A rpa-crispr / cas12a-based tetracycline resistance gene detection kit
By combining RPA and CRISPR/Cas12a technologies, a rapid and convenient tetracycline resistance gene detection method has been achieved, solving the problems of long detection time and expensive equipment in existing technologies, and providing an efficient environmental drug resistance monitoring solution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-25
- Publication Date
- 2026-06-30
Smart Images

Figure CN122303391A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the technical field of nucleic acid detection, and in particular to a tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a. Background Technology
[0002] Antibiotics are widely used in various fields such as medicine, poultry farming, animal husbandry, and aquaculture. Tetracycline, as a broad-spectrum antibiotic, is widely used in clinical diagnosis and agricultural production due to its low cost, strong antibacterial activity, good oral absorption, and low toxicity. However, tetracycline resistance genes (such as tetA) can expel tetracycline from bacterial cells by encoding efflux proteins, inducing bacterial resistance. Furthermore, plasmids carrying the tetA gene can spread in the environment through horizontal transfer and can integrate with other resistance genes, forming multidrug resistance. Currently, the tetA gene has been widely detected in various environmental media such as soil, surface water, air, sewage treatment plants, and sediments, posing a potential threat to the ecological environment and public health safety. Therefore, it is urgent to establish effective resistance gene detection technologies to support environmental antimicrobial resistance monitoring.
[0003] Currently, methods for detecting antibiotic resistance genes are mainly divided into two categories: phenotypic detection and genotypic detection. Phenotypic detection assesses resistance risk through antimicrobial susceptibility testing. While this method provides direct evidence of resistance, it relies on microbial culture, cannot cover the large number of unculturable microorganisms in the environment, and has a long detection cycle (usually 2-3 days). Genotypic detection technologies (such as polymerase chain reaction, real-time quantitative polymerase chain reaction, and metagenomic sequencing) combine high sensitivity and high specificity and have become a research focus in this field. However, these technologies rely on expensive instruments and specialized operators, making them difficult to promote and apply in rapid on-site testing scenarios and resource-limited environments. For example, conventional polymerase chain reaction requires a thermal cycler, and the detection time is about 1-2 hours; real-time quantitative polymerase chain reaction has high sensitivity, but suffers from expensive equipment and complex operating procedures; metagenomic sequencing has even higher detection costs and a cumbersome data analysis process. These shortcomings severely limit the ability to detect and monitor environmental resistance genes in a timely manner. Therefore, developing a rapid, sensitive, portable method for detecting tetracycline resistance genes that does not rely on complex instruments is of great significance for environmental drug resistance monitoring and public health safety control. Summary of the Invention
[0004] The problem this invention aims to solve is to provide a tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a, addressing the aforementioned shortcomings of existing technologies. This kit integrates recombinase polymerase amplification technology with a CRISPR / Cas12a detection system into the same reaction tube. Utilizing isothermal amplification and specific cleavage by CRISPR / Cas12a, combined with a portable fluorescence detector, detection can be completed within 30 minutes. Furthermore, its sensitivity is 100 times higher than that of real-time quantitative polymerase chain reaction (RT-PCR). It offers advantages such as ease of operation, no need to open the tube, avoidance of aerosol contamination, and suitability for on-site, real-time detection.
[0005] The above-mentioned objective of this invention is achieved through the following technical solutions: A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a includes an RPA primer pair, a crRNA guide sequence, a Cas12a protease, and an ssDNA reporter probe. The RPA primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2. The nucleotide sequence of the crRNA is shown in SEQ ID NO.3.
[0006] Furthermore, the nucleotide sequence of the ssDNA reporter probe is 5'-FAM-TTATT-BHQ1-3'.
[0007] Furthermore, the detection process of the kit includes, S1 extracts genomic DNA from the sample to be tested to obtain a DNA template; S2 adds the DNA template obtained in S1 to the RPA amplification system containing the RPA primer pair to carry out the RPA amplification reaction and obtain the RPA amplification product. S3 adds the CRISPR / Cas12a detection system containing crRNA guide sequence, Cas12a protease and ssDNA reporter probe to the RPA amplification product obtained in S2, performs CRISPR / Cas12a reaction, and obtains CRISPR / Cas12a reaction product. S4 uses a fluorescence detection device to detect the CRISPR / Cas12a reaction product obtained in S3. If an amplification curve is formed in the detection result, it proves that the sample to be tested contains a tetracycline resistance gene.
