Alternaria alternata isolated from artemisia vulgaris, fermentation supernatant thereof and application thereof in preparation of anti-prrsv medicine

Abstract

This invention belongs to the fields of microbial technology and veterinary pharmacology, and discloses a strain of *Alternaria alternata* isolated from Artemisia argyi, its fermentation supernatant, and its application in the preparation of anti-PRRSV drugs. The strain's preservation number is CCTCC NO: M2026443. The fermentation supernatant of this strain can inhibit PRRSV infection of cells and inhibit viral proliferation on cells. Cell-level anti-infection studies show that this strain has significant anti-PRRSV activity in vitro, reducing viral titer, viral genome copy number, and viral nucleoprotein production. It can be used to prepare a broad-spectrum anti-porcine reproductive and respiratory syndrome virus drug to control the occurrence of porcine reproductive and respiratory syndrome.

Description

Technical Field

[0001] This invention belongs to the fields of microbial technology and veterinary pharmacy, specifically relating to a strain of Alternaria isolated from Artemisia argyi, its fermentation supernatant, and its application in the preparation of anti-PRRSV drugs. Background Technology

[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most important pathogens threatening the global pig industry. The porcine reproductive and respiratory syndrome (PRRSV) it causes is characterized by reproductive disorders in sows and respiratory diseases in piglets, resulting in significant economic losses. PRRSV belongs to the Arteriviridae family and is an enveloped, single-stranded, positive-sense RNA virus with high genetic diversity, mainly divided into genotype 1 (European type) and genotype 2 (North American type). Significant differences in antigenicity and pathogenicity exist among different strains, posing a major challenge to vaccine control.

[0003] Currently, the prevention and control of PRRS mainly relies on live attenuated vaccines and inactivated vaccines, but vaccines have problems such as safety issues (virulence reversion) and limited cross-protection. There is a lack of highly effective and specific anti-PRRSV chemical drugs on the market, and some commonly used broad-spectrum antiviral drugs (such as ribavirin) have limited efficacy and may have side effects and residual risks. Therefore, the development of novel, highly effective, broad-spectrum, and safe anti-PRRSV drugs is urgently needed.

[0004] The pathogenic mechanism of PRRSV is complex, involving multiple aspects such as immune evasion, autophagy hijacking, and dysregulation of inflammatory responses. For example, the virus can inhibit the production of type I interferon through various mechanisms, promote its own replication by regulating the host cell autophagy pathway, or induce excessive inflammatory death (such as pyroptosis) in host cells, leading to tissue damage. These mechanisms may differ among different strains, but they also share common targets or pathways.

[0005] Plant endophytes are a class of microorganisms that live symbiotically within healthy plant tissues and represent a treasure trove of novel bioactive substances. They can produce secondary metabolites with diverse structures and unique activities, showing great potential in antibacterial, antiviral, and antitumor applications. However, research on the anti-PRRSV activity, especially broad-spectrum anti-PRRSV activity, of specific plant endophytes such as Alternaria alternatae or their metabolites has not been reported. Summary of the Invention

[0006] In view of the shortcomings of the prior art, the purpose of this invention is to provide a strain of Alternaria alternata 7-5 isolated from Artemisia argyi, with the preservation number CCTCC NO: M2026443.

[0007] Another object of the present invention is to provide the application of Alternaria alternata 7-5.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] The applicant screened a bacterium from 28 self-preserved endophytic fungi of Artemisia argyi that showed a significant inhibitory effect on porcine reproductive and respiratory syndrome virus infection. This bacterium was deposited at the China Center for Type Culture Collection on March 13, 2026, with the classification name: Alternaria alternata 7-5, accession number CCTCC NO: M2026443, address: Wuhan University, Wuhan, China.

[0010] The scope of protection of this invention also includes:

[0011] Fermentation broth or fermentation supernatant of Alternaria alternata 7-5.

[0012] A drug for treating porcine reproductive and respiratory syndrome virus, wherein the drug contains Alternaria 7-5, the fermentation broth of Alternaria 7-5 or its fermentation supernatant.

[0013] The use of Alternaria 7-5, the fermentation broth of Alternaria 7-5, the fermentation supernatant of Alternaria 7-5, or the above-mentioned anti-porcine reproductive and respiratory syndrome virus drugs in the preparation of drugs for the treatment or prevention of porcine reproductive and respiratory syndrome virus infection.

