A method for constructing a visual mouse model of characterizing hepatocyte necroptosis
By constructing an MLKL oligomerization indicator probe system based on the principle of bimolecular fluorescence complementarity, the problem that existing ALI models cannot specifically simulate necrosis and apoptosis has been solved, enabling real-time and dynamic monitoring of hepatocyte necrosis and apoptosis, and supporting the development of targeted drugs.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ACADEMY OF MILITARY MEDICAL SCIENCES
- Filing Date
- 2026-04-20
- Publication Date
- 2026-06-30
Smart Images
Figure CN122303324A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a method for constructing a visual mouse model characterizing hepatocyte necrosis and apoptosis. Background Technology
[0002] Programmed cell death is a core biological process for maintaining homeostasis and responding to pathological stimuli. Since the concept of "apoptosis" was proposed in 1972, the scientific community has successively discovered and elucidated the molecular mechanisms of various programmed cell death modes, such as apoptosis, pyroptosis, and necrotizing apoptosis. However, in complex infectious diseases, a single death pattern is often insufficient to fully explain the molecular basis of host cell fate determination.
[0003] Necroptosis, a form of programmed necrosis, plays a crucial role in ALI. It is precisely regulated by molecules (such as RIPK1, RIPK3, MLKL, etc.) and exhibits inflammatory characteristics of necrosis, making it an important mechanism driving the progression of liver injury.
[0004] Currently, the lack of stable, reliable, and specific in vivo models that can mimic the necroptosis process in human diseases severely limits in-depth research on this death mechanism and the development of targeted drugs. While existing ALI models can induce hepatocyte death, the death mechanisms are mixed and lack specificity. There is a need to provide a method that can specifically monitor hepatic necroptosis. Summary of the Invention
[0005] The purpose of this invention is to provide a method for specifically monitoring liver necrosis and apoptosis.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a method for constructing a visual mouse model characterizing hepatocyte necrosis and apoptosis. The method involves dissecting firefly luciferase Fluc into inactive N-terminal fragments Nluc and C-terminal fragments Cluc, which are then fused and expressed at specific locations in MLKL, respectively. This results in the construction of two independent plasmid vectors, MLKL-Nluc and MLKL-Cluc. The two plasmid vectors are then injected into mouse hepatocytes via high-pressure hydrodynamic injection into the tail vein, thereby constructing the visual mouse model characterizing hepatocyte necrosis and apoptosis.
[0007] Preferably, the nucleotide sequence of the N-terminal fragment NLuc of firefly luciferase is shown in SEQ ID NO.1; The nucleotide sequence of the C-terminal fragment Cluc is shown in SEQ ID NO.2; The nucleotide sequence of MLKL is shown in SEQ ID NO.3.
[0008] Preferably, when using the high-pressure hydrodynamic injection method to infect mouse hepatocytes, the concentration of the injection solution is 4~6 μg / mL, the injection volume is 8%~10% of the mouse body weight, and the injection is completed within 3~5 seconds.
[0009] This invention provides an MLKL oligomerization-specific probe, which is composed of an MLKL-NLuc probe and an MLKL-CLuc probe.
[0010] The present invention also provides the application of the probe in drug screening for hepatocyte apoptosis.
[0011] In this invention, MLKL, as the terminal effector molecule of the necroptosis pathway, undergoes phosphorylation-induced conformational changes and subsequent oligomerization, which are key steps in executing cell membrane perforation and amplifying death signals. To capture this dynamic event in real-time and specifically at the in vivo level, overcoming the limitations of traditional methods in reflecting the formation of functional multimers, this invention designs and constructs an MLKL oligomerization indicator probe system based on the principle of bimolecular fluorescence complementation (BiFC). The core strategy of this system involves disassembling firefly luciferase (Fluc) into inactive N-terminal (Nluc, 1-416 aa) and C-terminal (Cluc, 398-550 aa) fragments, which are then fused and expressed at specific positions on the MLKL molecule, forming two independent expression plasmids: MLKL-Nluc and MLKL-Cluc. Only when MLKL undergoes functional oligomerization after RIPK3-mediated phosphorylation can the spatial distance be reduced, allowing the N-terminal and C-terminal fragments of Fluc to complement each other, reconstructing a catalytically active luciferase, thereby generating a bioluminescent signal that can be detected by in vivo imaging systems.