[0008] Furthermore, in S2, the volume ratio of the forward primer, the reverse primer, and the DNA template is controlled to be 1.0~1.5:1.0~1.5:2.0~3.0.
[0009] Furthermore, in S2, the RPA amplification system consists of the following raw materials in volume parts: 25.0-35.0 parts of diluted reconstitution solution, 1.0-1.5 parts of forward primer, 1.0-1.5 parts of reverse primer, 5.0-15.0 parts of nuclease-free water, and 2.0-3.0 parts of MgOAc activator.
[0010] Furthermore, in S2, the reaction temperature of the RPA amplification reaction is controlled at 36~38℃, and the reaction time is controlled at 10~20min.
[0011] Furthermore, in S3, the volume ratio of the RPA amplification system and the CRISPR / Cas12a detection system is controlled to be 2-4:10, and the concentrations of the crRNA guide sequence, Cas12a protease, and ssDNA reporter probe are each independently 8-12 μM.
[0012] Furthermore, in S3, the CRISPR / Cas12a detection system consists of the following components by volume: 1.5–2.5 parts of 10×HOLMES Buffer, 0.1–0.2 parts of RNase Inhibitor, 0.3–0.5 parts of 8–12 μM crRNA guide sequence, 0.1–0.2 parts of 8–12 μM Cas12a protease, and 0.3–0.5 parts of 8–12 μM ssDNA reporter probe.
[0013] Furthermore, in S3, the reaction temperature of the CRISPR / Cas12a reaction is controlled at 36~38°C, and the reaction time is controlled at 15~25 min.
[0014] Furthermore, in S4, the tetracycline resistance gene is tetA.
[0015] In summary, the beneficial technical effects of this invention are as follows: This invention combines RPA isothermal amplification technology and CRISPR / Cas12a detection technology to provide a rapid detection method for tetracycline resistance genes (tetA) in environmental samples, achieving convenient, efficient, and accurate detection of bacterial tetracycline resistance. Under isothermal conditions, the detection can be completed in only 30 minutes, with a detection limit as low as 3.34 aM, and a sensitivity 100 times that of qPCR. Furthermore, this method possesses extremely high accuracy and convenience, requiring no complex equipment or professional operators; only a thermostat and a portable fluorescence detection device are needed for on-site, real-time detection. It is particularly suitable for emergency environmental monitoring with limited resources, providing an efficient and convenient technical solution for the rapid detection of antibiotic resistance genes, and also offering new technical support for environmental antibiotic resistance monitoring and public health safety control. Attached Figure Description
[0016] Figure 1 This is a diagram showing the screening results of RPA amplification primers for the tetA target sequence in Example 2 of this invention; where the marker is the DNA standard DL2000, and the first, second, and third electrophoresis bands correspond to the amplification products of primer pairs tetA-F1R1, tetA-F2R2, and tetA-F3R3.
[0017] Figure 2 This is a graph showing the results of optimizing the Cas12a / crRNA concentration ratio in the CRISPR / Cas12a detection system using RPA amplification products in Example 5 of this invention; wherein, (a) is the result of the fluorescence signal intensity under real-time fluorescence quantitative PCR instrument after significant difference analysis by Prism 10, and (b) is a mobile phone image of the fluorescence visualization result under ultraviolet light.
[0018] Figure 3 The following figures show the comparison of fluorescence intensity of the RPA amplification product and PCR amplification product prepared in Example 5 of this invention for CRISPR / Cas12a detection. (a) The fluorescence signal intensity under real-time quantitative PCR instrument is obtained after Prism 10 significant difference analysis. (b) The fluorescence amplification curves of the two amplification products are shown. (c) The fluorescence visualization results under ultraviolet light are taken by mobile phone.
[0019] Figure 4 This is a graph showing the optimized RPA amplification volume in the single-tube one-step method of Preparation Example 5 of this invention. Group T1 represents the "two-step method," where 2 μL of RPA amplification product is added to the CRISPR / Cas12a detection system, involving mid-process capping and product transfer. Group T2 represents the "one-step method with a 10 μL RPA amplification volume," and Group T3 represents the "one-step method with a 20 μL RPA amplification volume." Groups T2 and T3 do not involve mid-process capping or product transfer; that is, two reaction systems are pre-loaded into the reaction tube in separate sections. NTC1, NTC2, and NTC3 correspond to the template-free negative controls of groups T1, T2, and T3, respectively. (a) The graph shows the fluorescence signal intensity obtained after significant difference analysis using Prism 10 under a real-time quantitative PCR instrument. (b) The graph shows the fluorescence visualization results under UV light, captured by a mobile phone.
