LAMP primer set, kit and detection method for detecting *Cyclophorus melanogaster* subspecies *Melanogaster*
By designing a specific LAMP primer set and kit, and using Bst DNA polymerase for LAMP amplification under isothermal conditions, the problem of insufficient sensitivity and specificity in the detection of *Bacillus mermaidus* subspecies *Mermaidus* was solved, realizing a rapid and convenient detection method suitable for on-site detection in marine aquaculture.
Patent Information
- Application Number
- CN202610581657.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-29
- Publication Date
- 2026-06-30
AI Technical Summary
Existing detection technologies for *Bacillus luminescenceis* subspecies *Mermaid* suffer from long detection cycles, low sensitivity, and insufficient specificity, making it difficult to meet the needs for rapid diagnosis in the early stages of infection. Furthermore, traditional methods are highly dependent on equipment and personnel, limiting their application in grassroots farms.
A specific LAMP primer set and kit were designed, including forward outer primer F3, reverse outer primer B3, forward inner primer FIP, and reverse inner primer BIP, combined with Bst DNA polymerase, dNTPs, buffer, and visualization dye, to achieve rapid, sensitive, and specific detection under isothermal conditions through LAMP amplification technology.
It enables detection to be completed within 55 minutes, possesses high sensitivity and strong specificity, is suitable for rapid on-site screening in marine aquaculture, provides an efficient and convenient means of disease monitoring, and reduces dependence on equipment and personnel.
Smart Images

Figure CN122303459A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the technical field of LAMP field detection methods, specifically involving LAMP primer sets, reagent kits, and detection methods for detecting *Bacillus mermaidus* subspecies *Mermaidus*. Background Technology
[0002] Mermaid bioluminescent bacteria, mermaid subspecies ( Photobacterium damselae subsp. damselae ) is a Gram-negative pathogenic bacterium that is currently widespread in global oceans and seriously harms a variety of marine animals. It belongs to the family Vibrionaceae and the genus Lucifera. Photobacterium With its increasing ability to spread across species, this bacterium has broken through the limitations of fish hosts, successfully infecting a variety of marine animals, including crustaceans, mollusks, echinoderms, and reptiles, and even causing fatal damage to aquatic mammals. Therefore, *Bacillus mermaidus* subspecies *Mermaidus* lacks obvious regional and host specificity, and its prevalence and severity are escalating, posing a significant threat to the healthy development of global mariculture and the safety of nearshore ecosystems.
[0003] Currently, detection technologies for *Bacillus merantii* subspecies *Melilotus melilotus* still primarily rely on traditional pathogen detection and molecular nucleic acid detection. Pathogen detection, centered on pathogen isolation and purification combined with biochemical identification techniques, suffers from technical bottlenecks such as long detection cycles, low sensitivity, and insufficient specificity, making it difficult to meet the needs of rapid diagnosis in the early stages of infection. Molecular nucleic acid detection technologies include conventional PCR and real-time quantitative PCR (qPCR): While conventional PCR can achieve rapid amplification of target nucleic acids, its sensitivity is limited and requires verification of amplified products via electrophoresis, restricting its accurate detection application in low-viral-load infection scenarios; although qPCR significantly improves detection sensitivity and timeliness, its high dependence on sophisticated instruments and professional personnel greatly hinders its widespread application in grassroots aquaculture farms.
[0004] In recent years, loop-mediated isothermal amplification (LAMP) has attracted widespread attention as an emerging isothermal nucleic acid amplification method. Based on Bst DNA polymerase with strand displacement activity, this technology uses 4-6 primers that specifically recognize multiple conserved regions of the target sequence to trigger a cyclic strand displacement reaction, thereby achieving efficient and continuous nucleic acid amplification under isothermal conditions. Compared with traditional detection techniques, this technology has significant advantages such as high sensitivity (detecting target nucleic acids as low as 10 copies / μL), high specificity (multiple primers targeting conserved regions reduce non-specific amplification), short reaction time (detection completed within 30-60 minutes), low equipment and personnel requirements (only requiring an isothermal device and basic pipetting tools), and intuitive result interpretation (direct observation via turbidity or fluorescence colorimetry). It has become an ideal technology choice for rapid on-site detection of emerging infectious diseases.
