Application of CsSYP61 gene in regulating cucumber growth and development and powdery mildew resistance
By using stable genetic transformation of cucumbers and identification of CsSYP61 gene mutants, the problem of chemical control of cucumber powdery mildew was solved, enabling rapid identification and elimination of susceptible varieties, and improving the growth stability and powdery mildew resistance of cucumbers.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2026-04-19
- Publication Date
- 2026-06-30
AI Technical Summary
In current technologies, the control of cucumber powdery mildew mainly relies on chemical methods, which leads to the development of drug resistance and pesticide residue problems, and there is a lack of effective genetic modification methods to enhance resistance.
The CsSYP61 mutant was created through stable genetic transformation of cucumbers. The CsSYP61 gene mutation was identified using PCR amplification and sequencing technology, which eliminated varieties susceptible to powdery mildew and improved growth stability and resistance.
This method enables rapid identification and elimination of low-quality cucumber varieties, improves identification efficiency, provides a basis for studying the molecular mechanism of cucumber powdery mildew resistance, and enhances cucumber resistance to powdery mildew.
Smart Images

Figure CN122303467A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular biology technology, specifically involving CsSYP61 Application of genes in regulating cucumber growth and development and powdery mildew resistance. Background Technology
[0002] cucumber( Cucumis sativus L Powdery mildew is an important horticultural crop in greenhouse cultivation in my country. It is one of the major diseases affecting cucumber production, severely impacting yield and fruit quality. Currently, chemical control is the primary method, but this approach easily accelerates the development of drug resistance in pathogens and leads to pesticide residue problems, posing a dual threat to the sustainable development of the industry and human health. Breeding disease-resistant varieties is the most economical, effective, and environmentally friendly way to control cucumber powdery mildew. Furthermore, identifying and utilizing the disease-resistant genes within cucumbers themselves is fundamental to conducting molecular marker-assisted breeding and gene-editing breeding.
[0003] The Syntaxin family, as core components of Qc-SNARE, are key regulators of vesicle transport and membrane fusion, playing a crucial role in intracellular vesicle transport in eukaryotes. The SYP61 gene, initially discovered and identified during research on the Arabidopsis thaliana endomembrane system, is a Qc-SNARE protein located in the trans-Golgi network / early endosome (TGN / EE), with its core function being the regulation of vesicle transport. Its homologs are widely distributed in plants, animals, and fungi, exhibiting highly conserved functions in vesicle transport, stress response, and growth and development. The T-DNA insertion mutant (osm1) demonstrated that AtSYP61 / OSM1 participates in Arabidopsis osmotic stress and ABA signaling responses through interaction with specific SNARE complexes, marking the first time this gene was associated with plant stress response function. Subsequent studies have shown that the SYP61 gene plays an important role in plant growth, development, and stress response. In terms of growth and development, the Atosm1 / syp61 mutant exhibits delayed seed germination, inhibited root growth, and increased root branching under salt stress. The membrane localization of the aquaporin AtPIP2;7 is synergistically regulated by a complex formed by AtSYP61 and AtSYP121, a process that indirectly affects cell membrane water permeability. Regarding stress responses, the SYP61 gene has been shown to participate in the regulation of plant resistance to various abiotic stresses, including salt and nutrient stress. Studies have demonstrated that AtSYP61, AtSYP121, and AtVAMP727 form a SNARE complex, mediating vacuolar membrane H2O. + -ATPase (VHA-a1) is transported from the TGN to the vacuoles under high salt stress, thereby regulating cellular ion homeostasis and salt tolerance. AtSYP61 and the RING-type E3 ubiquitin ligase AtATL31 work synergistically in carbon / nitrogen (C / N) nutrient stress (such as high carbon and low nitrogen conditions) to jointly regulate plant tolerance to nutrient imbalance.