[0014] The use of Alternaria 7-5, the fermentation broth of Alternaria 7-5, the fermentation supernatant of Alternaria 7-5, or the above-mentioned anti-porcine reproductive and respiratory syndrome virus drugs in the preparation of preparations that inhibit porcine reproductive and respiratory syndrome virus.

[0015] The application of Alternaria 7-5, the fermentation broth of Alternaria 7-5, the fermentation supernatant of Alternaria 7-5, or the above-mentioned anti-porcine reproductive and respiratory syndrome virus drugs in the non-therapeutic in vitro inhibition of porcine reproductive and respiratory syndrome virus.

[0016] The application of Alternaria 7-5, the fermentation broth of Alternaria 7-5, the fermentation supernatant of Alternaria 7-5, or the above-mentioned anti-porcine reproductive and respiratory syndrome virus drugs in the preparation of treatment or prevention of porcine reproductive and respiratory syndrome.

[0017] Application of Alternaria 7-5, fermentation broth of Alternaria 7-5, fermentation supernatant of Alternaria 7-5, or the above-mentioned anti-swine reproductive and respiratory syndrome virus drugs in the preparation of feed additives.

[0018] The porcine reproductive and respiratory syndrome virus (PRRSV) genotypes mentioned above include genotypes 1 and 2. The strains used in the following experiments are all genotype 2.

[0019] Compared with the prior art, the advantages of the present invention are as follows:

[0020] In this invention, *Alternaria alternata* 7-5, an endophytic fungus of Artemisia argyi, was used to study the anti-infection activity against PRRSV at the cellular level. The results showed that it exhibits significant anti-PRRSV activity in vitro. *Alternaria alternata* 7-5, as a potential antiviral microecological agent, has the following advantages compared to vaccines and traditional antiviral chemical drugs:

[0021] For the first time, a bacterium with potent anti-PRRSV activity was isolated and identified from Artemisia argyi, providing a novel microbial resource with independent intellectual property rights for the development of new anti-PRRSV drugs.

[0022] Broad spectrum: The endophytic bacterial metabolites of this invention exhibit significant inhibitory effects at the cellular level on multiple genotypes (genotypes 1 and 2) of PRRSV strains, including the highly pathogenic strain WUH3 and the prevalent NADC30 recombinant strain. This solves the problem that some existing drugs or vaccines are ineffective against variant strains.

[0023] High efficacy: Through multiple methods, including cytopathic effect (CPE) inhibition assay, viral titer (TCID50) determination, and real-time quantitative PCR (qPCR) detection of viral genome copy number, it has been confirmed that endophytic fungus 7-5 can reduce the infectivity of PRRSV cells, inhibit PRRSV infection of cells, and reduce viral proliferation on cells, and can be used for the prevention and control of PRRSV infection.

[0024] Broad application prospects: This endophytic bacterium and its metabolites are naturally derived and can be produced on a large scale through fermentation, with controllable costs. It can be developed into veterinary injections, oral solutions, feed premixes for the prevention or treatment of PRRS, or as a disinfectant component for disinfection of farm environments, offering flexible application options. Attached Figure Description

[0025] Figure 1 This study aimed to isolate endophytic fungi and obtain fermentation supernatant.

[0026] Figure 2 Screening of fermentation supernatant for effective PRRSV-resistant strains.

[0027] Figure 3 The results show the cytotoxicity and half-maximal effective concentration of the fermentation supernatant from fermentation 7-5.

[0028] Figure 4 Investigation into the broad-spectrum anti-PRRSV activity of fermentation supernatant from 7-5;

[0029] Among them, the detection index is the viral copy number, of which PRRSV-WUH3 is a virulent strain and PRRSV-NADC30 is a weak strain;

[0030] Wherein: control is the virus control group.

[0031] Figure 5 The effect of fermentation supernatant at 7-5°C on the expression level of viral N protein in PRRSV-infected cells.

[0032] Figure 6 The effect of fermentation supernatant at 7-5°C on viral titer in PRRSV-infected cells.

[0033] Figure 7 The effect of fermentation supernatant at 7-5°C on the viral proliferation of PRRSV-GFP-infected cells;

[0034] Control was the virus control group infected with the PRRSV-GFP strain.

[0035] Figure 8 The effect of fermentation supernatant from 7-5 on the change in body weight in mice.

