Rpa primer set and probe, kit and use method for detecting sweet potato chlorotic dwarf virus

By optimizing the reaction system of RPA primer set and probe, and combining it with LFD test strips or EP, the problem of rapid detection of sweet potato chlorosis dwarf virus in the field has been solved, realizing efficient and simple virus detection, which is suitable for both field and laboratory use.

CN122303489APending Publication Date: 2026-06-30HENAN ACAD OF AGRI SCI INST OF GRAIN CROPS
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HENAN ACAD OF AGRI SCI INST OF GRAIN CROPS
Filing Date
2026-05-15
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate detection of sweet potato chlorosis dwarf virus in fields and at the grassroots level. Furthermore, traditional methods are highly dependent on the environment and instruments, and cannot meet the requirements for detection speed and accuracy in the seed potato and seedling trading process.

Method used

This invention provides an RPA primer set and probe for detecting sweet potato chlorosis dwarf virus, combined with an RPA kit and usage method, to optimize the reaction system to adapt to field conditions. Results are displayed using LFD test strips or EP, simplifying the operation process.

Benefits of technology

It enables rapid, simple, and accurate detection of sweet potato chlorosis dwarf virus, suitable for both field and laboratory use, reducing dependence on instruments, improving detection efficiency and sensitivity, and applicable to the detection of multiple samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303489A_ABST
    Figure CN122303489A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of rapid detection of plant viruses, specifically the rapid detection of sweet potato chlorosis dwarf virus (SPCSV). It proposes an RPA primer set and probe, a reagent kit, and a method of use for detecting SPCSV. This patent is applicable to the rapid detection of SPCSV virus. One sample undergoes one RPA test reaction using a single LFD test strip to directly read the result. The experimental method is simple, rapid, and highly efficient, requiring no additional instruments, placing no restrictions on operators, and allowing the experiment to be conducted not only in the laboratory but also in the field. Alternatively, multiple samples can undergo multiple RPA tests, with results displayed via agarose gel electrophoresis. This reduces experimental costs and makes it more suitable for laboratory testing of suspected infected plants or virus-free seedlings.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rapid detection of plant viruses, and relates to the rapid detection of sweet potato chlorosis dwarf virus. Background Technology

[0002] In recent years, sweet potato viral diseases have become one of the main limiting factors for the development of the sweet potato industry, seriously affecting the yield and quality of sweet potatoes. In particular, combined infections with different viruses can cause symptoms such as yellowing, veining, and wrinkling of sweet potato leaves, stunted growth, excessive branching, failure to produce tubers or small tubers, and cracked tubers. Sweet potatoes reproduce asexually; once infected with a virus, the plant remains infected for life. As the virus accumulates in tubers, seeds, and seedlings, it can cause incalculable losses to the yield and quality of sweet potatoes in the same planting area.

[0003] Virus testing for sweet potatoes mainly refers to the quarantine of sweet potato seedlings, seed potatoes, and tubers (roots). Among the more than 20 types of sweet potato viruses detected in my country, Sweet potato chlorotic stuntvirus (SPCSV) is one of the most serious sweet potato viruses in the country. SPCSV is a dichotomous virus with a genome composed of double-stranded positive-sense RNA. It belongs to the genus Crinivirus of the family Closteroviridae and is divided into East African (EA) and West African (WA) strains, with the WA strain being the dominant strain in my country. The main harm of SPCSV is that this virus can form synergistic diseases with other viruses. While it may cause mild symptoms when infected alone, it can co-infect sweet potatoes with various viruses such as Sweet potato feathery mottle virus (SPFMV), Sweet potato virus G (SPVG), Sweet potato latent virus (SPLV), and Sweet potato chlorotic fleck virus (SPCFV), exacerbating the damage and leading to reduced yields or even crop failure. Seed tubers carrying SPCSV are a key factor in the severe occurrence of sweet potato viral diseases. Therefore, my country stipulates that the SPCSV carrier rate of virus-free sweet potatoes should be 0 at all stages of testing for virus-free seed potatoes (seedlings).

[0004] Sweet potato virus disease detection is necessary in various processes, including field planting, laboratory cultivation of virus-free seedlings, and seed potato or seedling trading. Detection methods include NCM-ELISA, indicator plants, PCR, and RT-PCR. However, these methods have drawbacks such as high requirements for the environment and personnel, the need for specific instruments, and long detection times, making them unsuitable for grassroots units or field testing. In recent years, RPA / RT-RPA-LFD / EP, combining recombinase polymerase amplification (RPA) or RT-RPA with agarose gel electrophoresis (EP) or lateral flow dipstick (LFD), has received increasing attention. It offers advantages such as high sensitivity, strong specificity, low instrument dependence, and short detection time, making it suitable for point-of-care testing. However, in practical applications, RT-RPA-LFD / EP detection needs to be able to cope with different application scenarios. For example, samples extracted from the field may contain polysaccharide, polyphenol and protein residues that may affect the reaction efficiency. It is also difficult to guarantee that the RT-RPA reaction temperature and environment in the field or seed potato and seedling trading venues will reach the optimal conditions. The seed potato and seedling trading process also needs to meet the requirements of fast detection speed and high accuracy. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention proposes an RPA primer set and probe, a kit, and a method for using it to detect sweet potato chlorosis dwarf virus.