[0004] Although SYP61 was initially identified as an abiotic stress response factor, it may also be involved in plant disease resistance responses to biotic stress. OsSYP61 expression peaked at 8 hours after rice blast inoculation and then declined, suggesting that this gene may play an important role in rice pathogen defense, particularly in vesicle transport and signal transduction. AtSYP61-vesicles were purified by fluorescently labeled immunoaffinity, and the resulting vesicle proteome revealed that AtSYP61 is involved in the secretion of cell wall components (cellulose, pectin). Furthermore, the AtMLO2 protein, a branch of the MLO, was found on AtSYP61-vesicles. Using a hybridization method combining vesicle immunoisolation and a large-scale carbohydrate antibody microarray, the glycan profile of AtSYP61-labeled vesicles in the Arabidopsis trans-Golgi network was analyzed, confirming that SYP61 mediates the directed transport and deposition of cell wall polysaccharides. These results indicate that AtSYP61-mediated vesicle transport may play an important role in powdery mildew resistance. Currently, some progress has been made in understanding the genes that regulate powdery mildew resistance in cucumbers, but no studies have found a link between CsSYP61 and cucumber powdery mildew resistance, nor are there any technical solutions for improving cucumber powdery mildew resistance using the CsSYP61 gene. Summary of the Invention
[0005] Therefore, this invention creates a stable genetic transformation of cucumber. CsSYP61 The mutant material was analyzed, and its SPAD, plant height, leaf area, and fruit length were measured to reveal... CsSYP61 Gene mutations inhibited plant growth. Further identification of powdery mildew resistance revealed that... CsSYP61 Gene mutations increase the plant's susceptibility to powdery mildew.
[0006] One of the objectives of this invention is to provide CsSYP61 The application of genes in the elimination of cucumber varieties with poor growth stability and / or susceptibility to powdery mildew, the aforementioned CsSYP61 The gene nucleotide sequence is shown in SEQ ID NO.1.
[0007] The second objective of this invention is to provide CsSYP61 Application of genes in maintaining or improving cucumber growth and development and resistance to powdery mildew.
[0008] The third objective of this invention is to provide a method for eliminating cucumber varieties with poor growth stability and / or susceptibility to powdery mildew, comprising the following steps: using the DNA of the material to be tested as a template, performing PCR amplification, sequencing the amplification product, and when it contains... CsSYP61 The complete gene sequence is retained for that variety; if it does not contain... CsSYP61 If the gene sequence is complete, the variety will be eliminated.
[0009] In some specific embodiments, the preferred PCR amplification primers are as follows: CsSYP61-Hi-TOM-F: GGAGTGAGTACGGTGTGCGTGGAACGAACTCGGGAATG; CsSYP61-Hi-TOM-R:GAGTTGGATGCTGGATGGGATGACACGGTTCAGAGAAGC.
[0010] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention verifies that in cucumber plants CsSYP61 After gene mutation, the mutant plants showed significantly reduced average plant height and leaf area compared to the unmutated plants, while fruit length remained largely unchanged. However, their susceptibility to powdery mildew was increased. These results can be used to... CsSYP61 Using genes to eliminate low-quality cucumber varieties significantly reduces time and improves efficiency compared to conventional phenotypic identification. Identification can be completed before planting and cultivation, further enhancing efficiency.
[0011] Furthermore, this application also addresses the problems in existing research. CsSYP61 The lack of understanding of the link between genes and cucumber powdery mildew resistance provides a new theoretical basis for the study of the molecular mechanism of cucumber powdery mildew resistance, and also provides a reference for the discovery of disease resistance genes in other cucurbitaceous crops. Attached Figure Description
[0012] Figure 1 The cucumber T0 generation in Embodiment 1 of the present invention CsSYP61 Editing efficiency detection and acquisition results of transgenic positive materials.
[0013] Figure 2 The cucumber in Embodiment 1 of the present invention CsSYP61 Efficiency of gene editing detection in biallelic mutant single plants.
[0014] Figure 3 The cucumber in Embodiment 1 of the present invention CsSYP61 (Bi) Identification of growth phenotypes of bis-allelic mutants.
[0015] Figure 4 The cucumber in Embodiment 1 of the present invention CsSYP61 (Bi) Identification of powdery mildew resistance in bisallelic mutants. Detailed Implementation
[0016] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the following embodiments are all conventional means well known to those skilled in the art, and all reagents and consumables are commercially available products.