[0020] Figure 5 These are PCR and qPCR reaction results under different concentrations of DNA template in Example 1 of this invention; wherein, (a) is a PCR gel electrophoresis band diagram, the first lane is the marker, which is the DNA standard DL2000, and lanes 2 to 8 correspond to 10 1 -10 -5 (a) DNA template with a concentration of ng / μL; (b) qPCR fluorescence amplification curve.
[0021] Figure 6 The results of sensitivity testing of the RPA-CRISPR / Cas12a single-tube one-step method in Example 1 of this invention are shown in Figure (a), which is the fluorescence signal intensity analysis result of real-time fluorescence quantitative PCR instrument for different concentrations of DNA templates; Figure (b) is the fluorescence amplification curve of different concentrations of DNA templates; and Figure (c) is the fluorescence visualization result under ultraviolet light taken by mobile phone.
[0022] Figure 7 This is a graph showing the qPCR detection results of different environmental strains in Example 1 of the present invention; wherein, the first three strains were identified as carrying tetracycline resistance after phenotypic testing, and the latter three strains were identified as not carrying tetracycline resistance.
[0023] Figure 8 This is a graph showing the accuracy verification results of the RPA-CRISPR / Cas12a single-tube one-step detection method in Embodiment 1 of the present invention. Detailed Implementation
[0024] To make the technical means, creative features, objectives and effects of this invention clearer and easier to understand, the invention will be further described below in conjunction with the accompanying drawings and specific embodiments.
[0025] Preparation Example 1: Conservation Analysis of tetA Gene and Determination of Target Sequence The tetA gene is a representative and widely studied tetracycline resistance gene. In prokaryotes, this gene sequence exhibits high conservation and good specificity. In this embodiment, the nucleotide sequence of the *E. coli* tetA gene (GenBank accession number: L29404.2) was obtained by consulting the NCBI gene database (https: / / www.ncbi.nlm.nih.gov / ). A continuous nucleotide sequence of approximately 200 bp was selected from the CDS region as the target sequence of this invention. The selected sequence should contain multiple PAM (Protospacer Adjacent Motif) sites (sequences “TTTN” or “TTN”, where V represents A, C, or G) to ensure that the Cas12a nuclease and its crRNA can effectively recognize and cleave the target sequence.
[0026] The strain used in this invention is the engineered Escherichia coli strain HB101, purchased from Shanghai Maokang Biotechnology Co., Ltd. This invention also involves five other strains: Shigella flexneri, Escherichia coli, Raoultella ornithinolytica, Klebsiella grimontii, and Phytobacter palmae, all of which were collected and isolated from a wastewater treatment plant in Hangzhou, Zhejiang Province in 2024.
[0027] Preparation Example 2: Design and Screening of RPA Amplification Primers Based on the determined tetracycline resistance gene tetA target sequence, three primer pairs were designed using SnapGene and Oligo 7 software. After design, the NCBI-BLAST tool was used to perform specificity analysis and primer dimer risk assessment on each primer pair. Primer pairs with high specificity and low dimer risk were selected and synthesized by Beijing Qingke Biotechnology Co., Ltd. Primer sequence information is shown in Table 1.
[0028] Table 1 name Sequence (5'-3') RPA-tetA-F1 TGGCGTTCCCGATCATGGTCCTGCTTGCTTC RPA-tetA-R1 CTGCCCCTGACGTTCCTCATCCACCTGCCT RPA-tetA-F2 TTCCTTTGGGTTCTCTATATCGGGCCGGATCGT RPA-tetA-R2 GAGAAACCGCCCATCAGCCCACCGAGCACAG RPA-tetA-F3 CTGTTTCCTTTTGCCGGAGTCGCACAAAGGC RPA-tetA-R3 GATCCTCGCCGAAAATGACCCAAAGCGCGG Genomic DNA was extracted from *Escherichia coli* strain HB101 using the TIANamp Bacteria DNA Kit. After extraction, the concentration of double-stranded DNA (dsDNA) was measured using a NanoDrop spectrophotometer, and the results were recorded. The DNA samples were then stored at -20°C for later use.
