean_mCG not exceeding a threshold M are preferred within the candidate genome safe harbor region to reduce the risk of epigenetic silencing after exogenous gene integration. Then, within the set of intervals satisfying the mean_mCG threshold condition, they are sorted from high to low PAM density, and the top three are selected as priority intervals (if PAM densities are similar, the interval with lower mean_mCG is preferred). Accordingly, the first three intervals of the sites recorded in Table 1 are preferentially selected as follows: GSH-2: Chromosome / Sequence NC_047564.1, interval 13,164,362–13,174,552 bp (length 10,191 bp), PAM density 81.3543 / kb, mean_mCG 0.021978; GSH-3: Chromosome / Sequence NC_047566.1, interval 57,046,650–57,051,903 bp (length 5,254 bp), PAM density 56.3488 / kb, mean_mCG 0.001311; GSH-4: Chromosome / Sequence NC_047566.1, interval 57,022,777–57,031,016 bp (length 8,240 bp), PAM density 52.0694 / kb, mean_mCG 0.000642.

[0012] The threshold M is determined based on the statistical distribution of the candidate interval mean_mCG. Preferably, the upper quartile (Q3) of the candidate interval mean_mCG is taken and rounded up to the engineering threshold. In this embodiment, M=0.03.

[0013] A method for screening genomic safe harbor regions in oysters suitable for stable integration of exogenous genes. (1) Exclude protein-coding gene bodies and upstream and downstream ±30 kb regions from the whole genome; (2) Exclude the heat shock protein gene body and the upstream and downstream ±150 kb region; (3) Exclude the lncRNA itself and the upstream and downstream ±50 kb regions; (4) Remove the region of union with the ATAC-seq peak; (5) Retain segments with a length of 5–15 kb and a distance of ≥10 kb from the nearest TSS; (6) Select a region where neighboring genes are arranged in a convergent manner and the PAM density is ≥30 / kb, thus obtaining a safe harbor region for oyster genome that is suitable for the integration of exogenous genes.

[0014] Furthermore, based on the oyster reference genome (GCF_902806645.1), and combined with multidimensional data such as transcriptomics, ATAC-seq, lncRNA annotation, and gene expression profiling, the following key steps were used for screening: Initial screening of non-coding regions: Protein-coding gene bodies and their upstream and downstream ±30 kb regions were removed from the whole genome to construct the initial non-coding regions; Stress-related region exclusion: Using known heat shock protein genes, heat shock response genes within ±150 kb and their upstream and downstream regulatory regions were excluded; simultaneously, all known lncRNA regions and their ±50 kb range were removed; Chromatin active layer filtering: Based on multi-tissue and multi-condition ATAC-seq data, open chromatin signal regions (i.e., regions where peak signals were detected in any tissue / condition) were excluded, ensuring that candidate regions remained "closed" or "silent" under different physiological states; Length and structure screening: Continuous fragments of 5–15 kb in length were retained; the distance between each segment and the nearest protein-coding gene transcription start site (TSS) was calculated, requiring ≥10 kb to reduce potential promoter interference; Directionality and editability analysis: The alignment of upstream and downstream genes in candidate regions is detected, with convergent (→ ←) or parallel (→ → / ← ←) patterns preferred; simultaneously, PAM (NGG) sequences are scanned within the region, and PAM density (number per kb) is calculated, with a PAM density ≥ 30 / kb preferred to ensure efficient subsequent CRISPR / Cas editing; Methylation stability (optional sorting layer): The average methylation level (mean_mCG) and fluctuation level (e.g., sd_mCG) are calculated for the screened candidate regions, with mean_mCG ≤ 0.03 and low sd_mCG preferred. The segment is used to improve the stability of expression after integration of exogenous genes.

[0015] An application of the genomic safe harbor region of the oyster suitable for stable integration of exogenous genes, wherein the genomic safe harbor region is used for genetic modification of the oyster to achieve site-specific integration and stable expression of exogenous genes in the safe harbor region.

[0016] The safe harbor region of the genome is used to construct the basic framework for knocking in oyster characteristic genes. The basic framework includes at least homologous arms located on both sides of the safe harbor region and expression elements that are functionally linked to the characteristic genes to be knocked in.