[0017] Example 1 This embodiment provides a method for utilizing CsSYP61 The application of genes in regulating cucumber growth and development and powdery mildew resistance is as follows: 1.1 Cucumber CsSYP61 Breeding gene knockout mutants 1.1.1 Experimental Materials The recipient material was cucumber germplasm CU2 of the South China type (from the National Key Laboratory of Germplasm Innovation and Utilization of Fruit, Vegetable and Horticultural Crops, Huazhong Agricultural University), the vector was CRISPR / Cas9 gene editing vector pASEGU-Cssyp61, and the reagents included Agrobacterium strain (GV3101), DNA extraction kit, etc., all of which were purchased from conventional biochemical reagent suppliers.
[0018] 1.1.2 Stable genetic transformation of cucumber (1) Explant preparation: Take plump and uniformly sized CU2 cucumber seeds and soak them in 55℃ warm water for more than half an hour to remove the seed coat. In a clean bench, first wash with 75% alcohol for 5 seconds, then soak in 0.3% sodium hypochlorite solution for 15 minutes, and finally rinse with sterile water 6 times. Transfer the sterilized seeds to the prepared seed germination medium and germinate in the dark at 25℃ for 2 days. Take the germinated seeds and cut off about 1 / 3 of the cotyledons in a clean bench, remove the hypocotyl, and separate the two cotyledons; each cotyledon will form a U-shaped wound near the end, which is the explant. The seed germination medium formula is as follows: MS solid medium with 2 mg / L 6-BA and 1 mg / L ABA added.
[0019] The MS solid culture medium was prepared as follows: Weigh 4.43g MS powder and 30g sucrose, add to 1L of pure water, adjust the pH to 5.7-5.8 with 0.5M KOH, add 3g / L plant gel, and autoclave at 121℃ for 15 min.
[0020] (2) Agrobacterium infection: Agrobacterium culture stored at -80℃ was transferred to 2 mL of LB medium containing 50 mg / L Kan and 50 mg / L Rif, and incubated overnight at 28℃ and 200 rpm with a shaker. Then, it was diluted 1:500 and added to 50 mL of LB medium containing 50 mg / L Kan and 25 mg / L Rif, and incubated overnight at 28℃ and 200 rpm. When the culture reached OD... 600 When the concentration is 0.4-0.8, Agrobacterium is collected by centrifugation at 6000 rpm for 8 min, and the cells are resuspended in 1M liquid medium and diluted to OD. 600Set the value to 0.2 for later use. Remove the plunger from the 20mL syringe and place the cotyledonary explant into the syringe barrel. Draw more than 10mL of Agrobacterium tumefaciens solution through the needle hole and push the plunger forward until it stops at the 10mL mark. Seal the needle hole at the syringe tip with a rubber stopper, and pull the plunger to stop it at the 20mL mark. Hold this position for 1.5 minutes to apply negative vacuum. Gently release the plunger and wait for it to slowly return to the 10mL mark. Repeat the negative vacuum application for 1.5 minutes once more.
[0021] The formulation of IM liquid culture medium is as follows: 2 mg / L BA, 1 mg / L ABA, 80 mg / L LAS and 2.5 mM MES are added to MS liquid culture medium (the pH of the stock solution used for MES is adjusted to 5.2).
[0022] (3) Co-culture: After infection, the explants were spread on filter paper and the attached bacterial solution was gently blotted dry. The explants were then transferred to filter paper and co-cultured at 24°C in the dark for 3 days. The luminescence of GFP was observed under a fluorescence stereomicroscope to assess the infection efficiency.
[0023] The co-culture medium formulation is as follows: MS solid medium is supplemented with 2 mg / L BA, 1 mg / L ABA, 80 mg / L AS and 2.5 mM MES (the pH of the stock solution used for MES is adjusted to 5.2).
[0024] (4) Differentiation and regeneration: Wash the explants 5-8 times with sterile water, dry the liquid on the surface with absorbent paper, then transfer the explants to the recovery medium and culture them under light for 7 days before changing to the differentiation medium. After one to two months of culture under light, select the cotyledons containing GFP fluorescent buds under a stereofluorescence microscope and subculture them onto the rooting medium to induce rooting.
[0025] The recovery medium was formulated as follows: MS solid medium supplemented with 2 mg / L BA, 1 mg / L ABA, and 200 mg / L TMT. The differentiation medium was prepared by adding 100 mg / L Kan antibiotic to the recovery medium.