[0005] In summary, given the existing shortcomings in the detection technology for *Bacillus merantii* subspecies *Melilotus melilotus*, there is an urgent need to develop a LAMP detection technology system that combines high sensitivity and strong specificity for rapid on-site screening of this bacterium. The development of this system will enable accurate detection and immediate interpretation of trace pathogens in the early stages of infection, providing efficient and convenient technical support for disease monitoring in marine aquaculture and helping the industry steadily develop towards a green, healthy, and sustainable direction. Summary of the Invention
[0006] The purpose of this invention is to provide a LAMP primer set, kit, and detection method for detecting *Bacillus mermaidus* subspecies *Mermaidus*, in order to solve the problems mentioned in the background art.
[0007] To achieve the above objectives, the present invention provides the following technical solution: a LAMP primer set for detecting *Bacillus mermaidus* subspecies *Mermaidus*, comprising... Forward outer primer F3, reverse outer primer B3, forward inner primer FIP, and reverse inner primer BIP; F3: 5'-TCGTACTTGGCAATGTGC-3'; B3: 5'-ATCCCATAAAACGATATCTGC-3'; FIP: 5'-GCGTTTGATTCGGGTGTTATCACTA-CAATAAGATGAAGCTTCAGCG-3'; BIP: 5'-TGCTAAATATACGATCAATCCAGCT-TTACCCACTTCTAGAGAACC-3'.
[0008] Detection reagents or kits containing the primers described above.
[0009] The Mermaid Proteobacterium catarrhalis subspecies detection kit includes the primers described above, and further includes at least one of Bst DNA polymerase, dNTPs, buffer, visualization dye detection solution, and MgSO4.
[0010] The application of the primers, the detection reagents or kits, or the detection kits in the detection of *Bacillus mermaidus* subspecies *Mermaidus*.
[0011] The detection method for *Bacillus luminescenceis* in *Mermaid* subspecies includes the following steps: Step 1: Design LAMP detection primers for the specific detection of *Bacillus mermaidus* subspecies *Mermaidus*. The primers consist of a forward outer primer F3, a reverse outer primer B3, a forward inner primer FIP, and a reverse inner primer BIP. Step 2: Design a fluorescent LAMP detection kit for detecting *Bacillus mermaidus* subspecies *Mermaidus*. The LAMP detection kit includes LAMP Master Mix with UDG (2×) reagent. The reaction system in the visualization LAMP detection kit is: Bst DNA polymerase, dNTPs, buffer, visualization dye detection solution, MgSO4, forward outer primer F3, reverse outer primer B3, forward inner primer FIP, and reverse inner primer BIP. Step 3: Extract DNA from the sample to be tested, and then add it as template DNA to the LAMP detection kit for LAMP amplification; Step 4: Observe the color change of the reaction system with the naked eye, analyze the obtained LAMP amplification products, and obtain the analysis results; Step 5: Verify the analytical results obtained in Step 5 using agarose gel electrophoresis.
[0012] Preferably, in step two, the concentrations of the inner and outer primers are set to 10 μmol / L, and the concentration ratio of the inner and outer primers is 8:1.
[0013] Preferably, the method for judging by visual observation in step four is as follows: if the sample is observed to be violet in the fluorescent dye, it is negative; if the sample is observed to be sky blue, it is positive.
[0014] Preferably, in step two, the reaction system used is as follows: LAMP Master Mix with UDG (2×) 10 μL, Bst DNA polymerase 1 μL, 10 μmol / L FIP 1.6 μL, 10 μmol / L BIP 1.6 μL, 10 μmol / L F3 0.2 μL, 10 μmol / L B3 0.2 μL, pET28a-ureC plasmid template DNA 1 μL, and ultrapure water 4.4 μL.