[0036] Figure 9 The effects of fermentation supernatant of 7-5 on organ lesions in mice. Detailed Implementation

[0037] To better understand the content of this invention, the following detailed description, in conjunction with specific embodiments, further illustrates the invention. However, the scope of protection of this invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and conditions in the embodiments of this invention are conventional methods. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the field; unless otherwise specified, the reagents or materials are all derived from commercial sources.

[0038] The PRRSV-WUH3 strain used in this invention is indexed in GenBank: HM853673.2, and the PRRSV-NADC30 strain is indexed in GenBank: JN654459.1. The PRRSV-GFP strain is a recombinant virus constructed by inserting a green fluorescent protein (GFP) coding sequence into the PRRSV-NADC30 backbone. Its GFP expression is stable and does not affect the basic viral replication characteristics.

[0039] Example 1:

[0040] Isolation, identification, and screening of PRRSV-resistant endophytic bacteria:

[0041] 1) Isolation of endophytic strains and acquisition of fermentation supernatant:

[0042] Whole plants of Artemisia argyi in good condition, including leaves, petioles, branches, and intact roots, were selected from different locations. After strict surface sterilization, the tissue was dissected with a sterile scalpel so that the cut surface came into contact with the culture medium. Intact tissue was used as a control to exclude surface fungi. The plants were incubated at a constant temperature of 28℃. Colonies of different morphologies were picked and purified, and the isolated and purified endophytic fungi were preserved in glycerol. Small-scale liquid fermentation was carried out on multiple isolated and purified endophytic fungi under the following conditions: PDB medium, 28℃, 180 rpm, for 7 days.

[0043] The fermentation broth was centrifuged to collect the supernatant, which was then freeze-dried directly. After freeze-drying, the supernatant was weighed and dissolved in sterile PBS to a concentration of 1.5 mg / ml, which was then used as a stock solution of the fermentation supernatant and frozen at -80°C for later use. The process for separating and obtaining the fermentation supernatant is as follows: Figure 1 As shown.

[0044] 2) Initial screening of PRRSV resistance in Marc 145 cells using fermentation supernatant from endophytic strains:

[0045] Marc145 cells were evenly seeded into 24-well cell culture plates and incubated in a constant temperature cell culture incubator. Once a uniform monolayer had formed, the supernatant was discarded, and the cells were washed three times with sterile PBS. The cells were then divided into three groups, with three replicates for each group:

[0046] (1) Fermentation supernatant group: Marc145 cells were inoculated with a mixture of DMEM medium containing fermentation supernatant of different strains and PRRSV-GFP (0.1 MOI); after 1 h, the supernatant was discarded, washed 3 times with PBS, and inoculated with DMEM medium containing fermentation supernatant of different strains, wherein the concentration of fermentation supernatant was 1 mg / mL.

[0047] (2) Cell control group: DMEM medium was added to Marc145 cells, the supernatant was discarded after 1 h, the cells were washed 3 times with PBS, and then DMEM medium was added.

[0048] (3) Virus control group: Marc145 cells were inoculated with PRRSV-GFP DMEM medium containing 0.1 MOI, the supernatant was discarded after 1 h, washed 3 times with PBS, and DMEM medium was added.

[0049] For all groups, 24-well cell culture plates were incubated in a constant-temperature cell culture incubator for 24 hours. The supernatant was discarded, and the cells were washed twice with sterile PBS. Cells were then digested and collected into EP tubes, centrifuged at 1500 rpm for 5 minutes, and the supernatant was discarded. The cells were resuspended in tissue fixative and subjected to flow cytometry. The proportion of fluorescent cells was used to screen fermentation supernatants that exhibited anti-PRRSV effects in vitro.

[0050] In this invention, PRRSV-GFP was used to evaluate the inhibitory effect of fermentation supernatant on viral infection. GFP expression is directly related to viral replication. When the fermentation supernatant inhibits viral replication, the expression level of GFP decreases, leading to a reduction in the proportion of fluorescent cells. The inhibition rate was obtained by calculating the proportion of GFP cells in the fermentation supernatant group and the proportion of GFP cells in the positive control group.

[0051] Virus inhibition rate (%) = [1 - (experimental group GFP-positive cell rate / virus control group GFP-positive cell rate)] × 100%.