[0026] (5) Rooting and transplanting Well-rooted transgenic seedlings were transplanted into sterilized substrate and hardened off in a light incubator for one month before being transplanted into a plastic greenhouse until fruit set. The rooting medium was prepared by adding 200 mg / L MT to MS solid medium.
[0027] 1.1.3 CsSYP61 Gene target site editing detection The Hi-TOM primer design principles refer to the gene editing mutation sequencing operation guide (http: / / 121.40.237.174 / Hi-TOM / Sample_acceptance_sanyang.php). CsSYP61 0.2g of fresh leaves from mutant plants were used to extract plant DNA using the CTAB method for Hi-TOM sequencing identification. The DNA was then subjected to PCR amplification. Successfully amplified PCR products were sent to the Hangzhou Fuyang Rice Research Institute for Hi-TOM sequencing identification. After the sequencing results were returned, the editing status was determined in Geneious software based on sequence alignment results (see results below). Figure 1 ).
[0028] The PCR amplification primers were CsSYP61-Hi-TOM-F: GGAGTGAGTACGGTGTGCGTGGAACGAACTCGGGAATG; and CsSYP61-Hi-TOM-R: GAGTTGGATGCTGGATGGGATGACACGGTTCAGAGAAGC.
[0029] The PCR amplification reaction system is shown in the table below:
[0030] The PCR amplification reaction procedure is shown in the table below:
[0031] Figure 1 The results showed that: in transgenic plants CsSYP61 Different degrees of insertion / deletion mutations were detected in the gene target site regions: the editing efficiency of Line 1 was 58.88%, mainly consisting of single base insertions (I); the editing efficiency of Line 2 was 26.39%, mainly consisting of small fragment deletions (D); and the editing efficiency of Line 3 was 24.92%, with single nucleotide polymorphism (SNP) mutations detected in addition to small fragment deletions. To obtain transgenic offspring seeds, T0 generation positive plants were self-pollinated and crossed with the genetic transformation recipient CU2 (CU2 as the female parent). Due to overwintering environmental limitations, only plump backcross F1 (BC1) seeds from the cross with the wild type were harvested.
[0032] 1.2 Cucumber CsSYP61 (Bi) Identification of growth phenotypes of biseleno mutants 1.2.1 Experimental Materials The fully-grown backcross generation (BC1) obtained by crossing with wild type. CsSYP61 (Bi) bisellic mutant.
[0033] 1.2.2 Cucumber CsSYP61(Bi) Identification of growth phenotype of biseleno mutants Due to T0 generation CsSYP61 (Self-pollination of the mutant did not yield plump seeds, and no homozygous mutants were isolated from BC1 obtained by hybridization with the genetic transformation recipient CU2. Therefore, fluorescently positive seeds from the T0 generation Line 1, which had a high editing efficiency, were germinated and screened to obtain...) CsSYP61 (Dual allelic mutant single plant (hereinafter uniformly named)) CsSYP61 (Bi) Gene editing detection was performed on each individual plantlet using method 1.1.3 (named Line 1-BC1-1, Line 1-BC1-2, etc., respectively; results are shown in […]). Figure 2 ).
[0034] Depend on Figure 2 It can be known that: CsSYP61 The editing efficiency of most individual plants in the biallelic mutants was around 50%, with Line1-BC1-1 achieving an editing efficiency of 75.32%. The editing types were mainly base insertion (I) and deletion (D).
[0035] Using the disease-susceptible cucumber cultivar CU2 as a control, the disease was treated with... (Bi) Comparative analysis of growth phenotypes of mutants was conducted (results are shown in...). CsSYP61 ).