[0015] In any of the above schemes, the preferred reaction conditions are: reaction at 57-60°C for 50-55 min.
[0016] In any of the above schemes, the preferred reaction conditions are: reaction at 57°C for 55 min. The gene in question is the urease γ subunit gene of *Bacillus mermaidus* subsp. *mermaidensis*. ureC The specific gene sequence is found in *Bacillus mermaidus* subspecies *Mermaid*. ureC The sequence of the gene is shown in SEQ NO.1, specifically at positions 1116 bp-1308 bp. SEQ NO.1: TCGTACTTGGCAATGTGCCAATAAGATGAAGCTTCAGCGAGGTTCATTAGAAGGTGATACTCCATTTAGTGATAACACCCGAATCAAACGCTACATTGCTAAATATACGATCAATCCAGCTATTGCTCATGGTATTTCTCACGAAGTGGGTTCTCTAGAAGTGGGTAAACTGGCAGATATCGTTTTATGGGAT.
[0017] Technical effects and advantages of the present invention: The method of the present invention utilizes *Bacillus mermaidus* subspecies *Bacillus mermaidus*. ureC Four specific primers were designed, and a fluorescent LAMP detection kit for *Proteobacterium melanogaster* subsp. *mercanthus* was designed by optimizing the reaction system and conditions. The LAMP detection technology allows amplification to be completed at 57°C, eliminating the need for complex and expensive instruments, resulting in low operating costs. Furthermore, the kit provides a rapid reaction, completing the reaction within 55 minutes. This fluorescent LAMP detection kit for *Proteobacterium melanogaster* subsp. *mercanthus* exhibits high sensitivity and specificity, facilitating rapid diagnosis of diseases caused by *Proteobacterium melanogaster* subsp. *mercanthus* in aquatic animals, and is of great significance for the prevention and treatment of related diseases. Attached Figure Description Figure 1 For the present invention ureC Primer sequences and their positions; Figure 2 For the present invention ureC PCR amplification diagram of gene fragments; Figure 3 This is a PCR identification diagram of DH5α colonies transformed with pET28a-ureC according to the present invention; Figure 4 This is a visualization of the detection results of the LAMP method of the present invention; Figure 5 The figure shows the specificity test results of the LAMP detection method of the present invention; Figure 6 The graph shows the sensitivity test results of the LAMP detection method of the present invention. Figure 7 The figure shows the practical test results of the LAMP detection method of the present invention. Detailed Implementation
[0018] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0019] Example 1: Design of a specific primer set for LAMP detection of *Bacillus mermaidus* subsp. *mermaid* Visit the website of the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov) to search for *Bacillus mermaidus* subspecies *Mermaid*. ureC The gene sequence (Genbank accession number: CP079238.1) was aligned using SnapGene 4.3.7 software, and conserved regions were selected. Then, the sequence was uploaded to the NEB LAMP Primer DesignTool website (https: / / lamp.neb.com / ) by clicking "Paste Sequence". ureC Gene conserved sequences, design specific LAMP primer sets ( Figure 1 The primers were synthesized by Qingdao Beijing Qingke Biotechnology Co., Ltd. The primers consist of a forward outer primer F3, a reverse outer primer B3, a forward inner primer FIP, and a reverse inner primer BIP, wherein: The nucleotide sequence of the forward outer primer F3 is: 5'-TCGTACTTGGCAATGTGC-3'; The reverse outer primer B3 nucleotide sequence is: 5'-ATCCCATAAAACGATATCTGC-3'; The nucleotide sequence of the forward inner primer FIP is as follows: 5'-GCGTTTGATTCGAGGTGTTATCACTA-CAATAAGATGAAGCTTCAGCG-3'; The reverse inner primer BIP nucleotide sequence is as follows: 5'-TGCTAAATATACGATCAATCCAGCT-TTACCCACTTCTAGAGAACC-3'.