[0029] The extracted genomic DNA was initially diluted to a concentration of 10 ng / μL and used as the DNA template for subsequent RPA amplification using the TwistAmp® Basic RPA amplification kit. The reaction mixture consisted of 29.5 μL of reconstitution solution, 1.2 μL each of forward and reverse primers, 2.5 μL of DNA template, and 10.7 μL of nuclease-free water. This mixture was then added sequentially to TwistAmp® reaction tubes containing lyophilized enzyme, followed by 2.5 μL of MgOAc activator to the tube cap. The tubes were gently pipetted to ensure complete mixing, and then immediately centrifuged to thoroughly mix the activator with the reagents at the bottom of the reaction. The tubes were then incubated at 39°C for 15 min. After amplification, 50 μL of Tris-saturated phenol / chloroform / isoamyl alcohol (25:24:1) DNA extraction solvent was added to each RPA amplification tube to extract DNA from the amplified products and remove protein interference to prevent interference with subsequent analysis. After adding the extraction solvent and mixing well, centrifuge at 12000 rpm for 5 min. After centrifugation, aspirate 5 μL of the supernatant and mix with 1 μL of 6× Loading buffer, then spot the mixture onto an agarose gel for electrophoresis (2% agarose gel concentration). After electrophoresis, use a BioRad gel imaging system to photograph and observe the position, brightness, and clarity of the bands. Figure 1 The results showed that the second primer pair (RPA-tetA-F2R2) amplified bands of appropriate size and were clear and bright. As optimized RPA amplification primers, they were used for subsequent experiments.
[0030] Preparation Example 3: Design and Screening of crRNA Guide Sequences When designing crRNA, the target sequence (i.e., the region between the upstream and downstream primers of the optimal primer pair) must first be determined, and the protospacer adjacent motif (PAM site) must be found within it. The typical PAM site sequence is TTTN or TTN (N represents any base). Subsequently, 18-24 bases downstream (3' end) of the PAM site are selected as the target sequence for crRNA spacer region recognition. The crRNA spacer region needs to be completely complementary to the target sequence on the TS strand. When designing complementary crRNA based on the TS strand sequence, a repeat region sequence required for Cas12a protein binding (Scaffold sequence: 5'-UAAUUUCUACUAAGUGUAGAU-3') needs to be added to its 5' end. The final determined target sequence is 5'-GGGTTCGGGATGGTCGCGGGAC-3', and the crRNA sequence designed based on the target sequence information is: 5'-UAAUUUCUACUAAGUGUAGAUGGGUUCGGGAUGGUCGCGGGAC-3'.
[0031] Preparation Example 4: The fluorescent reporter probe ssDNA sequence is 5'-TTATT-3', wherein the 5' end of the reporter probe is modified with a FAM fluorescent group, and the 3' end is modified with a BHQ quencher group.
[0032] Preparation Example 5: Optimization of RPA-CRISPR / Cas12a Single-Tube One-Step Detection System 1. Optimization of Cas12a / crRNA concentration ratio The RPA amplification product was used for CRISPR-Cas12a reaction, with nine concentration ratios (50 / 50, 50 / 100, 50 / 200, 100 / 50, 100 / 100, 100 / 200, 200 / 50, 200 / 100, and 200 / 200) of Cas12a / crRNA. The specific sample loading system was as follows: 2 μL of 10×HOLMES Buffer, 0.1 μL of RNase Inhibitor, the selected concentration of Cas12a / crRNA, 0.4 μL of ssDNA (initial concentration 10 μM), and 2 μL of RPA amplification product. The total volume was then brought to 20 μL with RNase-free ddH2O. After mixing, the reaction tubes were immediately placed in a real-time quantitative PCR instrument and incubated at 37°C for 20 minutes, with fluorescence signals from the FAM channel acquired every 30 seconds. After the reaction, data were collected, and significant difference analysis and graphing were performed using Prism 10 software. The reaction tubes were then placed under a UV lamp for fluorescence visualization. The results are shown below. Figure 2 As shown, Figure 2 (a) The intensity of the focal fluorescence signal in the two reactions with a final Cas12a / crRNA concentration (nM) ratio of 50 / 200 and 200 / 200 was significantly higher than that in the control group (**P<0.01). Figure 2 (b) Under blue light, the highest brightness can be observed with the naked eye when the concentration ratio is 200 / 200. Considering cost, the final concentration (nM) ratio of Cas12a / crRNA was selected as 50 / 200, that is, the sample loading volumes were 0.1 μL of Cas12a (initial concentration of 10 μM) and 0.4 μL of crRNA (initial concentration of 10 μM), respectively, for subsequent CRISPR-Cas12a reactions.