[0052] The results are shown in Table 1 and... Figure 2 As shown, fermentation supernatant numbered 35 was not selected for subsequent experiments because its cytotoxicity was too high, resulting in the death of most cells before collection. Finally, fermentation supernatant numbered 1 in Table 1, with an inhibition rate of 95%, was selected. The strain that produced this fermentation supernatant was named 7-5, and it was chosen for subsequent experiments.

[0053] Table 1 Screening of Effective Fermentation Supernatant

[0054] .

[0055] 3) Cytotoxicity assay of fermentation supernatant numbered 1:

[0056] MARC-145 cells were used at 2 × 10⁶ cells per well. 4 Cells were seeded in 96-well plates and cultured for 12 hours until adherence. The old culture medium was discarded, and the cells were washed three times with sterile PBS and divided into two groups:

[0057] (1) Fermentation supernatant group: add maintenance medium (DMEM medium containing 2% serum) containing different concentrations (0.156, 0.3125, 0.625, 1.25, 2.5, 5, 10, 20, 40 mg / mL) of fermentation supernatant, and set 3 replicates for each concentration.

[0058] (2) Cell control group: DMEM medium was added to Marc145 cells, and three replicates were set.

[0059] After culturing each group of cells for 48 hours, 10 μL of CCK-8 solution was added to each well, and the cells were incubated for 2 hours. The absorbance (OD value) at 450 nm was measured using a microplate reader. Cell viability was calculated using the formula, and the cytotoxicity of the drug was calculated using GraphPad Prism software.

[0060] Cell viability (%) = [OD value of drug-treated group / OD value of control group] × 100%, results are shown in Table 2 and Figure 3As shown in Figure A, 1 mg / ml is a safe concentration, with cell viability exceeding 95%, and this concentration can be used for subsequent experiments.

[0061] Table 2. Cytotoxicity assay of fermentation supernatant

[0062] .

[0063] 4) EC50 determination of fermentation supernatant numbered 1:

[0064] The inhibition rates of different gradient drug concentrations on PRRSV-GFP were measured after inoculation. Marc145 cells were uniformly seeded in 24-well cell culture plates and cultured in a constant-temperature cell culture incubator. After the cells grew into a uniform monolayer, the supernatant was discarded, and the cells were washed three times with sterile PBS. The cells were then divided into three groups, with three replicates for each group:

[0065] (1) Fermentation supernatant group: Marc145 cells were inoculated with a mixture of DMEM medium containing different concentrations of fermentation supernatant and PRRSV-GFP (0.1 MOI); after 1 h, the supernatant was discarded, the cells were washed 3 times with PBS, and then inoculated with DMEM medium containing different concentrations of fermentation supernatant, namely 4000 µg / ml, 2000 µg / ml, 1000 µg / ml, 500 µg / ml, 250 µg / ml, 125 µg / ml and 62.5 µg / ml;

[0066] (2) Cell control group: DMEM medium was added to Marc145 cells, the supernatant was discarded after 1 h, the cells were washed 3 times with PBS, and then DMEM medium was added.

[0067] (3) Virus control group: Marc145 cells were inoculated with PRRSV-GFP DMEM medium containing 0.1 MOI, the supernatant was discarded after 1 h, washed 3 times with PBS, and DMEM medium was added.

[0068] For all groups, the 24-well cell culture plates were placed in a constant temperature cell culture incubator and cultured for 24 hours. The supernatant was discarded, and the cells were washed twice with sterile PBS. The cells were then digested and collected into 1.5 ml EP tubes. After centrifugation at 1500 rpm / min for 5 min, the supernatant was discarded, and the cells were resuspended in tissue fixative before flow cytometry.

[0069] The inhibition rate was calculated by determining the percentage of fluorescent cells. The results are shown in Table 3. Figure 3As shown in Figure B, the inhibitory effect of fermentation supernatant (number 1) on PRRSV-GFP showed a significant dose-dependent effect. At a high concentration of 4000 µg / mL, the percentage of GFP-positive cells decreased from approximately 29% in the virus control group to 0.2%-0.4%, with an inhibition rate exceeding 98%. The inhibitory effect gradually weakened as the metabolite concentration decreased: at 500 µg / mL, the inhibition rate was approximately 88-89%; at 250 µg / mL, the inhibition rate decreased to 59-63%; at 125 µg / mL, the inhibition rate further decreased to 29-39%; and at 62.5 µg / mL, the inhibition rate was only 15-18%, close to the level of the virus control group.