[0020] Example 2: Construction and Validation of Standard Plasmid Carrying the ureC Gene from *Bacillus mermaidus* Subspecies *Mermaid* The *Bacillus melanogaster* subsp. *mermaidus* was inoculated into TSB solid medium and incubated statically at 28°C for 18 h. Single colonies were picked and inoculated into TSB liquid medium and incubated with shaking at 28°C for 12 h. Genomic DNA of *Bacillus melanogaster* subsp. *mermaidus* was extracted using a commercially available bacterial genomic DNA extraction kit, and the DNA concentration and quality were determined using a NanoDrop micro-spectrophotometer.
[0021] Designed with pET28a plasmid Sac I restriction site homologous arm ureC Gene amplification primers were synthesized at Qingke Biotechnology Co., Ltd., including: The nucleotide sequence of the forward primer pET28a-ureC-F is as follows: 5'-CGGATCCGAATTCGAGCTC-GTTTAGCCGATACTGAGTTGCT -3'; The reverse primer pET28a-ureC-R nucleotide sequence is as follows: 5'- CAAGCTTGTCGACGGAGCTC-ATTGTTCTGGGACACCGTTA -3'.
[0022] Using the primers described above, and with the extracted genomic DNA of *Bacillus mermaidus* subsp. *mermaidensis* as a template, PCR amplification was performed. The amplified products were then subjected to 1% agarose gel electrophoresis, successfully amplifying a 1488 bp target gene fragment. Figure 2The amplified fragment was purified and recovered using an agarose gel extraction kit, and cloned into the pET28a plasmid using a homologous recombination kit. The plasmid was then transformed into *E. coli* DH5α competent cells via heat shock and cultured statically at 37°C for 18 h in LB agar containing kanamycin. Multiple single clones were picked and verified by PCR using the universal forward primer T7 and the universal reverse primer T7ter. The amplified gene fragment was 1774 bp. Figure 3 Positive clones of [product name] were sent to Qingke Biotechnology Co., Ltd. for Sanger sequencing. The correctly sequenced plasmid was named pET28a-ureC. pET28a-ureC was extracted using a plasmid extraction kit, and its mass and concentration were determined using a NanoDrop micro-volume spectrophotometer. The formula was used to calculate the concentration of pET28a-ureC: copies / μL = (6.02 × 10⁻⁶) / μL. 23 ) × (ng / μL×10 -9 The plasmid mass concentration was converted to copy number concentration using the formula (DNA sequence size × 660), which was then used as a standard for LAMP detection. The measured plasmid concentration was approximately 98.88 ng / μL, and the plasmid copy number was calculated to be approximately 1.3 × 10⁻⁶. 10 copies / μL.
[0023] Example 3: Establishment of a Visual LAMP Detection Method for *Bacillus mermaidus* Subspecies *Mermaid* According to the BeyoColor™ Isothermal Amplification Colorimetric Detection Kit instructions, the LAMP detection system for *Proteobacterium melanogaster* subsp. *mercantileveria* is as follows: 20 μL LAMP Master Mix with UDG (2×) 10 μL, Bst DNA polymerase 1 μL, 1.6 μL of 10 μmol / L FIP, 1.6 μL of 10 μmol / L BIP, 0.2 μL of 10 μmol / L F3, 0.2 μL of 10 μmol / L B3, 1 μL of pET28a-ureC plasmid template DNA, and 4.4 μL of ultrapure water. The reaction was then carried out in a 57°C water bath for 55 min. When the reaction solution is light blue, the result of the *Proteobacterium melanogaster* subsp. *mercantileveria* detection is positive; when the reaction solution is violet, the result is negative. Figure 4Wherein, 1: the primer set used in this invention; 2 and 3: other primer sets designed from the NEB LAMP Primer Design Tool website). 5 μL of amplification product from each reaction was subjected to 1% agarose gel electrophoresis for verification. If the sample amplification product showed characteristic ladder-like bands, it indicated a positive result for the detection of *Proteobacterium melanogaster* subsp. *mercanthus*; if the sample amplification product showed no specific bands, it indicated a negative result for the detection of *Proteobacterium melanogaster* subsp. *mercanthus*. Figure 4 Wherein, 1: the primer set used in this invention; 2 and 3: other primer sets designed in the NEB LAMP Primer Design Tool website.