[0006] The technical solution of this invention is implemented as follows:

[0007] This application provides an RPA primer set and probe for detecting sweet potato chlorosis dwarf virus.

[0008] The detection primers are as follows:

[0009] SPCSV-F1 (SEQ ID No.1): 5' AGGAACGGCTAGTTTGGGAAGACGAGATA 3'

[0010] SPCSV-R1 (SEQ ID No. 2):

[0011] 5' Biotin-GGCATGTTAGATTGAATATGGTTTATGAAGTTGTG 3'

[0012] 2. The detection probe is as follows:

[0013] SPCSV-P (SEQ ID No. 3):

[0014] 5' 6-FAM-TCCAGATATTATGTCAAAGAGTCAAGAGGATGAGT / dSpacer / TAAGCGTCATATGGA-C3 Spacer 3'

[0015] Primer SPCSV-R1 has a biotin group attached to its 5' end; probe SPCSV-P has a 6-carboxyfluorescein group (6-FAM) attached to its 5' end, a cleavage recognition group (dSpacer) modified in the middle, and a blocking group (C3spacer) attached to its 3' end.

[0016] The application of the above-mentioned RPA primer set and probe in the preparation of reagents or kits for detecting sweet potato chlorosis dwarf virus.

[0017] A kit for detecting sweet potato chlorosis dwarf virus is also provided: the detection reaction system of the kit is as follows:

[0018] Buffer A 25 μL, Buffer B 10 μL, Buffer C 2.5 μL, 10 μM detection primers (SPCSV-F, SPCSV-R) 2 μL each, 10 μM probe (SPCSV-P) 0.6 μL, template and ddH2O (or DEPC ddH2O) 7.9 μL, total RPA reaction system 50 μL.

[0019] Buffer A contains: 4 mM DTT, 200 mM potassium acetate, 10% Carbowax 20M, 400 μM dNTPs, 6 mM ATP, 100 mM Tris at pH 7.9, and 100 mM creatine phosphate. Mix well and set aside.

[0020] Buffer B contains: 150 ng / μL -1 Bsu DNA polymerase, 500 ng·μL -1 Creatine kinase, 3 μg·μL -1 gp32 protein, 600 ng·μL -1 T4 uvsX, 300 ng·μL -1 T4 uvsY, 1 μg·μL -1 Mix Endonuclease IV, 50 U of M-MLV reverse transcriptase, and 100 U of RNase Inhibitor thoroughly and set aside.

[0021] Buffer C is 10 μM magnesium acetate.

[0022] Thirdly, the method of using the above-mentioned kit for detecting sweet potato chlorosis dwarf virus is provided, and the steps are as follows:

[0023] (1) Use total RNA from the leaves of the sweet potato sample to be tested or SPCSV standard plasmid as template, and ddH2O as negative control (CK).

[0024] (2) Add Buffer A, Buffer B, detection primers, probes, and templates to a 200 μL centrifuge tube, add ddH2O to 47.5 μL, mix well, and centrifuge to concentrate the solution at the bottom of the tube;

[0025] (3) Add Buffer C to the centrifuge tube, mix quickly, and centrifuge to concentrate the solution at the bottom of the tube;

[0026] (4) Immediately place the centrifuge tubes in a water bath (or other heater) to carry out the RT-RPA / RPA reaction;

[0027] (5) Use LFD test strips or EP to display the test results.

[0028] Optimization of the testing system:

[0029] (1) Primer concentration optimization

[0030] The standard working concentration of the primers in this patent is 0.40 μmol·L⁻¹. -1 The optimal primer working concentration for SPCSV RPA detection is 0.20 μmol·L⁻¹. -1 The lowest is 0.02 μmol·L⁻¹. -1 Below this concentration, the RPA reaction cannot be completed.

[0031] (2) Probe concentration optimization

[0032] The standard working concentration of the probe in this patent is 120 nmol·L⁻¹. -1 The optimal probe concentration for SPCSV RPA detection is 60 nmol·L⁻¹. -1 The lowest is 2.4 nmol·L -1 Below this concentration, the RPA reaction cannot be completed.

[0033] (3) Optimization of reaction time

[0034] The standard working time in this patent is 20 minutes. The optimal reaction time for SPCSV RPA detection is 15 minutes, and the shortest is 10 minutes. If the reaction is shorter than this time, the RPA reaction cannot be completed.

[0035] (4) Optimization of reaction temperature

[0036] The standard operating temperature in this patent is 42℃. The optimal reaction temperature for SPCSV RPA detection is 41℃, with a minimum of 38℃ and a maximum of 44℃. The RPA reaction cannot be accurately completed outside this range.