[0070] Using GraphPad Prism software for nonlinear fitting (four-parameter logistic model), the half-maximal effective concentration (EC50) of the metabolite of this invention inhibiting PRRSV-GFP was calculated to be 107.6 µg / mL. The R² of the fitted curve was above 0.95, indicating that the dose-response relationship was clear and the model fit was good.

[0071] Table 3. Inhibitory effects of metabolites on PRRSV-GFP

[0072] .

[0073] 5) Strain identification:

[0074] Molecular biology: Genomic DNA was extracted from colony 7-5, and its ITS gene sequence (approximately 800 bp) was amplified. The sequencing results were compared with the NCBI database. The results showed that 7-5 was most closely related to the type strain *Alternaria alternata*, with a similarity of up to 100%. Based on its morphological characteristics, it was identified as *Alternaria alternata*. This bacterium was deposited at the China Center for Type Culture Collection (CCTCC) on March 13, 2026, with the classification name *Alternaria alternata* 7-5, accession number CCTCC NO: M2026443, address: Wuhan University, Wuhan, China.

[0075] Spread an appropriate amount of 7-5 bacterial suspension onto PDA medium and incubate at 28℃ for 2-3 days. This strain appears as grayish-black, velvety colonies on PDA medium, producing a large number of conidiophores, which are solitary or clustered, with small wart-like protrusions on the surface, consistent with typical characteristics of the genus *Alternaria*. For fermentation, use PDB medium. After inoculation, incubate at 28℃ and 175 rpm / min in a shaker for seven days. After three days, yellow spherical solids appear; after seven days, the solids increase in number, forming flocculent hyphal aggregates that darken in color to brownish-yellow. The viscosity of the fermentation broth slightly increases compared to the initial medium. After filtering out the bacterial precipitate, the fermentation broth is yellowish-brown.

[0076] Example 2:

[0077] The effect of Alternaria 7-5 fermentation supernatant on the resistance of different strains of PRRSV in Marc145 cells:

[0078] 1) PRRSV-WUH3, PRRSV-NADC30 or PRRSV-GFP were selected to detect antiviral activity in Marc-145 cells. The in vitro antiviral effect of fermentation supernatant was detected by Western blot, TCID50 and qPCR.

[0079] Marc145 cells were evenly seeded into 24-well cell culture plates and incubated in a constant temperature cell culture incubator. Once a uniform monolayer had formed, the supernatant was discarded, and the cells were washed three times with sterile PBS. The cells were then divided into four groups, with three replicates in each group:

[0080] (1) Fermentation supernatant group: Marc145 cells were inoculated with DMEM medium containing fermentation supernatant of Alternaria 7-5 at a final concentration of 1 mg / mL and a mixture containing PRRSV-GFP, PRRSV-WUH3 or PRRSV-NADC30 at 0.1 MOI; after 1 h, the supernatant was discarded, the cells were washed 3 times with PBS, and then inoculated with DMEM medium containing fermentation supernatant of Alternaria 7-5 at a final concentration of 1 mg / mL.

[0081] (2) Cell control group: DMEM medium was added to Marc145 cells, the supernatant was discarded after 1 h, the cells were washed 3 times with PBS, and then DMEM medium was added.

[0082] (3) Virus control group: Marc145 cells were inoculated with DMEM medium containing 0.1 MOI of PRRSV-GFP, PRRSV-WUH3 or PRRSV-NADC30. After 1 h, the supernatant was discarded, the cells were washed 3 times with PBS, and DMEM medium was added.

[0083] (4) In the control group, Marc145 cells were inoculated with DMEM medium containing 1 mg / ml PDB (obtained by the same freeze-drying treatment as fermentation supernatant) and a mixture containing 0.1 MOI of PRRSV-GFP, PRRSV-WUH3 or PRRSV-NADC30. After 1 h, the supernatant was discarded, the cells were washed 3 times with PBS, and DMEM medium was added.

[0084] All groups had their 24-well cell culture plates incubated in a constant temperature cell culture incubator for 36 hours for subsequent detection.