[0024] Primer set 2: The nucleotide sequence of the forward outer primer F3 is: 5'-TCATTAGAAGGTGATACTCCATT-3'; The reverse outer primer B3 nucleotide sequence is: 5'-ATAGGGGCATAGGCAACT-3'; The nucleotide sequence of the forward inner primer FIP is as follows: 5'-AGAACCCACTTCGTGAGAAATACCA-TGATAACACCCGAATCAAACG-3'; The reverse inner primer BIP nucleotide sequence is as follows: 5'-TGGGTAAACTGGCAGATATCGT-AACCACATTTCAAAATTAGAGC-3'.
[0025] Primer set 3: The nucleotide sequence of the forward outer primer F3 is: 5'-GATGACTTACCTATTAATGTGG-3'; The reverse outer primer B3 nucleotide sequence is: 5'-CATTTAAGGTGTCTGAGTGG-3'; The nucleotide sequence of the forward inner primer FIP is as follows: 5'-GCTCCAGCTTCAATTTGCTCTC-GTTTATTTGGTAAAGGTTGTGTC-3'; The reverse inner primer BIP nucleotide sequence is as follows: 5'-ACGCCCGCTGCTATTAATAAC-TAGCAACTTGAATATCCATCTCA-3'.
[0026] Example 4: Establishment of a Visual LAMP Detection Method for *Bacillus mermaidus* Subspecies *Mermaid* The difference between this embodiment and Embodiment 3 is that the reaction at 57°C for 55 minutes is changed to a reaction at a constant temperature water bath at 60°C for 50 minutes.
[0027] Example 5: Specificity test of the visual LAMP detection method for *Bacillus mermaidus* subspecies *Mermaid* Bacterial genomic DNA extraction kits were used to extract *Bacillus mermaidus* subspecies *Mermaidus* and *Bacillus mermaidus* subspecies *Aureobacterium*. P. damselae subsp. piscicida ), Vibrio harveyi ( Vibrio parahemolyticus ), Vibrio parahaemolyticus ( V. parahaemolyticus Edwardsiella tarda ( ), Edwardsiella tarda ( Edwardsiella tarda Aeromonas hydrophila ( ) Aeromonas hydrophila Aeromonas salmonii ( ), A. salmonicida ), and pseudoalternating monoclonal bacteria ( Pseudoalteromonas piscicida The genomic DNA of *Bacillus merantii* subsp. *merantii* was used as a template for LAMP experiments according to the optimal reaction system and procedure determined in Example 4. The results showed that only the LAMP reaction system containing the genomic DNA of *Bacillus merantii* subsp. *merantii* and the pET28a-ureC plasmid (positive control) was light blue, indicating a positive reaction; the LAMP reaction systems containing the genomic DNA of other strains or the control group were all violet, indicating a negative reaction. The amplified products were detected by 1% agarose gel electrophoresis. The results showed that lane 1 *Bacillus merantii* subsp. *merantii* and lane PC pET28a-ureC plasmid showed typical ladder-like bands, while no typical ladder-like bands appeared in other lanes. Figure 5 The DNA contained in the following samples were: 1: *Bacillus mermaidus* subsp. *mermaidensis* genomic DNA; 2: *Bacillus mermaidus* subsp. *fish-killing* genomic DNA; 3: *Vibrio harveyi* genomic DNA; 4: *Vibrio parahaemolyticus* genomic DNA; 5: *Edwards tarda* genomic DNA; 6: *Aeromonas hydrophila* genomic DNA; 7: *Aeromonas salmonicida* genomic DNA; 8: *Pseudomonas pseudoalteromonas* genomic DNA; PC: pET28a-ureC plasmid; NC: ultrapure water. The agarose gel electrophoresis results were consistent with the dye development results, indicating that the established LAMP detection method has good specificity.