[0012] The key to the probe design of this invention lies in optimizing the length and flexibility of the fusion linker peptide. This ensures that the normal folding, phosphorylation, translocation, and oligomerization processes of both functional domains (such as fluorescent proteins and targeting modules) remain undisturbed, providing sufficient relative degrees of freedom for the two domains to independently seek and bind to their respective targets, thus improving binding efficiency. Simultaneously, it ensures that the complementary fragment can effectively reconstruct enzyme activity during oligomerization. The linker peptide (3×GGGGS) used in this invention minimizes non-specific interference, preventing interactions between the linker peptide itself (which carries charged or hydrophobic residues) and non-target molecules, thus ensuring the probe's stability within cells. Finally, the successful construction of this probe provides a powerful and specific tool for non-invasive, dynamic monitoring of the necroptotic process—MLKL oligomerization—in live animal models, filling a technological gap in real-time visualization and monitoring of necroptosis in pan-apoptotic research. Attached Figure Description
[0013] Figure 1 Strategies for designing MLKL-Nluc and MLKL-CLuc luciferase plasmid vectors: (A) Connect the N-terminus and C-terminus of Fluc to the 3' end of the MLKL gene to form two plasmids; (B) Connect the N-terminus and C-terminus of Fluc to the 5' end of the MLKL gene.
[0014] Figure 2 This is a map of the MLKL-Nluc luciferase plasmid vector.
[0015] Figure 3 This is a map of the MLKL-Cluc luciferase plasmid vector.
[0016] Figure 4 In vivo imaging and statistical graphs of LPS-induced MLKL-Nluc and MLKL-CLuc plasmid expression (ns: no significant differences between groups; data are expressed as mean ± standard deviation (n = 6, in vivo images show 3 mice).
[0017] Figure 5 Western blot results of LPS-stimulated mouse necrotizing and apoptotic proteins p-MLKL, MLKL, p-RIP3, and RIP3 at different time points.
[0018] Figure 6 In vivo imaging and statistical diagrams of Pam3CSK4-induced MLKL-Nluc and MLKL-CLuc plasmid expression. There is a significant difference compared to 0h. p < 0.05; data are expressed as mean ± standard deviation (n = 6, live images show 3 mice).
[0019] Figure 7 Western blot results of necrotizing and apoptotic proteins p-MLKL, MLKL, p-RIP3, and RIP3 at different time points after Pam3CSK4 stimulation. Detailed Implementation
[0020] The experimental reagents and materials used in this invention are shown in Table 1:
[0021] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0022] Example 1
[0023] This invention designs and constructs an MLKL oligomerization indicator probe system based on the principle of bimolecular fluorescence complementation (BiFC). The design strategy of this system is as follows: Figure 1 As shown, firefly luciferase (Fluc) is dissected into inactive N-terminal (Nluc, 1-416 aa) and C-terminal (Cluc, 398-550 aa) fragments. The nucleotide sequence of NLuc is shown in SEQ ID NO.1, and the nucleotide sequence of CLuc is shown in SEQ ID NO.2. In this invention, the full-length or specific domain-specific MLKL protein is fused with the N-terminal fragment (1-156) and C-terminal fragment (157-172) of NanoLuc luciferase (Nluc) respectively (the nucleotide sequence of MLKL is shown in SEQ ID NO.3), forming MLKL-Nluc (plasmid vector map shown in...). Figure 2 (as shown) and MLKL-Cluc (plasmid vector map as shown) Figure 3 (As shown) Two independent expression plasmids. Only when MLKL undergoes a specific conformational change (such as activation or oligomerization) can the separated Nluc and Cluc fragments approach each other and reconstruct complete enzyme activity, thereby generating a bioluminescent signal to achieve real-time, highly sensitive monitoring of MLKL activity. This is a live-cell reporter system based on the principle of protein complementation assay (PCA).
[0024] NLuc (SEQ ID NO.1): CLuc (SEQ ID NO.2): 5'-GGTTATGTAAACAATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACCTCTTCATAGTTGACC GCTTGAAGTCTTTAATTAAATACAAAGGATACCAGGTGGCCCCCGCTGAATTGGAGTCGATATTGTTACAACACCCCAACATCTTCGACGCGGGCGTGGCAGGTCTTCCCGACGAT GACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAAAAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAGTTGCGCGG AGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGTCCAAATTGTAA-3'; MLKL(SEQ ID NO.3) Gateway technology, based on the λ phage site-specific recombination system, is a universal cloning technique capable of rapidly and specifically cloning heterologous DNA fragments into various vectors. Compared to traditional cloning methods, this technique does not require consideration of whether the target DNA has suitable restriction enzyme sites, nor does it require enzyme digestion and ligation reactions. Instead, it utilizes site-specific recombination to clone the target DNA into various destination vectors compatible with Gateway technology once an entry clone is obtained, following the correct orientation and reading frame. This significantly simplifies the gene cloning process.