[0033] 2. CRISPR / Cas12a reaction substrate screening Before constructing the RPA-CRISPR / Cas12a single-tube one-step system, this invention compared the effects of RPA amplification and PCR amplification on the efficiency and sensitivity of subsequent CRISPR / Cas12a reactions. Using RPA and PCR amplification products as substrates, the CRISPR-Cas12a reaction was performed. The CRISPR / Cas12a system was pre-mixed in the reaction tubes (the system consisted of: 2 μL of 10×HOLMES Buffer, 0.1 μL of RNase Inhibitor, 0.1 μL of Cas12a (initial concentration 10 μM), 0.4 μL of crRNA (initial concentration 10 μM), 0.4 μL of ssDNA (initial concentration 10 μM), and 15 μL of RNase-free ddH2O). Then, 2 μL of RPA and PCR amplification products were added to different reaction tubes, respectively. The results are as follows... Figure 3 As shown, the fluorescence signal curves of the RPA amplification group rapidly increased and reached the detection threshold within 10 minutes, reducing the total detection time to 20 minutes, significantly faster than the PCR group (which typically requires over 60 minutes). Furthermore, the endpoint fluorescence intensity was 1.3 times higher than that of the PCR group. These results indicate that RPA amplification not only improves the portability of the entire detection system through its isothermal properties, but also that the synergistic effect of its amplification products with the CRISPR system better optimizes detection sensitivity and timeliness, making it more suitable for rapid on-site detection. Therefore, the RPA amplification method was adopted for subsequent CRISPR-Cas12a detection.
[0034] 3. Optimization of single-tube one-step RPA amplification volume To address the issue of false positives caused by aerosol contamination in the two-step method, a single-tube one-step method is used. This system involves adding premixed RPA reaction components (excluding the activator MgOAc) to the bottom of the reaction tube, followed by adding the CRISPR cleavage system to the tube cap. After all samples are loaded, the MgOAc activator is added to the bottom of the tube, and the tube is quickly placed in a constant-temperature metal bath to initiate the amplification reaction. After the amplification reaction is complete, the tube is immediately centrifuged to dislodge the CRISPR system from the cap into the bottom for subsequent cleavage reactions. The entire process does not require opening the reaction tube cap, reducing the risk of aerosol contamination. The specific sample loading steps and reagent volumes for the single-tube one-step method are as follows: Tube cap: 2 μL of 10×HOLMES Buffer, 0.1 μL of RNase Inhibitor, 0.1 μL of Cas12a (initial concentration 10 μM), 0.4 μL of crRNA (initial concentration 10 μM), and 0.4 μL of ssDNA (initial concentration 10 μM). Bottom of the tube: TwistAmp® reaction tube containing lyophilized enzyme, 29.5 μL of dilution reconstitution solution, 1.2 μL each of forward and reverse primers, 2.5 μL of DNA template, and 10.7 μL of nuclease-free water. After mixing the above reagents, take 10 μL and 20 μL respectively and place them at the bottom of different reaction tubes.
[0035] After adding samples to the cap and bottom of the tube, add 1 μL of MgOAc activator to activate the reaction. Place the reaction tube in a 37°C constant temperature metal bath and incubate for 15 min. Then, perform a short centrifugation to mix the CRISPR-Cas12a detection system in the cap with the RPA amplification product in the bottom of the tube. Immediately place the tube in a real-time quantitative PCR instrument and incubate at 37°C for 20 min. Acquire the fluorescence signal of the FAM channel every 30 seconds.
[0036] The results are as follows Figure 4 As shown, the fluorescence signal intensity of the two-step method (T1) using 2 μL of RPA amplification product and the single-tube one-step method (T2) using 10 μL of RPA premix were significantly higher than that of the single-tube one-step method (T3) using 20 μL of RPA premix (**P<0.01). However, no significant difference was observed between T1 and T2 (P>0.05), indicating that the one-step method did not significantly affect the sensitivity compared to the two-step method. Furthermore, the 10 μL volume of RPA premix in the single-tube one-step method significantly improved the subsequent detection results compared to 20 μL. In addition, the experimental repeatability of the single-tube one-step method was significantly better than that of the two-step method, with the fluorescence signal error range reduced by 70%, indicating that the single-tube system improved detection stability while avoiding aerosol contamination upon opening the tube. Therefore, this study ultimately selected 10 μL of RPA pre-amplification volume as the optimized single-tube one-step detection method.