[0037] The present invention has the following beneficial effects:

[0038] (1) This patent is applicable to the rapid detection of SPCSV virus. One sample can be tested once using one LFD test strip to directly read the result. The experimental method is simple and fast, with high detection efficiency. No other instruments are required, and there are no restrictions on the operators. The experimental site is not limited to the laboratory, but can also be in the field. Multiple samples can also be tested multiple times, and the results can be displayed by agarose gel electrophoresis. The experimental cost is lower and it is more suitable for the detection of suspected infected plants or virus-free seedlings in the laboratory.

[0039] (2) The standard amplification system of RT-RPA / RPA in this patent is optimized, the reaction system is more stable, the reaction efficiency is higher, and the application range is wider.

[0040] (3) The sensitivity of the RT-RPA-LFD in this patent is 10. -10 ng·μL -1 The sensitivity of RT-RPA-EP is 10. - 8 ng·μL -1 The sensitivity of PCR is 10. -7 ng·μL -1 The three methods showed a high degree of consistency in detection rate, with RT-RPA-LFD exhibiting the highest sensitivity and reliable results.

[0041] (4) In this patent, field sweet potato samples and laboratory virus-free seedling samples were tested by RT-RPA-LFD / EP and RT-PCR, respectively. The detection rates of the two detection methods were highly consistent and the detection results were reliable. They can be used for rapid detection and identification of SPCSV virus. Attached Figure Description

[0042] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0043] Figure 1 This is a graph showing the primer screening results. 1 and 2: SPCSV F1 / R1, 3 and 4: SPCSV F2 / R2, M: DL2000.

[0044] Figure 2 The optimization results for the standard RPA amplification system for sweet potato virus are as follows: A: Optimization result of RPA-LDF buffer C; B: Optimization result of RPA-EP buffer C; C: Optimization result of RPA-LDF enhancer; D: Optimization result of RPA-EP enhancer.

[0045] Figure 3 Results of primer concentration optimization for SPCSV RPA-LFD.

[0046] Figure 4 Results of SPCSV RPA-LFD probe concentration optimization.

[0047] Figure 5 Results of SPCSV RPA-LFD reaction time optimization.

[0048] Figure 6 Results of SPCSV RPA-LFD reaction temperature optimization.

[0049] Figure 7 Results of SPCSV RPA-EP primer concentration optimization.

[0050] Figure 8 Results of SPCSV RPA-EP probe concentration optimization.

[0051] Figure 9 The results show the optimized reaction time for SPCSV RPA-EP.

[0052] Figure 10 Results of SPCSV RPA-EP reaction temperature optimization.

[0053] Figure 11 The results of SPCSV RPA-LFD, RPA-EP, and PCR reaction sensitivity tests are as follows: A: RPA-LFD test result; B: RPA-EP test result; C: PCR test result.

[0054] Figure 12 The results of SPCSV RPA-LFD, RPA-EP, and PCR specificity tests are as follows: A: RPA-LFD test result; B: RPA-EP test result; C: PCR test result.

[0055] Figure 13The following are the field practicality test results for SPCSV RPA-LFD, RPA-EP, and PCR: A: Field sample test results for RT-RPA-LFD; B: Field sample test results for RT-RPA-EP; C: Field sample test results for PCR; D: RT-RPA-LFD virus-free seedling sample test results; E: RT-RPA-EP virus-free seedling sample test results; F: PCR virus-free seedling sample test results. Detailed Implementation

[0056] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0057] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0058] 1. Test materials and main reagents

[0059] 1.1 Test materials

[0060] The SPCSV standard plasmid constructed in our laboratory is a cloning vector containing the SPCSV coat protein (CP) sequence. It has been tested on sweet potato leaves infected with sweet potato chlorotic dwarf virus (SPCSV), sweet potato feather mottle virus (SPFMV), sweet potato chlorotic fleck virus (SPCFV), and sweet potato latent virus (SPLV).

[0061] 1.2 Main Reagents

[0062] Vazyme's 2×Taq Master Mix (Dye Plus) (P112), and Anpu Future (Changzhou) Biotechnology Co., Ltd.'s DNA Isothermal Rapid Amplification Kit (Colloidal Gold Test Strip Type) (WLN8203KIT), DNA Isothermal Rapid Amplification Kit (Basic Type) (WLRB8201KIT), RNA Isothermal Rapid Amplification Kit (Colloidal Gold Test Strip Type)-II (WLRN8209KIT), RNA Isothermal Rapid Amplification Kit (Basic Type) (WLRB8207KIT), and Single Nucleic Acid Test Strip (WLFS8206). Primer and probe synthesis was completed by Sangon Biotech (Shanghai) Co., Ltd.