[0025] This invention employs the BP reaction method to construct an intermediate vector carrying the target gene. After correct sequencing, the LR reaction method is used for gene recombination to construct the final dual-plasmid vector (all the above processes were outsourced to Zhou Biotechnology (Guangzhou) Co., Ltd.). The specific operation steps are as follows: (1) Primer sequences were designed based on the MLKL gene (UniProtKB accession number: Q8NB16) data (commissioned by Zhou Biotechnology (Guangzhou) Co., Ltd.), and PCR amplification was performed (PCR reaction system and procedure are shown in Table 2 and Table 3, respectively).
[0026] Note: Please refer to the product instructions for the PCR enzyme used.
[0027] PCR product electrophoresis detection: After the PCR reaction is completed, 10 μL of 6× loading buffer is added to the reaction system to stop the reaction. The reaction products are subjected to agarose gel electrophoresis, and the target fragment is excised and recovered. (ii) Construction of intermediate supports via BP reaction; 1. Plasmid preparation: Refer to the instructions of the Tiangen Plasmid Mini-Prep Kit to prepare the various backbone vector DNAs used in the vector construction process.
[0028] 2. BP reaction (The BP reaction system is shown in Table 4)
[0029] BP reaction conditions: Incubate at 25℃ for 1 h; after the reaction, add 1 μL of proteinase K and incubate at 37℃ for 15 min to terminate the BP reaction.
[0030] 3. Transformation of E. coli competent cells
[0031] Add 5 μL of BP reaction product to 100 μL of competent cells and gently mix; incubate on ice for 30 min; heat shock at 42℃ for 90 s; incubate on ice for 3 min; add 250 μL of LB medium or SOC medium; incubate at 250 rpm and 37℃ for about 1 h (recovery); spread the recovered bacterial culture onto a plate containing Kana antibiotic and incubate upside down at 37℃ overnight.
[0032] 4. Selection and identification of positive clones
[0033] Three single colonies were randomly selected, and the bacterial cells were rinsed into a sterile 0.2 mL EP tube. 1 μL was used as a template for colony PCR, and the remainder was used as a bacterial strain for inoculating and culturing bacteria to extract plasmid DNA (the reaction system and reaction procedure are shown in Table 5 and Table 6, respectively).
[0034]
[0035] After colony PCR, 6× loading buffer was added and electrophoresis was performed. Clones that could amplify to the target length were selected according to the DNA ladder and inoculated into LB medium at 37°C and 250 rpm overnight. Subsequently, small-sample plasmid DNA was extracted and sent for sequencing. The returned sequencing results were compared with the standard sequence using Sequencher software. The entry vector with correct sequencing can proceed to the next step of LR reaction to construct the final vector.
[0036] (III) Construction of the final vector by LR reaction
[0037] The target sequence is recombined into the final backbone vector through the LR reaction to obtain a recombinant expression vector containing the target sequence.
[0038] 1. LR reaction (reaction system shown in Table 7)
[0039] LR reaction conditions: Incubation at 25℃ for 3 h. After the reaction, add 1 μL of proteinase K and incubate at 37℃ for 15 min to terminate the reaction.
[0040] 2. LR reaction products transform competent cells
[0041] Transform competent cells with 2 μL of LR reaction product, following the same procedure as BP reaction product. Finally, spread the revived bacterial culture onto LB plates containing Amp antibiotic and incubate overnight at 37°C upside down.
[0042] 3. Colony PCR
[0043] Five single colonies were randomly selected, and colony PCR was performed as described above for identifying single clones of intermediate vectors. Finally, agarose gel electrophoresis was performed, and colonies that could amplify DNA bands of the target length were selected according to the DNA ladder. The bacteria were then inoculated and cultured, and plasmid DNA was extracted.
[0044] Example 2 Model Construction
[0045] Materials and sources: SPF-grade Balb / c mice, 6-8 weeks old, male, weighing 18-22g, were housed in the animal facility of the Academy of Military Medical Sciences. Householding conditions were in accordance with SPF-grade animal standards.
[0046] Reagents: The two independent plasmid vectors MLKL-Nluc and MLKL-Cluc obtained in Example 1 were purified using the QIAGEN plasmid large-scale extraction and purification kit; physiological saline (0.9% NaCl solution).
[0047] Instruments: 1ml, 2ml and 5ml syringes.
[0048] High-pressure hydrodynamic tail vein injection: Heat the water bath to 42°C and place the mice in a restraint device. Immerse the mouse tails in 42°C warm water to promote vascular engorgement. Then, prepare the extracted plasmid in physiological saline, with each mouse receiving 2 mL of saline containing 10 μg of plasmid. Mix well and set aside. Next, attach a 1 mL syringe needle to a 2 mL syringe tubing, draw 2 mL of the saline solution containing the plasmid, and inject it into the mouse via the tail vein within 5 seconds. After injection, check the mice for any discomfort and ensure their vital signs are normal.