[0037] Example 1: A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a disclosed in this invention includes an RPA primer pair, a crRNA guide sequence, a Cas12a protease, and an ssDNA reporter probe; wherein, RPA primer pairs include a forward primer with a nucleotide sequence as shown in SEQ ID NO.1 (5'-TTCCTTTGGGTTCTCTATATCGGGCGGATCGT-3') and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2 (5'-GAGAAACCGCCCATCAGCCCACCGAGCACAG-3'). The nucleotide sequence of crRNA is shown in SEQ ID NO.3 (5'-UAAUUUCUACUAAGUGUAGAUGGGUUCGGGAUGGUCGCGGGAC-3'). The nucleotide sequence of the ssDNA reporter probe is 5'-FAM-TTATT-BHQ1-3'.
[0038] The detection process of the kit includes, S1 extracts genomic DNA from the sample to be tested to obtain a DNA template; S2: Add 2.5 μL of DNA template obtained in S1 to the RPA amplification system and perform RPA amplification reaction at 37℃ for 15 min to obtain RPA amplification product; wherein, the RPA amplification system includes 29.5 μL of dilution reconstitution solution, 1.2 μL of forward primer, 1.2 μL of reverse primer, 10.7 μL of nuclease-free water, and 2.5 μL of MgOAc activator; In step S3, the CRISPR / Cas12a detection system was added to 11 μL of the RPA amplification product obtained in step S2, and the CRISPR / Cas12a reaction was carried out at 37 °C for 20 min to obtain the CRISPR / Cas12a reaction product. The CRISPR / Cas12a detection system included 2.0 μL of 10×HOLMES Buffer, 0.1 μL of RNase Inhibitor, 0.4 μL of 10 μM crRNA guide sequence, 0.1 μL of 10 μM Cas12a protease, and 0.4 μL of 10 μM ssDNA reporter probe. S4 uses a fluorescence detection device to detect the CRISPR / Cas12a reaction product obtained in S3. If an amplification curve is formed in the detection result, it proves that the sample to be tested contains the tetracycline resistance gene tetA.
[0039] Example 2: A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a disclosed in this invention includes an RPA primer pair, a crRNA guide sequence, a Cas12a protease, and an ssDNA reporter probe; wherein, RPA primer pairs include a forward primer with a nucleotide sequence as shown in SEQ ID NO.1 (5'-TTCCTTTGGGTTCTCTATATCGGGCGGATCGT-3') and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2 (5'-GAGAAACCGCCCATCAGCCCACCGAGCACAG-3'). The nucleotide sequence of crRNA is shown in SEQ ID NO.3 (5'-UAAUUUCUACUAAGUGUAGAUGGGUUCGGGAUGGUCGCGGGAC-3'). The nucleotide sequence of the ssDNA reporter probe is 5'-FAM-TTATT-BHQ1-3'.
[0040] The detection process of the kit includes, S1 extracts genomic DNA from the sample to be tested to obtain a DNA template; S2: Add 2.0 μL of DNA template obtained in S1 to the RPA amplification system and perform RPA amplification reaction at 37℃ for 15 min to obtain RPA amplification product; wherein, the RPA amplification system includes 25.0 μL of dilution reconstitution solution, 1.0 μL of forward primer, 1.0 μL of reverse primer, 5.0 μL of nuclease-free water, and 2.0 μL of MgOAc activator; In step S3, the CRISPR / Cas12a detection system was added to 11 μL of the RPA amplification product obtained in step S2, and the CRISPR / Cas12a reaction was carried out at 37 °C for 20 min to obtain the CRISPR / Cas12a reaction product. The CRISPR / Cas12a detection system included 2.5 μL of 10×HOLMES Buffer, 0.2 μL of RNase Inhibitor, 0.5 μL of 12 μM crRNA guide sequence, 0.2 μL of 12 μM Cas12a protease, and 0.5 μL of 12 μM ssDNA reporter probe. S4 uses a fluorescence detection device to detect the CRISPR / Cas12a reaction product obtained in S3. If an amplification curve is formed in the detection result, it proves that the sample to be tested contains the tetracycline resistance gene tetA.
[0041] Example 3: A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a disclosed in this invention includes an RPA primer pair, a crRNA guide sequence, a Cas12a protease, and an ssDNA reporter probe; wherein, RPA primer pairs include a forward primer with a nucleotide sequence as shown in SEQ ID NO.1 (5'-TTCCTTTGGGTTCTCTATATCGGGCGGATCGT-3') and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.2 (5'-GAGAAACCGCCCATCAGCCCACCGAGCACAG-3'). The nucleotide sequence of crRNA is shown in SEQ ID NO.3 (5'-UAAUUUCUACUAAGUGUAGAUGGGUUCGGGAUGGUCGCGGGAC-3'). The nucleotide sequence of the ssDNA reporter probe is 5'-FAM-TTATT-BHQ1-3'.