[0028] Example 6: Sensitivity Test of Visual LAMP Detection Method for *Bacillus mermaidus* Subspecies *Mermaid* The pET28a-ureC plasmid constructed in Example 2 was serially diluted 10-fold. Using different concentrations of dilution as templates, LAMP experiments were conducted according to the optimal reaction system and procedure determined in Example 4. The results showed that when the pET28a-ureC plasmid concentration was 1.3 × 10⁻⁶, the optimal reaction was achieved. 9copies / μL, 1.3×10 8 copies / μL, 1.3×10 7 copies / μL, 1.3×10 6 copies / μL, 1.3×10 5 copies / μL, 1.3×10 4 copies / μL, 1.3×10 3 copies / μL, 1.3×10 2 copies / μL, 1.3×10 1 When the concentration was 1.3 × 10⁻⁶ copies / μL, the reaction system turned pale blue; when the concentration was diluted to 1.3 × 10⁻⁶ copies / μL, the reaction system turned pale blue. 0 copies / μL and 1.3×10 -1 When the concentration of pET28a-ureC plasmid was 10 copies / μL, the reaction system turned violet. The reaction product was detected by 1% agarose gel electrophoresis, and the results showed that the pET28a-ureC plasmid, after a 10-fold dilution to 1.3 × 10⁻⁶ copies / μL, was... 2 Even at a concentration of 1.3 × 10⁻⁶ copies / μL, typical ladder-like amplification bands were still visible; when the concentration was diluted to 1.3 × 10⁻⁶, the amplification bands were significantly reduced. 1 When diluted to 1.3 × 10⁻⁶ copies / μL, the band brightness became somewhat fainter; 0 copies / μL and 1.3×10 -1 When the number of copies / μL is 1, no amplification band appears. Figure 6 The concentrations of pET28a-ureC plasmid were 1:1.3×10⁻⁶. 9 copies / μL; 2: 1.3×10 8 copies / μL; 3: 1.3×10 7 copies / μL; 4: 1.3×10 6 copies / μL; 5: 1.3×10 5 copies / μL; 6: 1.3×10 4 copies / μL, 7: 1.3×10 3 copies / μL; 8: 1.3×10 2 copies / μL; 9: 1.3×10 1 copies / μL; 10: 1.3×10 0 copies / μL; 11: 1.3×10 -1 (Copies / μL; NC: sterile water). This indicates that the established LAMP detection method for *Bacillus mermaidus* subsp. *mermaidus* has a detection limit of 13 copies and high sensitivity.