[0063] Example 1

[0064] Establishment and optimization of the RPA standard testing system

[0065] 1. Experimental Procedure

[0066] 1.1 Primer and probe design and screening

[0067] Based on the gene sequence alignment analysis of the SPCSV WA strain CP in GeneBank, primers and probes were designed for RPA amplification. The primer and probe sequences are as follows:

[0068] SPCSV-F1: 5' AGGAACGGCTAGTTTGGGAAGACGAGATA 3';

[0069] SPCSV-R1: 5' Biotin-GGCATGTTAGATTGAATATGGTTTATGAAGTTGTG 3';

[0070] SPCSV-F2: 5' CCAGATATTATGTCAAAGAGTCAAGAGGATGAGTT 3';

[0071] SPCSV-R2: 5' Biotin-GCGGTTGTCGCCAAATCATTACCTCTC 3';

[0072] SPCSV-P:

[0073] 5' 6-FAM-TCCAGATATTATGTCAAAGAGTCAAGAGGATGAGT / dSpacer / TAAGCGTCATATGGA-C3 Spacer 3'.

[0074] Primer SPCSV-R1 has a biotin group attached to its 5' end; probe SPCSV-P has a 6-carboxyfluorescein group (6-FAM) attached to its 5' end, a cleavage recognition group (dSpacer) modified in the middle, and a blocking group (C3spacer) attached to its 3' end.

[0075] Using the SPCSV standard plasmid constructed in our laboratory as a positive template and ddH2O as a negative template, PCR amplification was performed using SPCSV-F1 and SPCSV-R1, and SPCSV-F2 and SPCSV-R2 as primers, respectively, with 2×Taq Master Mix (Dye Plus). Reaction system: 2×Taq Master Mix 25 μL, Primers (10 μmol·L⁻¹) -11 μL of reagent and 1 μL of template were added to each sample, and ddH2O was added to bring the total volume to 50 μL. The reaction program was: 95℃ for 5 min; 95℃ for 15 sec, 60℃ for 15 sec, 72℃ for 30 sec, for 30 cycles; 72℃ for 5 min. The amplified products were separated by 1% agarose gel electrophoresis, and the electrophoresis results were then observed using a UV gel imaging system.

[0076] 1.2 Establishment and optimization of RPA standard amplification system

[0077] Using the SPCSV standard plasmid constructed in our laboratory as a positive template and ddH2O as a negative control (CK), and the DNA isothermal rapid amplification kit (colloidal gold test strip type) and RNA isothermal rapid amplification kit (colloidal gold test strip type)-II as controls, the reaction system followed the RPA amplification system of Li, J., Macdonald, J., & von Stetten, F.: Buffer A 25 μL, Buffer B 10 μL, Buffer C 2.5 μL, 10 μM detection primers (SPCSV-F, SPCSV-R) 2 μL each, 10 μM probe (SPCSV-P) 0.6 μL, template and ddH2O (or DEPC ddH2O) 7.9 μL, the total RPA reaction system was 50 μL. After thorough mixing, the mixture was rapidly centrifuged and placed in a water bath at 42℃ for RPA reaction.

[0078] Buffer A contains: 4 mmol·L -1 DTT, 200 mmol·L -1 Potassium acetate, 10% Carbowax 20M, 400 μmol·L -1 dNTPs, 6 mmol·L -1 ATP, 100 mmol·L -1 Tris at pH 7.9, 100 mmol·L -1 Mix the phosphocreatine thoroughly and set aside.

[0079] Buffer B contains: 150 ng / μL -1 Bsu DNA polymerase, 500 ng·μL -1 Creatine kinase, 3 μg·μL -1 gp32 protein, 600 ng·μL -1 T4 uvsX, 300 ng·μL -1 T4 uvsY, 1 μg·μL -1Mix Endonuclease IV, 50 U of M-MLV reverse transcriptase, and 100 U of RNase Inhibitor thoroughly and set aside.

[0080] Buffer C is 10 μmol·L -1 Magnesium acetate.

[0081] Based on this system, the standard amplification system for sweet potato virus RPA was optimized. The optimization scheme is as follows:

[0082] (1) Optimization of magnesium acetate concentration in Buffer C

[0083] The standard working concentration of magnesium acetate is 0.50 μmol·L⁻¹. -1 (10μM magnesium acetate 2.5μL) is set to 100%, and the concentration gradient is set to 0%, 10%, 20%, 50% and 100%.

[0084] (2) Selection of reinforcing agent

[0085] The reaction system is supplemented with trehalose (0–0.3 M), betaine (3–0 M), dimethyl sulfoxide (DMSO, 0–10%), tetramethylammonium chloride (TMAC, 0–100 mM), and bovine serum albumin (BSA, 0–100 ng / mL). -1 Enhancers such as [unspecified] can increase the efficiency and specificity of the RPA reaction.

[0086] 1.3 Interpretation of colorimetric results from the test strip (LFD)

[0087] After the RPA reaction is complete, dilute the solution 20 times with ddH2O, mix well, and then apply an appropriate amount of the diluted solution to the test strip for color development. Observe the results of the control line and test line interpretation within 5 minutes. The test strip has two bands from bottom to top: the test line (T, red) and the control line (C, blue / red) corresponding to SPCSV. The method for interpreting the color development results of the test strip is as follows:

[0088] (1) If both C and T show bands, it is considered that SPCSV is positive (+);

[0089] (2) If a band appears in C and no band appears in T, it is negative (-);

[0090] (3) If no band appears in C, the detection result is invalid regardless of whether there is a band in T, and the detection needs to be repeated.