[0036] Depend on Figure 3 It can be seen that during the four-leaf clover stage, [[ID= The mutation resulted in abnormal growth points and leaf shape, with significantly smaller leaves and a significantly higher SPAD content than the wild type. To further clarify... The effects of mutations on plant growth and development were investigated by measuring the SPAD value, plant height, leaf area, and fruit length of mature plants. Results were consistent with those at the four-leaf stage. The (Bi) mutant had a significantly higher SPAD value than the wild type. The average plant height and leaf area fraction of the wild-type plants were reduced by 35.95% and 41.43%, respectively, compared to the wild type. Wild type and... Statistical results on fruit length of the (Bi) mutant showed that the average fruit length of the wild type was 24.87 cm, and the average fruit length of the mutant was 26.67 cm. Statistical analysis revealed no significant difference between the two. The above data indicate that... The gene mutation resulted in a significant reduction in plant height and leaf area, with no significant difference in fruit length, while the SPAD value increased significantly, indicating that the gene mutation inhibited the plant's vegetative growth and altered the photosynthetic capacity of the leaves.
[0037] 1.3 Cucumber (Bi) Identification of powdery mildew resistance in bisellic mutants 1.3.1 The experimental materials are the same as those in 1.2.1.
[0038] 1.3.2 Cucumber (Bi) Identification of powdery mildew resistance in bisellic mutants For wild type and (Bi) Mutant plants at the four-leaf-one-heart stage were inoculated with fresh powdery mildew using a spore suspension spray method: First, use a brush to gently brush the fresh powdery mildew spores from the diseased leaves into a 10µg / mL SDS solution, stir and mix well, and then use a hemocytometer under a microscope to count the spores to adjust the spore concentration to 5×10⁻⁶. 5 spores / mL; then spray the spore suspension evenly onto the leaf surface using a sprayer, ensuring each leaf is inoculated, ideally with droplets covering the entire leaf without running off. After inoculation, transfer to an artificial climate chamber for cultivation (results see...). ).
[0039] Disease severity levels are determined as follows: Level 0 indicates resistance, Level 9 indicates infection, and there are a total of six levels: 0, 1, 3, 5, 7, and 9. 0: Leaves are clean and free of disease spots; 1: A small number of fine, blurry white powdery spots, with the affected area covering less than 5% of the leaf area; 3: The powdery mildew layer is thin, and the area of lesions accounts for more than 5% but less than 30% of the leaf area; 5: The powdery mildew layer is thick, and the lesion area accounts for more than 30% but less than 50% of the leaf area; 7: The powdery mildew layer is thick, and the lesions cover more than 50% but less than 75% of the leaf area; 9: The powdery mildew layer is thick, and the lesions cover the entire leaf, with the lesions accounting for more than 75% of the leaf area.
[0040] The disease index is calculated as follows: Disease Index (DI) = [∑(number of diseased plants at each level × representative value at each level) / (total number of plants surveyed × highest representative value)] × 100.
[0041] The results showed that after inoculation with powdery mildew, compared with the wild type, (Bi) The area and thickness of powdery mildew lesions in the leaves of the mutant plants were significantly increased and thickened. The average powdery mildew disease index of the mutant and the wild type were 56.56 and 48.15, respectively, indicating that the knockout of the mutant plants was significantly larger and thicker. After gene modification, the plants' susceptibility to powdery mildew was significantly enhanced.
[0042] The above series of studies have shown that identifying plant components... Whether a gene mutation occurs can determine whether a cucumber variety has poor growth and is susceptible to powdery mildew, thus eliminating low-quality varieties. Compared with conventional phenotypic identification, this significantly shortens the identification time and improves efficiency.
[0043] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.
[0044] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. CsSYP61 The application of genes in the elimination of cucumber varieties with poor growth stability and / or susceptibility to powdery mildew is characterized by, The CsSYP61 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. CsSYP61 Application of genes in maintaining or improving cucumber growth and development and powdery mildew resistance.
3. A method for culling cucumber varieties with poor growth stability and / or susceptibility to powdery mildew, characterized in that, Includes the following steps: Using the DNA of the test material as a template, PCR amplification was performed, and the amplification products were sequenced. When the DNA contained... CsSYP61 The complete gene sequence is retained for that variety; if it does not contain... CsSYP61 If the gene sequence is complete, the variety will be eliminated.
4. The method according to claim 3, characterized in that, The specific primers for PCR amplification are as follows: CsSYP61-Hi-TOM-F: GGAGTGAGTACGGTGTGCGTGGAACGAACTCGGGAATG; CsSYP61-Hi-TOM-R:GAGTTGGATGCTGGATGGGATGACACGGTTCAGAGAAGC.