[0017] A method for oyster genome modification, using the safe harbor region of the genome as a target site, achieves site-specific integration of exogenous sequences at the target site through gene knock-in, thereby obtaining oysters with modified genomes; the gene knock-in includes homologous recombination-mediated knock-in or CRISPR / Cas-mediated site-specific knock-in.

[0018] Advantages of this invention: This invention establishes for the first time a safe harbor screening system adapted to the oyster genome structure and epigenomic characteristics; through multi-omics hierarchical filtering and quantitative evaluation of editability, the robustness and reproducibility of the screening results are significantly improved; the obtained candidate sites are generally located in the background region where ATAC-seq peak signals are missing, with low potential regulatory interference risk and high CRISPR editing design space; it provides a general-purpose fixed-site integration platform for oyster precision breeding, stress resistance improvement, and functional gene verification; and the screening approach is transferable and can be extended to other economically important shellfish species such as scallops, clams, and mussels; furthermore, This invention constructs a safe harbor screening method for oyster genomes based on multi-omics integration analysis. Through hierarchical masking filtering and structural feature evaluation, candidate regions suitable for site-specific and stable integration of exogenous genes while reducing the risk of interference with endogenous gene expression are screened, thus obtaining a series of GSH sites with application potential. After the above multi-level screening, a total of 22 candidate GSH segments were obtained. Among them, according to the priority rule of "first satisfying the low methylation threshold (mean_mCG≤0.03), and then sorting by PAM density from high to low", the representative preferred sites include the following three segments: GSH-2: Chromosome / Sequence NC_047564.1, interval 13,164,362–13,174,552 bp (length 10,191 bp), PAM density 81.3543 / kb, mean_mCG 0.021978; GSH-3: Chromosome / Sequence NC_047566.1, interval 57,046,650–57,051,903 bp (length 5,254 bp), PAM density 56.3488 / kb, mean_mCG 0.001311; GSH-4: Chromosome / Sequence NC_047566.1, interval 57,022,777–57,031,016 bp (length 8,240 bp), PAM density 52.0694 / kb, mean_mCG 0.000642. Attached Figure Description

[0019] Figure 1 Oyster Genome Safe Harbor Screening Flowchart Figure 2 Distribution map of 21 candidate GSH loci on the oyster genome; of which only 13 loci are located on 10 assembled chromosomes, and the rest are located in the scaffold; the X-axis is the chromosome number (NC_047559.1–NC_047566.1); the Y-axis is the start and end position of the GSH loci; the color of the dots represents methylation stability (dark blue for high, light blue for low); the star symbol represents the "top ten preferred loci".

[0020] Figure 3 Schematic diagram of the ranking of methylation mean (mean_mCG) and stability (sd_mCG) of candidate GSH sites.

[0021] Figure 4 Genomic characteristics of representative GSH regions; the upper figure shows the upstream and downstream genes and their distribution in the region; the lower figure shows the integration of GSH regions and ATAC-seq.

[0022] Figure 5Schematic diagram of the integration verification of exogenous genes in representative GSH segments. Detailed Implementation

[0023] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.

[0024] Example 1: Oyster Genome Safe Harbor Screening Process This embodiment uses the oyster reference genome GCF_902806645.1 and multi-omics data for systematic screening. Figure 1 The main steps are as follows: 1) Data preparation Oyster protein-coding gene annotation files (GFF / GTF format) were used, combined with transcriptome (RNA-seq), ATAC-seq, lncRNA annotation, and a list of known HSP genes as initial input data.

[0025] 2) Constructing a non-coding search space The `bedtools slop` command is used to expand and merge the upstream and downstream 50 kb regions of each protein-coding gene obtained above. The full-length genome interval is used as the complete set, and the expanded gene intervals are subtracted to obtain `intergenic50k.bed`.

[0026] 3) Remove stress-related and regulatory active areas. Within the non-coding search space region obtained above, remove heat shock genes within ±300 kb; remove lncRNAs within ±150 kb. Then, ATAC-seq peak merging (multi-organization union) is used to perform subtraction operations to remove all segments where open signals appear.