[0091] 1.4 Interpretation of Gel Electrophoresis (EP) Results

[0092] After the RPA reaction, the RPA product was added to an equal volume of Tris-saturated phenol:chloroform:isoamyl alcohol (25:24:1), mixed well, centrifuged at 12000 rpm, and a suitable amount of supernatant was collected, mixed with loading buffer, and then analyzed by agarose gel electrophoresis. The electrophoresis results showed one band between 250 and 500 bp, corresponding to the detection fragment of SPCSV.

[0093] 2. Experimental Results

[0094] 2.1 Primer screening results

[0095] The primer screening electrophoresis results showed that ( Figure 1 The SPCSV F1 / R1 amplification bands were clear and bright, consistent with the expected size, while the SPCSV F2 / R2 amplification bands were blurry. Therefore, SPCSV F1 / R1 was selected as the primer for the RPA amplification system.

[0096] 2.2 RPA Standard Amplification System

[0097] At magnesium acetate concentrations of 40–100% (0.20 μmol·L⁻¹) -1 ~0.50 μmol·L -1 Under the specified conditions, all RPA amplification products displayed correct results on the test strips. Positive samples showed positive (+) and negative samples showed negative (-), with no false positives or false negatives observed. At 40–100% (0.20 μmol·L⁻¹) concentrations... -1 ~0.50 μmol·L -1 Since no concentration had a significant impact on the detection results, the optimal primer concentration was selected as 0.25 μmol·L⁻¹. -1 (10 μmol·L in the reaction system) -1 Magnesium acetate 1.25 μL). The detection rates of LDF and EP were highly consistent, and the results were reliable. Figure 2 A, B).

[0098] Adding trehalose, betaine, DMSO, TMAC, and BSA to the RPA reaction system did not significantly change the RPA amplification efficiency, and the detection rates of LDF and EP showed high consistency, indicating reliable results. Figure 2 C, D).

[0099] Example 2

[0100] Establishment and optimization of RPA-LFD detection system

[0101] 1. Experimental steps:

[0102] Using the SPCSV standard plasmid constructed in our laboratory as a positive template and ddH2O as a negative control (CK), the SPCSVRPA detection system was optimized using a DNA isothermal rapid amplification kit (colloidal gold test strip type) and the RPA standard amplification system established in Example 1. The optimized schemes are (1), (2), (3), and (4). The final reaction volume is 50 μL. After thorough mixing and rapid centrifugation, the mixture is placed in a water bath for RPA reaction, followed by test strip color development. The optimized system scheme is as follows:

[0103] (1) Primer concentration optimization

[0104] The working concentrations of primers SPCSV-F1 and SPCSV-R1 were 0.40 μmol·L⁻¹, respectively. -1 (2 μL of each 10 μM primer) was set to 100%, and concentration gradients of 1%, 2%, 5%, 10%, 20%, 50%, and 100% were set.

[0105] (2) Probe concentration optimization

[0106] The standard working concentration of probe SPCSV-P is 120 nmol·L⁻¹. -1 (10μM probe 0.6μL) is set to 100%, and the concentration gradient is set to 1%, 2%, 5%, 10%, 20%, 50% and 100%.

[0107] (3) Optimization of reaction time

[0108] Amplification times were 5 min, 10 min, 12 min, 15 min, 18 min, 20 min, and 25 min.

[0109] (4) Optimization of reaction temperature

[0110] Amplification temperatures were 38℃, 39℃, 40℃, 41℃, 42℃, 43℃, and 44℃.

[0111] 2. Experimental Results:

[0112] 2.1 Primer Concentration Optimization

[0113] The RPA standard amplification system contains 2 μL each of 10 μM primers SPCSV-F1 and SPCSV-R1, meaning the standard working concentration of the primers is 0.40 μmol·L⁻¹. -1 The primer concentration gradient was set to 1%–100% (0.004 μmol·L⁻¹). -1 ~0.40 μmol·L -1 ). In the range of 5–100% (0.02 μmol·L⁻¹) -1 ~0.40 μmol·L -1Under these conditions, all RPA amplification products displayed the correct results on the test strip. Positive samples showed positive (+), and negative samples showed negative (-). No false positives or false negatives were observed. Figure 3 ). At 2% (0.008 μmol·L -1 Under these conditions, the T-line is extremely shallow. At 5–100% (0.02 μmol·L⁻¹) concentrations, the T-line is very shallow. -1 ~0.40 μmol·L -1 Since no concentration had a significant impact on the detection results, the optimal primer concentration was selected as 0.20 μmol·L⁻¹. -1 (1 μL of 10 μM primer in each reaction system), minimum concentration 0.008 μmol·L⁻¹ -1 Below this concentration, the RPA reaction cannot be completed.