[0049] Example 3
[0050] To confirm the specific response of the MLKL-Nluc / MLKL-CLuc probe to necroptotic signals, in vivo imaging analysis was performed using LPS derived from Gram-negative bacteria and cell wall mimics from Gram-positive bacteria as stimuli.
[0051] The experimental mice obtained in Example 2 were intraperitoneally injected with 10 μg of LPS per mouse and placed in an isoflurane anesthesia induction box for anesthesia induction. After entering a stable anesthesia state, the luciferin substrate D-Luciferin was intraperitoneally injected at a dose of 150 μg / g based on body weight. After injection, the mice remained in the anesthesia induction box to maintain anesthesia. Three minutes after injection, the mice were transferred to the in vivo imaging system, and bioluminescence signals from six mice were acquired simultaneously at 0h, 12h, and 24h. The acquired images were subsequently processed and analyzed using the in vivo imaging system's accompanying analysis software (Xenogen). To reduce the attenuation and scattering interference of animal hair on optical signals, the corresponding observation areas were shaved before imaging. Simultaneously, key genes involved in necrosis and apoptosis were detected using Western blotting.
[0052] like Figure 4 As shown, LPS stimulation (10 μg / animal) failed to significantly activate the MLKL-Nluc / MLKL-CLuc reporter system, and there were no statistically significant differences (ns) in liver bioluminescence signals at each time point compared with baseline. Figure 5 The Western blot analysis also clearly revealed that key phosphorylation events p-RIP3 and p-MLKL in the LPS-induced hepatocyte death execution mode did not show significant changes, meaning that the necroptotic pathway was not significantly altered. This result indicates that LPS from Gram-negative bacteria is insufficient to trigger the execution of functional necroptosis—namely, MLKL phosphorylation, oligomerization, and membrane perforation—suggesting that Gram-negative bacterial components are unlikely to trigger MLKL oligomerization.
[0053] Simultaneously, to investigate whether Gram-positive bacterial components can activate this pathway, the TLR2 / 1 agonist Pam3CSK4 (a cell wall mimic of Gram-positive bacteria) was selected as a stimulus for in vivo imaging analysis. Imaging was performed at 0h, 2h, 4h, 8h, 12h, and 24h after Pam3CSK4 injection, with other steps as described above.
[0054] The results are as follows Figure 6 As shown, stimulation with the TLR2 / 1 specific agonist Pam3CSK4 effectively activated the MLKL-Nluc / MLKL-CLuc reporter system, with a significant increase in liver bioluminescent signal within 24 hours post-infection, reaching a peak at a specific time point (e.g., 8 hours), with an intensity approximately 25.3 times higher than baseline. p <0.05), Western blotting analysis revealed ( Figure 7 The increased expression of p-MLKL and p-RIP3, representing the necroptosis pathway, indicates that the mouse model established in this application was successfully constructed and can dynamically and specifically monitor liver necroptosis.
[0055] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for constructing a visual mouse model characterizing hepatocyte necrosis and apoptosis, characterized in that, Firefly luciferase Fluc was disassembled into inactive N-terminal fragment Nluc and C-terminal fragment Cluc, which were fused and expressed at specific locations in MLKL, thereby constructing two independent plasmid vectors, MLKL-Nluc and MLKL-Cluc. The two plasmid vectors were then injected into mouse hepatocytes via tail vein high-pressure hydrodynamic injection to construct the visualized mouse model characterizing hepatocyte necrosis and apoptosis.
2. The construction method as described in claim 1, characterized in that, The nucleotide sequence of the N-terminal fragment NLuc of firefly luciferase is shown in SEQ ID NO.1, and the nucleotide sequence of the C-terminal fragment Cluc is shown in SEQ ID NO.2; The nucleotide sequence of MLKL is shown in SEQ ID NO.
3.
3. The construction method as described in claim 2, characterized in that, When infecting mouse hepatocytes using the high-pressure hydrodynamic injection method, the concentration of the injection solution is 4-6 μg / mL, the injection volume is 8%-10% of the mouse body weight, and the injection is completed within 3-5 seconds.
4. An MLKL oligomerization-specific probe, characterized in that, The probe consists of an MLKL-NLuc probe and an MLKL-CLuc probe.
5. The application of the construction method according to any one of claims 1 to 3 or the probe according to claim 4 in drug screening for hepatocyte apoptosis.