[0027] 4) Structure and length filtering The obtained region is used to retain only continuous segments with a length of 5–15 kb, and the distance of each segment to the nearest TSS is calculated. Segments with TSS ≥ 10 kb are retained as candidate segments.

[0028] 5) Directional Analysis For each candidate segment, the arrangement direction of its upstream and downstream genes was identified: convergent (→ ←), parallel (→ →), or divergent (← →); the results showed that 68% of the candidate segments were convergent, indicating high regulatory isolation.

[0029] 6) PAM density calculation Genome sequences were extracted from each candidate region selected above, and NGG / CCN patterns were scanned; the average PAM density was 48.0 sites / kb, with the highest reaching 81.35 sites / kb, indicating that these regions have good editability potential.

[0030] 7) Results Statistics After the above screening, a total of 21 candidate GSH segments were obtained.

[0031] Example 2: The PAM density and methylation degree of the above-obtained candidate GSH site list were analyzed, and the sites were prioritized based on these two factors.

[0032] This embodiment is based on the candidate GSH site set obtained in Example 1. The candidate sites are organized and numbered, and optionally prioritized by combining methylation data, in order to obtain preferred target sites suitable for long-term stable expression (see Table 1 and ...). Figure 2 , 3).

[0033] 1) Candidate site list and numbering The candidate loci obtained through Example 1 were ordered by occurrence or by chromosomal location and numbered sequentially from GSH-1 to GSH-21. Each locus recorded at least the following information: Chromosome / sequence number (chr); start / end coordinates; length; PAM density (sites / kb); distance from the nearest upstream and downstream TSS genes; neighbor gene arrangement type; weighted CpG methylation level.

[0034] An exemplary list of candidate sites is shown in Table 1.

[0035] 2) Prioritization of PAM density and methylation When whole-genome methylation data is available, the weighted CpG methylation level (mean_mCG) within candidate GSH regions is calculated and used together with PAM (NGG) density for priority ranking. This ranking aims to simultaneously consider (I) gene editing feasibility (designability) and (II) expression stability after exogenous gene integration (reducing the risk of epigenetic silencing).

[0036] In this embodiment, a two-level decision-making strategy is preferred: First, a methylation threshold M is set to eliminate candidate regions with mean_mCG higher than the threshold M, thus avoiding the selection of regions with a significant high methylation background and a high potential risk of silencing. The threshold M can be determined based on the methylation distribution of the candidate set, preferably a threshold that covers the upper bound of the low-methylation candidate set and excludes high-methylation outliers. In this embodiment, M=0.03 is preferred. Second, within the candidate set that satisfies mean_mCG≤M, the regions are sorted from high to low PAM density, and the regions with the highest PAM density are selected as priority sites. When the PAM density difference is small (e.g., difference ≤1 PAM / kb), regions with lower mean_mCG can be further prioritized. If it is still difficult to distinguish, regions with a length within the engineering window (e.g., 5–15 kb) and that are more conducive to the construction of homologous arms and donors are preferred.

[0037] 3) Examples of preferred sites Based on the combined ranking of PAM and methylation levels, the basic information and ranking information of the 21 sites are as follows (Table 1): Example 3: CRISPR / Cas9-mediated site-directed knock-in application of the safe harbor locus NC_047561.1:1,593,775–1,608,017 in the Pacific oyster genome ( Figure 4 ,5) In this embodiment, the representative sites obtained from the above screening were selected from the Pacific oyster (Crassostrea gigas). Crassostrea gigas The GSH candidate region 1,593,775–1,608,017 bp on the reference genome chromosome sequence NC_047561.1 was selected as the target integration region for exogenous sequences. This region is approximately 14.2 kb in length, with a weighted CpG methylation level of 0.00069 and a PAM density of 50.77 / kb. Furthermore, the nearest upstream and downstream protein-coding genes are located approximately 43 kb and 88 kb away from this region, respectively, suggesting that this region does not participate in the transcriptional regulation of known protein-coding genes and is suitable as a target site for the stable integration of exogenous sequences.