[0114] 2.2 Probe Concentration Optimization

[0115] The RPA standard amplification system contains 0.6 μL of 10 μM probe SPCSV-P, which means the standard working concentration of the probe is 120 nmol·L⁻¹. -1 The probe concentration gradient was set to 1–100% (1.2 nmol·L⁻¹). -1 ~120 nmol·L -1 ). In the range of 2–100% (2.4 nmol·L⁻¹) -1 ~120 nmol·L -1 Under these conditions, all RPA amplification products displayed the correct results on the test strip. Positive samples showed positive (+), and negative samples showed negative (-). No false positives or false negatives were observed. Figure 4 ). In the range of 2–100% (2.4 nmol·L⁻¹) -1 ~120 nmol·L -1 Since no concentration had a significant impact on the detection results, the optimal probe concentration was selected as 60 nmol·L⁻¹. -1 (0.3 μL of 10 μM probe in the reaction system), minimum value is 2.4 nmol·L⁻¹. -1 Below this concentration, the RPA reaction cannot be completed.

[0116] 2.3 Optimization of Reaction Time

[0117] RPA amplification was performed under a time gradient of 5–25 min. After reactions of 10 min, 12 min, 15 min, 18 min, 20 min, and 25 min, positive samples showed positive (+) and negative samples showed negative (-). The RPA amplification products all displayed the correct results on the test strip. Optimized reaction time results showed no false positives or false negatives. Figure 5At 25 minutes, the T-line was shallow, but this did not affect the interpretation of the results. There was no significant impact on the detection results at any time point between 10 and 25 minutes; therefore, the optimal reaction time of 15 minutes was selected.

[0118] 2.4 Optimization of Reaction Temperature

[0119] RPA amplification was performed under a temperature gradient of 38–44℃. After 15 minutes of reaction, the reaction products at each temperature showed correct results on the test strip. Positive samples showed positive (+), and negative samples showed negative (-). The optimized reaction temperature results showed no false positives or false negatives. Figure 6 At 38℃, the T-line is shallower, but this does not affect the interpretation of the results. Temperatures between 38℃ and 44℃ have no significant impact on the test results; therefore, 41℃ was selected.

[0120] Example 3

[0121] Establishment and optimization of the RPA-EP testing system

[0122] 1. Experimental Procedure

[0123] The RPA-EP detection system used the SPCSV standard plasmid constructed in our laboratory as the positive template and ddH2O as the negative control (CK). A DNA isothermal rapid amplification kit (basic type) was used. The reaction system contained Buffer A, Buffer B, Buffer C, 10 μM detection primers (SPCSV-F, SPCSV-R), template, and ddH2O. The total RPA reaction volume was 50 μL. After thorough mixing and rapid centrifugation, the mixture was placed in a water bath for the RPA reaction. The remaining system contents were the same as in Example 1. The results were interpreted by gel electrophoresis after RPA, and the electrophoresis and result interpretation were the same as in Example 1.

[0124] 2. Experimental Results

[0125] 2.1 Primer Concentration Optimization

[0126] The standard RT-RPA amplification system contains 2 μL each of 10 μM primers SPCSV-F1 and SPCSV-R1, meaning the standard working concentration of the primers is 0.40 μmol·L⁻¹. -1 The primer concentration gradient was set to 1%–100% (0.004 μmol·L⁻¹). -1 ~0.40 μmol·L -1 ). In the range of 2–100% (0.008 μmol·L⁻¹) -1 ~0.40 μmol·L -1Under the specified conditions, all RPA amplification products showed correct results in the gel, with positive samples showing positive (+) and negative samples showing negative (-). Primer concentration optimization results showed no false positives or false negatives. Figure 7 ). In the range of 2–100% (0.008 μmol·L⁻¹) -1 ~0.40 μmol·L -1 Since no concentration had a significant impact on the detection results, the optimal primer concentration was selected as 0.20 μmol·L⁻¹. -1 (1 μL of 10 μM primer in each reaction system), minimum concentration 0.008 μmol·L⁻¹ -1 Below this concentration, the RPA reaction cannot be completed.

[0127] 2.2 Probe Concentration Optimization

[0128] The standard RT-RPA amplification system contains 0.6 μL of the 10 μM probe SPCSV-P, which means the standard working concentration of the probe is 120 nmol·L⁻¹. -1 The probe concentration gradient was set to 1–100% (1.2 nmol·L⁻¹). -1 ~120 nmol·L -1 ). In the range of 5–100% (6 nmol·L⁻¹) -1 ~120 nmol·L -1 Under the specified conditions, all RPA amplification products were correctly displayed in the gel, with positive samples showing positive (+) and negative samples showing negative (-). Optimized probe concentration results showed no false positives or false negatives. Figure 8 ). In the range of 5–100% (6 nmol·L⁻¹) -1 ~120 nmol·L -1 Since no concentration had a significant impact on the detection results, the optimal probe concentration was selected as 60 nmol·L⁻¹. -1 (0.3 μL of 10 μM probe in the reaction system), minimum 6 nmol·L⁻¹ -1 Below this concentration, the RPA reaction cannot be completed.