[0042] The detection process of the kit includes, S1 extracts genomic DNA from the sample to be tested to obtain a DNA template; S2: Add 3.0 μL of DNA template obtained in S1 to the RPA amplification system and perform RPA amplification reaction at 37℃ for 15 min to obtain RPA amplification product; wherein, the RPA amplification system includes 35.0 μL of dilution reconstitution solution, 1.5 μL of forward primer, 1.5 μL of reverse primer, 15.0 μL of nuclease-free water, and 3.0 μL of MgOAc activator; In step S3, the CRISPR / Cas12a detection system was added to 11 μL of the RPA amplification product obtained in step S2, and the CRISPR / Cas12a reaction was carried out at 37 °C for 20 min to obtain the CRISPR / Cas12a reaction product. The CRISPR / Cas12a detection system included 1.5 μL of 10×HOLMES Buffer, 0.1 μL of RNase Inhibitor, 0.3 μL of 8 μM crRNA guide sequence, 0.1 μL of 8 μM Cas12a protease, and 0.3 μL of 8 μM ssDNA reporter probe. S4 uses a fluorescence detection device to detect the CRISPR / Cas12a reaction product obtained in S3. If an amplification curve is formed in the detection result, it proves that the sample to be tested contains the tetracycline resistance gene tetA.
[0043] Experimental Example 1: Sensitivity and Specificity Analysis of RPA-CRISPR / Cas12a Single-Tube One-Step Detection Kit I. Sensitivity Testing of RPA-CRISPR / Cas12a Single-Tube One-Step Method The RPA-CRISPR-Cas12a single-tube one-step detection kit established in Example 1 was used to detect DNA of different concentrations of Escherichia coli HB101 strain. At the same time, PCR and qPCR methods were used to verify the sensitivity of the kit established in this invention. The results are shown in Table 2.
[0044] Table 2 name Sequence (5'-3') PCR-tetA-F AATCTTGCTCGTCTCGCTGG PCR-tetA-R GAAACCGCCCATCAGCCCAC (1) Take 10 1 -10 -5The DNA dilution of Escherichia coli HB101 strain nucleic acid sample at a concentration of ng / μL was used as a template for PCR amplification. The amplification primers, reaction system and conditions were as follows: (1) Amplification primers: forward and reverse primers are shown in Table 2; (2) Reaction system: 10 μL of Taq PCR Mix (2X), 0.5 μL of each primer pair (initial concentration 10 μM), 1 μL of DNA template, and ddH2O to make up to 20 μL; (3) Reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; final extension at 72℃ for 5 min, and storage at 4℃). The results are as follows. Figure 5 As shown in (a), a band was still visible in lane 4, indicating that the lowest detectable DNA concentration by PCR is 10. -3 ng / μL.
[0045] (2) Take 10 1 -10 -5 A diluted DNA sample from *E. coli* strain HB101 at a concentration of ng / μL was used as a template for quantitative real-time PCR (qPCR). A negative control was performed using a mixture of other reagents without the DNA template. The reaction mixture consisted of: 7.5 μL of TB Green Premix Ex Taq II (2X), 0.3 μL of ROX plus, 0.5 μL each of the forward and reverse PCR primers, 1 μL of DNA, and ddH2O to a final volume of 15 μL. After thorough mixing, the mixture was placed in a qPCR instrument for detection. The reaction program was set as follows: 95℃ pre-denaturation for 1 min, followed by 39 cycles of 95℃ for 5 s, 60℃ for 30 s, and finally, a melting curve was added: 95℃ for 15 s, 65℃ for 5 s, and 95℃ for 15 s. The results are as follows: Figure 5 As shown in (b), the lowest detectable DNA concentration by qPCR is 10. -3 ng / μL (3) With concentrations of 10 1 -10 -5 Seven DNA templates (ng / μL) were used, and subsequent RPA amplification, CRISPR-Cas12a single-tube one-step reaction, and fluorescence signal detection were performed according to Example 1. Results are as follows: Figure 6 As shown, the RPA-CRISPR / Cas12a single-tube one-step detection method was observed to be effective even at template concentrations as low as 10⁻⁻⁶. 5 Even at ng / μL, a clear fluorescent signal can still be observed with the naked eye, and its fluorescence signal intensity is significantly higher than that of the negative control, with a detection limit of 3.34 aM.