[0038] 1) sgRNA target selection and cleavage site determination Within the aforementioned GSH region, a high-scoring CRISPR / Cas9 sgRNA target was selected. This sgRNA satisfies the PAM requirement of NGG, and the cleavage site is located near the center of the region to reduce boundary effects. The primary sgRNA target sequence (20 nt protospacer) selected in this embodiment is: sgRNA protospacer (20 nt): CGGTTTAACGCTCTACTACC PAM:TGG Chain direction: Negative chain (-) Cleavage site (1-based): NC_047561.1:1,600,990 The sgRNA is co-delivered with Cas9 protein or Cas9 mRNA to fertilized eggs / early embryonic cells to induce double-strand breaks (DSBs) at the target site.

[0039] 2) Overall structure and universal insertion module design of HDR donor plasmid To achieve a universal knock-in platform that allows for "unrestricted insertion of fragment X", this embodiment uses HDR donor DNA containing left and right homologous arms, and sets a universal module between the homologous arms, so that any exogenous fragment X can be inserted using standard cloning methods. The donor plasmid structure is as follows: 5' homologous arm (5'HA) – U1 – (exogenous fragment X) – U2 – 3' homologous arm (3'HA).

[0040] U1 and U2 are universal primer sites / universal ligation modules (fixed sequences) used to achieve ligation PCR identification independent of the exogenous fragment X. The universal module (for synthesizing double-stranded DNA) used in this embodiment is U1–MCS–U2, with the following sequence (72 bp): U1 (20 nt): ACGTTGACCTGATCGTACGA MCS (32 nt): GCGGCCGCGGCCGCCTTAATTAAGGCCGGCC U2 (20 nt): TGCATCGAGTCTAGCTGATC U1–MCS–U2 (72 bp): ACGTTGACCTGATCGTACGAGCGGCCGCGGCGCGCCTTAATTAAGGCCGGCCTGCATCGAGTCTAGCTGATC.

[0041] The exogenous fragment X can be an expression cassette consisting of a promoter-coding sequence-terminator / PolyA, or a reporter gene module (EGFP / mCherry / Luciferase) or other functional elements. The exogenous fragment X is cloned into the space between U1 and U2 via the MCS slot to obtain the final HDR donor plasmid.

[0042] 3) Homologous arm origin and amplification primers (for Gibson splicing) Using the genomic DNA of the Pacific oyster as a template, homologous arm fragments (preferably 800–1200 bp in length) were amplified from both sides of the cleavage site. In this embodiment, the range of homologous arms selected from both sides based on the cleavage site 1,600,990 is as follows: 5'HA section: NC_047561.1: 1,599,990–1,600,989 (approximately 1 kb) 3'HA section: NC_047561.1: 1,600,991–1,601,990 (approximately 1 kb) The primers (annealing region sequences) used to amplify the homologous arms are as follows (from Gibson_KI_kit.tsv): 5'HA amplification primers: HA5_amp_F:AGCCATGTTACACACCAGTCAA HA5_amp_R:TGCCAACTAAAGATTGTAGCTCTG The expected amplified fragment is approximately 956 bp.

[0043] 3'HA amplification primers: HA3_amp_F:CGCAGGTTTTTACGATGTTATGATG HA3_amp_R: ACCAATCAGACGTCAACTTCCT The expected amplified fragment is approximately 946 bp.

[0044] The 5'HA, U1–MCS–U2 module, 3'HA, and linearized plasmid backbone were spliced ​​together using Gibson Assembly to obtain the donor plasmid backbone (5'HA–U1–MCS–U2–3'HA). Subsequently, the exogenous fragment X was cloned between U1 and U2 to form the final donor plasmid (5'HA–U1–X–U2–3'HA).

[0045] During Gibson splicing, a 20–40 bp overlap can be added to the 5' end of the homologous arm amplification primer; the overlap with the vector end depends on the linearization method of the plasmid backbone used (which is a conventional experimental condition variable) and is unrelated to the core idea of ​​this invention.