[0129] 2.3 Optimization of Reaction Time

[0130] RPA amplification was performed under a time gradient of 5–25 min. After reactions of 10 min, 15 min, 20 min, and 25 min, the RPA amplification products all showed correct results in the gel. Positive samples showed positive (+) and negative samples showed negative (-). The optimized reaction time results showed no false positives or false negatives. Figure 9 The reaction time was not significantly affected at any time point between 10 and 25 minutes, so the optimal reaction time of 15 minutes was selected.

[0131] 2.4 Optimization of Reaction Temperature

[0132] RPA amplification was performed under a temperature gradient of 38–44 °C. After 15 min of reaction, the reaction products at each temperature showed correct results in the gel. Positive samples showed positive (+) and negative samples showed negative (-). The optimized reaction temperature results showed no false positives or false negatives. Figure 10 Since the test results were not significantly affected at temperatures ranging from 38 to 44℃, a temperature of 41℃ was selected.

[0133] Example 4

[0134] Sensitivity test

[0135] 1. RPA Sensitivity Test

[0136] The SPCSV standard plasmid constructed in our laboratory was used as the positive template for sensitive detection, and ddH2O was used as the negative control (CK). The working concentration of the template was 100 ng·μL. -1 Dilute sequentially in a 10-fold concentration gradient to a final concentration of 100 ng / μL. -1 10 ng·μL -1 1 ng·μL -1 10 -1 ng·μL -1 10 -2 ng·μL -1 10 -3 ng·μL -1 10 -4 ng·μL -1 10 -5 ng·μL -1 10 -6 ng·μL -1 10 -7 ng·μL -1 10 -8 ng·μL -1 10 -9 ng·μL -1 10 -10 ng·μL -1 10 -11 ng·μL -1 10 - 12 ng·μL -1 The remaining steps are the same as in Examples 1, 2, and 3.

[0137] 2. PCR sensitivity test

[0138] The template and primers were the same as in Example 1. PCR amplification was performed using 2×Taq Master Mix (Dye Plus), and the reaction system and procedure were the same as in Example 1. The amplification products were detected by 1% agarose gel electrophoresis, and the electrophoresis results were then observed using a UV gel imaging system.

[0139] 3. Sensitivity test results

[0140] SPCSV standard plasmid concentration at standard working concentration (100 ng·μL) -1 ) of 10 -12 ng·μL -1 ~100ng·μL -1 RPA amplification was performed under the following conditions, at 10 -10 ng·μL -1 ~100ng·μL -1 Under the given conditions, RPA-LFD showed correct results, with positive samples showing positive (+) and negative samples showing negative (-). The sensitivity test results indicated no false positives or false negatives. Figure 11 A); in 10 -8 ng·μL -1 ~10ng·μL -1 Under the given conditions, RPA-EP displays the correct results. Figure 11 B). In 10 -7 ng·μL -1 ~10ng·μL -1 Under the given conditions, all PCR amplification products were correctly displayed on agarose gels, with positive samples showing positive (+) and negative samples showing negative (-). No false positives or false negatives were observed. Figure 11 C). The sensitivity of RT-RPA-LFD is 10. -10 ng·μL -1 The sensitivity of RT-RPA-EP is 10. -8 ng·μL -1 The sensitivity of PCR is 10. - 7 ng·μL -1 RT-RPA-LFD has higher sensitivity than PCR, and the detection rates of the three methods are highly consistent, making the results reliable.

[0141] Example 5

[0142] Specificity test

[0143] 1. Total RNA extraction and reverse transcription from samples

[0144] Take an appropriate amount of leaves from plants infected with sweet potato virus, extract total RNA from the leaves according to the instructions of the TRIzol RNA extraction reagent, and store at -80℃ for later use; take a portion of the RNA and reverse transcribe it into cDNA according to the instructions of the PrimeScript™ RT reagent Kit with gDNAEraser (Perfect Real Time) kit, and store at -80℃ for later use.

[0145] 2. RPA Specificity Test

[0146] Total RNA from sweet potato leaves infected with SPCSV, SPFMV, SPCFV, and SPLV obtained in step 1 was used as a specific detection template, and ddH2O was used as a negative template. The working concentration of the specific detection template was 15–20 ng / μL. -1 The remaining steps are the same as in Examples 1, 2, and 3.

[0147] 3. PCR amplification test

[0148] The total cDNA from sweet potato leaves infected with SPCSV, SPFMV, SPCFV, and SPLV obtained in step 1 was used as a specific detection template, and ddH2O was used as a negative template. PCR amplification and electrophoresis were performed using 2×Taq Master Mix (Dye Plus), following the same steps as in Example 1.

[0149] 4. Specific detection results

[0150] RPA-LFD, RPA-EP, and PCR tests all showed ( Figure 12 Samples infected with SPCSV showed positive (+), while all other samples showed negative (-). The three detection methods consistently detected the same positive samples, indicating identical results. This demonstrates that the RPA-LFD and RPA-EP detection methods established in this invention are specific for SPCSV detection, exhibit no cross-reactivity with other viruses on sweet potatoes, and possess strong specificity for SPCSV.