[0046] II. Accuracy Verification of RPA-CRISPR / Cas12a Single-Tube One-Step Method The RPA-CRISPR-Cas12a single-tube one-step detection kit established in Example 1 was used to detect DNA from different strains. At the same time, qPCR was used to verify the accuracy of the kit established in this invention.
[0047] Multiple bacterial strains were screened from the environment and cultured for 6-8 hours to amplify their genomic DNA. The DNA of these strains was extracted, and subsequent RPA-CRISPR / Cas12a single-tube one-step detection and qPCR detection were performed according to Example 1. The qPCR detection system is shown in step (2) of Example 8. The results of the RPA-CRISPR / Cas12a detection method are as follows: Figure 8 As shown, three strains of the six strains were positive for the tetracycline resistance gene tetA, consistent with phenotypic identification and qPCR detection results. Figure 7 The results are consistent, indicating that the established RPA-CRISPR / Cas12a single-tube one-step method has good detection accuracy.
[0048] In summary, the RPA-CRISPR / Cas12a single-tube one-step detection method provided by this invention has good accuracy in environmental sample detection and higher sensitivity than conventional PCR and qPCR methods. It has good detection capability for low concentrations of the tetracycline resistance gene tetA in environmental samples. When combined with a portable fluorescence detector, it can achieve rapid detection of samples. The total reaction time can be controlled within 30 minutes. It has good effect and reliability in resource-limited environments or on-site emergency monitoring applications.
[0049] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. A RPA-CRISPR / Cas12a-based tetracycline resistance gene detection kit, characterized in that: It includes an RPA primer pair, a crRNA guide sequence, a Cas12a protease, and an ssDNA reporter probe. The RPA primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.
2. The nucleotide sequence of the crRNA is shown in SEQ ID NO.
3.
2. The tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 1, characterized in that: The nucleotide sequence of the ssDNA reporter probe is 5'-FAM-TTATT-BHQ1-3'.
3. The tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 1, characterized in that: The detection process of the kit includes, S1 extracts genomic DNA from the sample to be tested to obtain a DNA template; S2 adds the DNA template obtained in S1 to the RPA amplification system containing the RPA primer pair to carry out the RPA amplification reaction and obtain the RPA amplification product. S3 adds the CRISPR / Cas12a detection system containing crRNA guide sequence, Cas12a protease and ssDNA reporter probe to the RPA amplification product obtained in S2, performs CRISPR / Cas12a reaction, and obtains CRISPR / Cas12a reaction product. S4 uses a fluorescence detection device to detect the CRISPR / Cas12a reaction product obtained in S3. If an amplification curve is formed in the detection result, it proves that the sample to be tested contains a tetracycline resistance gene.
4. The tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 3, characterized in that: In S2, the volume ratio of the forward primer, reverse primer, and DNA template is controlled to be 1.0~1.5:1.0~1.5:2.0~3.
0.
5. A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 4, characterized in that: In S2, the RPA amplification system consists of the following raw materials in volume parts: 25.0-35.0 parts of dilution reconstitution solution, 1.0-1.5 parts of forward primer, 1.0-1.5 parts of reverse primer, 5.0-15.0 parts of nuclease-free water, and 2.0-3.0 parts of MgOAc activator.
6. The tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 3, characterized in that: In S2, the reaction temperature of the RPA amplification reaction is controlled at 36~38℃, and the reaction time is controlled at 10~20min.
7. A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 3, characterized in that: In S3, the volume ratio of the RPA amplification system to the CRISPR / Cas12a detection system is controlled to be 2-4:10, and the concentrations of the crRNA guide sequence, Cas12a protease, and ssDNA reporter probe are each independently 8-12 μM.
8. A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 7, characterized in that: In S3, the CRISPR / Cas12a detection system consists of the following components in parts by volume: 1.5-2.5 parts of 10×HOLMES Buffer, 0.1-0.2 parts of RNase Inhibitor, 0.3-0.5 parts of 8-12 μM crRNA guide sequence, 0.1-0.2 parts of 8-12 μM Cas12a protease, and 0.3-0.5 parts of 8-12 μM ssDNA reporter probe.
9. A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 3, characterized in that: In S3, the reaction temperature of the CRISPR / Cas12a reaction is controlled at 36~38℃, and the reaction time is controlled at 15~25min.
10. A tetracycline resistance gene detection kit based on RPA-CRISPR / Cas12a according to claim 3, characterized in that: In S4, the tetracycline resistance gene is tetA.