[0046] 4) Ligation PCR and WT PCR identification strategy (exogenous fragment X independent) Genomic DNA was extracted from the obtained candidate knock-in individuals, and site-directed integration identification was performed using the following PCR combination: (1) PCR-L: Correct recombination at the 5' end (ligation PCR) Primer combination: outer genome primer + inner donor U1 primer Primer sequence for this example: PCR-L_F (genome ext upstream): ATATGACGCCCATGATCCAGTC (coordinates approximately NC_047561.1:1,599,665); PCR-L_R(U1_rc):TCGTACGATCAGGTCAACGT Expected output: approximately 1345 bp (2) PCR-R: Correct recombination at the 3' end (ligation PCR) Primer combination: donor in vivo U2 primer + genome outer primer Primer sequence for this embodiment: PCR-R_F(U2):TGCATCGAGTCTAGCTGATC PCR-R_R: AGAAATGCATGGGAGAGGACAG Expected output: approximately 1518 bp (3) PCR-WT: PCR for determining wild-type across cuts Primer combination: Genomic primers flanking the cleavage site Primer sequence for this embodiment: PCR-WT_F:GAGTACCCTTGACGCAGAGAAA PCR-WT_R:GCCTTGAAAGTATAACCACCCCA Wild-type expected product: approximately 370 bp; if knock-in occurs, it usually manifests as a change in band size, band deletion, or difficulty in amplification (depending on the length of the inserted fragment).

[0047] When a sample is positive for both PCR-L and PCR-R, and PCR-WT shows deletion or size change, it can be determined that the target site has been knocked in. If the exogenous fragment X is a reporter gene expression cassette, the exogenous expression can be further verified by fluorescence / luminescence signals.

[0048] The oyster genome safe harbor screening system proposed in this invention uses a combination of hierarchical filtering and quantitative evaluation to screen 21 candidate safe harbor sites in the oyster genome and determine the priority of utilization based on methylation stability. This technology system can provide a basic reference for the integration of exogenous genes, functional verification, and safe breeding of oysters, and also has cross-species scalability.

Claims

1. A safe harbor region for stable integration of exogenous genes into the genome of the Pacific oyster, characterized in that: The safe harbor region of the genome is a region where exogenous genes are stably integrated and expressed. It is located in different chromosomal regions of the oyster genome, is in a non-open chromatin state, and meets the following conditions; (1) This region is located on the chromosome and scaffold, and contains no coding genes / lncRNAs; (2) There is no ATAC-seq signal in this area; (3) The region length is 5.25–14.84 kb; (4) The regional average methylation level was 0–0.161765; (5) The PAM (NGG) density in this region is 38.68–81.35 PAM / kb.

2. The safe harbor region for stable integration of exogenous genes in the Crassula longifolia genome according to claim 1, characterized in that: The oyster is suitable for a genomic safe harbor region for stable integration of exogenous genes. The PAM density ( / kb) and methylation level (mean_mCG) are combined to meet the following conditions: PAM density ( / kb) is greater than 50 PAM / kb, and the methylation level in the region is less than 0.

03.

3. A method for screening safe harbor regions of the Crassula longicorn genome for stable integration of exogenous genes, as described in claim 1, characterized in that: (1) Exclude protein-coding gene bodies and upstream and downstream ±30 kb regions from the whole genome; (2) Exclude the heat shock protein gene body and the upstream and downstream ±150 kb region; (3) Exclude the lncRNA itself and the upstream and downstream ±50 kb regions; (4) Remove the region of union with the ATAC-seq peak; (5) Retain segments with a length of 5–15 kb and a distance of ≥10 kb from the nearest TSS; (6) Select a region where neighboring genes are arranged in a convergent manner and the PAM density is ≥30 / kb, thus obtaining a safe harbor region for oyster genome that is suitable for the integration of exogenous genes.

4. The application of the safe harbor region of the Crassula longifolia genome for stable integration of exogenous genes as described in claim 1, characterized in that: The safe harbor region of the genome was used for genetic modification of oysters to achieve site-specific integration and stable expression of exogenous genes in the safe harbor region.

5. The application according to claim 4, characterized in that: The safe harbor region of the genome is used to construct the basic framework for knocking in oyster characteristic genes. The basic framework includes at least homologous arms located on both sides of the safe harbor region and expression elements that are functionally linked to the characteristic genes to be knocked in.

6. A method for oyster genome modification, characterized in that: Using the genomic safe harbor region as described in claim 1 as the target site, the exogenous sequence is integrated into the target site through gene knock-in, thereby obtaining an oyster with a modified genome; the gene knock-in includes homologous recombination-mediated knock-in or CRISPR / Cas-mediated site-specific knock-in.