[0151] Implementation Results Example

[0152] Field practicality test

[0153] 1. Total RNA extraction and reverse transcription from samples

[0154] Same as step 1 in Example 5.

[0155] 2. Field practicality test of RT-RPA

[0156] Total RNA from 8 field-collected sweet potato leaves and 11 laboratory-collected sweet potato virus-free seedling leaves obtained in step 1 was used as a template for field-practical detection. ddH2O was used as a negative template, and the working concentration of the template was 15–20 ng·μL. -1 The remaining steps are the same as in Examples 1, 2, and 3.

[0157] 3. PCR amplification test

[0158] The total cDNA from 8 field sweet potato leaves and 11 laboratory tissue culture sweet potato virus-free seedling leaves obtained in step 1 was used as a specific detection template, and ddH2O was used as a negative template. The PCR amplification method was the same as in Example 1.

[0159] 3. Results of field practicality test

[0160] The results of RT-RPA-LFD, RT-RPA-EP, and PCR detection of SPCSV in 8 field-collected leaf samples and 11 virus-free seedling samples all showed that ( Figure 13 Of the field samples, 5 were positive (+) and 3 were negative (-), with a positive rate of 62.5%. Of the virus-free vaccine samples, 0 were positive (+) and 11 were negative (-), with a positive rate of 0%. The positive samples detected by the three methods were consistent, and the test results were the same. The test results of field samples and virus-free vaccine samples show that the RT-RPA-LFD and RT-RPA-EP methods for detecting SPCSV established in this invention are accurate, reliable, convenient, and fast, and can be used for the wide detection of this virus.

[0161] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An RPA primer set and probe for detecting sweet potato chlorosis dwarf virus, characterized in that: The RPA primer set includes SPCSV-F1 primer and SPCSV-R1 primer. The nucleotide sequence of the SPCSV-F1 primer is shown in SEQ ID No. 1, and the nucleotide sequence of the SPCSV-R1 primer is shown in SEQ ID No.

2. Both primers have a Biotin tag attached to their 5' end. The nucleotide sequence of the probe is shown in SEQ ID No.

3. Both primers have a 6-FAM tag attached to their 5' end and a C3 Spacer 3 modified to their 3' end.

2. The use of the RPA primer set and probe described in claim 1 in the preparation of reagents or kits for detecting sweet potato chlorosis dwarf virus.

3. A kit for detecting sweet potato chlorosis dwarfing virus, characterized in that: Includes the RPA primer set and probe as described in claim 1.

4. The kit for detecting sweet potato chlorosis dwarfing virus according to claim 3, characterized in that: It also includes BufferA, BufferB and BufferC.

5. The kit for detecting sweet potato chlorosis dwarfing virus according to claim 4, characterized in that: The Buffer A contains 4 mM DTT, 200 mM potassium acetate, 10% Carbowax 20M, 400 μM dNTPs, 6 mM ATP, 100 mM Tris at pH 7.9, and 100 mM creatine phosphate.

6. The kit for detecting sweet potato chlorosis dwarf virus according to claim 5, characterized in that: The Buffer B contains 150 ng / μL -1 Bsu DNA polymerase, 500 ng·μL -1 Creatine kinase, 3 μg·μL -1 gp32 protein, 600 ng·μL -1 T4 uvsX, 300 ng·μL -1 T4 uvsY, 1 μg·μL -1 Endonuclease IV, 50 U of M-MLV reverse transcriptase, and 100 U of RNase inhibitor.

7. The kit for detecting sweet potato chlorosis dwarfing virus according to claim 6, characterized in that: The Buffer C is 10 μM magnesium acetate.

8. The method of using the kit for detecting sweet potato chlorosis dwarf virus according to any one of claims 3-7, characterized in that, The steps are as follows: (1) Extract total RNA from the sweet potato sample to be tested as a template; (2) Add Buffer A, Buffer B, detection primers, probes, and templates to a centrifuge tube, add ddH2O to 47.5 μL, mix well, and centrifuge to concentrate the solution at the bottom of the tube; (3) Add Buffer C to the centrifuge tube, mix quickly, and centrifuge to concentrate the solution at the bottom of the tube; (4) After heating the centrifuge tube, perform RT-RPA or RPA reaction. After the reaction is completed, use LFD test strips or EP to display the detection results.

9. The method of using the kit for detecting sweet potato chlorosis dwarf virus according to claim 8, characterized in that: The amount of Buffer A added is 25 μL, the amount of Buffer B added is 10 μL, the amount of Buffer C added is 2.5 μL, the concentration of the detection primer is 10 μM and the volume is 1 μL for each primer, and the concentration of the probe is 10 μM and the volume is 0.3 μL.

10. The method of using the kit for detecting sweet potato chlorosis dwarf virus according to claim 9, characterized in that: The temperature of the RT-RPA or RPA reaction is 38-44℃ and the time is 10-25 min.