[0029] Example 7: Effectiveness Test of Visual LAMP Detection Method for *Bacillus mermaidus* Subspecies *Mermaid* Forty healthy rockfish (Scorpionichthys schlegelii) with an average weight of 87.7 ± 7.8 g were purchased from an aquaculture company in Qingdao and temporarily housed in a seawater circulation system for 14 days, during which they were fed commercial feed twice daily. After acclimatization under laboratory conditions, they were randomly divided into two groups: an infection group of 30 fish and a control group of 10 fish. *Bacillus medusa* subsp. *melanocarpa* was inoculated into TSB solid medium and incubated statically at 28°C for 18 h. Single colonies were then picked and inoculated into TSB liquid medium and incubated with shaking at 28°C for 12 h. The bacterial concentration was adjusted to 1.0 × 10⁻⁶ using PBS. 7 For the challenge group, 100 μL of the above-mentioned bacterial solution was injected intraperitoneally into each *Scorpionichthys schlegelii*, while for the control group, 100 μL of PBS was injected intraperitoneally into each *Scorpionichthys schlegelii*. Three days after infection, all fish were euthanized using MS-222, and approximately 100 mg of liver, spleen, and intestinal tissue were collected and placed in the same centrifuge tube. PBS was added, and the mixture was thoroughly ground and heated at 95°C for 5 min. The supernatant was collected as template DNA. pET28a-ureC plasmid and ultrapure water were used as positive and negative controls, respectively. A LAMP assay was performed using the optimal reaction system and procedure determined in Example 4 to detect *Bacillus melanogaster* subspecies *Bacillus melanogaster*. The results showed that all infected samples and positive controls appeared pale blue, indicating a positive result, while the PBS group samples and sterile water appeared violet, indicating a negative result. LAMP amplification products were subjected to 1% agarose gel electrophoresis. The results showed that all infected group samples and positive controls exhibited typical ladder-like amplification bands, while PBS group samples and sterile water samples did not show ladder-like amplification bands, consistent with the colorimetric results. Figure 7 Among them, 1-9 are crude DNA samples extracted from 9 infected group Scorpionfish tissues; 10-18 are crude DNA samples extracted from 9 PBS group Scorpionfish tissues; PC is pET28a-ureC plasmid, and NC is ultrapure water.
[0030] Furthermore, the simultaneous extraction of crude DNA samples for PCR detection showed that the PCR results were consistent with the LAMP detection results, indicating that the LAMP detection method of this invention has high reliability.
[0031] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.
Claims
1. A LAMP primer set for detecting *Bacillus mermaidus* subspecies *Mermaid*, characterized in that, include: Forward outer primer F3, reverse outer primer B3, forward inner primer FIP, and reverse inner primer BIP; F3: 5'-TCGTACTTGGCAATGTGC-3'; B3: 5'-ATCCCATAAAACGATATCTGC-3'; FIP: 5'-GCGTTTGATTCGGGTGTTATCACTA-CAATAAGATGAAGCTTCAGCG-3'; BIP: 5'-TGCTAAATATACGATCAATCCAGCT-TTACCCACTTCTAGAGAACC-3'.
2. A detection reagent or kit containing the primers as described in claim 1.
3. A reagent kit for detecting *Bacillus merantii* subspecies *Mermaid*, characterized in that... The kit contains the primers of claim 1, and further includes at least one of Bst DNA polymerase, dNTPs, buffer, visualization dye detection solution, and MgSO4.
4. The application of the primers of claim 1, the detection reagents or kits of claim 2, or the detection kits of claim 3 in the detection of *Bacillus mermaidus* subspecies *Mermaidus*.
5. A method for detecting *Bacillus mermaidus* subspecies *Mermaid*, characterized in that, Includes the following steps: S1, Extract DNA from the sample to be tested; S2, using the extracted DNA as a template, perform LAMP amplification reaction using the primers described in claim 1; S3, Judging the amplification results.
6. The detection method according to claim 5, characterized in that, In step S2, the reaction system used is as follows: LAMPMaster Mix with UDG (2×) 10 μL, Bst DNA polymerase 1 μL, 10 μmol / L FIP 1.6 μL, 10 μmol / L BIP 1.6 μL, 10 μmol / L F3 0.2 μL, 10 μmol / L B3 0.2 μL, pET28a-ureC plasmid template DNA 1 μL, and ultrapure water 4.4 μL.
7. The detection method according to claim 5, characterized in that, In step S2, the reaction conditions used are: reaction at 57-60°C for 50-55 min.
8. The detection method according to claim 7, characterized in that, The reaction conditions used were: reaction at 57°C for 55 min.
9. A gene, characterized by, The gene is the urease γ subunit of *Bacillus mermaidus* subsp. *mermaidus*, and its sequence is shown in SEQ NO.1.