[0085] 2) Virus replication detection:

[0086] (1) qPCR detection of viral genome: The 24-well cell plates cultured for 36 h were repeatedly frozen and thawed three times in a -80℃ freezer to fully release the viral particles in the cells. After centrifugation, the supernatant was collected for viral load detection. The detection method was performed according to the real-time quantitative PCR method recommended by the National Standard of the People's Republic of China for the Detection of Porcine Reproductive and Respiratory Syndrome (PRRS) (GB / T18090-2023). The primer sequences were: F: 5'-GCACTGATTGACAYTGTGCC-3', as shown in SEQ ID NO.1; R: 5'-CGCATGGTTCTCGCCAAT-3', as shown in SEQ ID NO.2; and the probe primer was: 5'-(FAM)AGTCACCTATTCAATTAGGGCGACCG(TAMRA)-3', as shown in SEQ ID NO.3. See Table 4 and Figure 4 As shown in the figures (all data in the figures are the average of three replicates), after incubating cells with different strains, the viral RNA copy number of the fermentation supernatant of 7-5 was measured. The CT values ​​of the 7-5 samples were all higher than those of the virus control group, indicating that the viral RNA copy number was low and could significantly inhibit the proliferation of the attenuated PRRSV strain NADC30 and the highly pathogenic strain WUH3 in Marc145 cells. The fermentation supernatant of 7-5 has broad-spectrum antiviral activity against PRRSV.

[0087] Table 4. Validation of the broad-spectrum anti-PRRSV activity of fermentation supernatant 7-5

[0088] .

[0089] (2) TCID50 determination of viral titer: The viral supernatant collected after 36 hours of culture was serially diluted (10⁻⁶ oz). -1 Up to 10 -8 MARC-145 cells were seeded in eight replicates at each dilution. Cells were cultured for 2-3 days, and cytopathic effect (CPE) was observed. Viral titers (lgTCID50 / 0.1 ml) were calculated for each group using the Reed-Muench method and compared with the virus control group to evaluate the inhibitory effect of the 7-5 fermentation supernatant on viral replication.

[0090] The results are shown in Table 5 and Figure 6 As shown, compared with the virus control group, the 7-5 fermentation supernatant treatment group significantly reduced the viral titer in PRRSV-infected cells, indicating that the 7-5 fermentation supernatant has an inhibitory effect on the proliferation of all three different strains.

[0091] Table 5 Results of virus titer reduction in fermentation supernatant (7-5).

[0092] .

[0093] (3) Western blot analysis of viral N protein expression: Cells were collected from 24-well plates cultured for 36 h, and total protein was extracted using RIPA lysis buffer. Protein concentration was determined by BCA method, followed by SDS-PAGE electrophoresis and transfer to a PVDF membrane. After blocking with 5% skim milk, PRRSV N protein-specific primary antibody was added and incubated overnight at 4°C, followed by incubation with HRP-labeled secondary antibody at room temperature for 1 hour. Finally, the membrane was developed using an ECL chemiluminescence assay kit.

[0094] The results are as follows Figure 5 As shown, the 7-5 fermentation supernatant reduced the production of viral N protein, and this effect was observed in all three strains.

[0095] (4) CPE observation was performed using PRRSV-GFP. GFP expression is directly related to viral replication. When the fermentation supernatant inhibited viral replication, the expression level of GFP decreased, leading to a weakening of the fluorescence signal. The results are as follows: Figure 7 As shown, the 7-5 fermentation supernatant significantly reduced fluorescence intensity, inhibiting viral proliferation.

[0096] Example 3:

[0097] Acute toxicity test of Alternaria 7-5 fermentation supernatant in mice

[0098] 1. Experimental Objective

[0099] To evaluate the acute toxicity of Alternaria alternata 7-5 fermentation supernatant in mice, clarify its target organs, dose-response relationship and safety range, and provide in vivo evidence for the safety of this fermentation supernatant.

[0100] 2. Experimental Materials

[0101] 2.1 Test substance

[0102] The fermentation supernatant of Alternaria alternata 7-5 was freeze-dried to obtain a brown powder. Before the experiment, it was prepared with sterile physiological saline to the required concentration and used immediately.

[0103] 2.2 Laboratory Animals

[0104] Twenty SPF-grade female BALB / c mice, 4-6 weeks old, weighing 18-22g, were housed in a temperature- and humidity-controlled animal room (temperature 22±2℃, humidity 50±10%, 12h / 12h light / dark cycle) with free access to water and food. They underwent a 3-day acclimatization period before the experiment. All animal procedures were approved by the animal ethics committee.

[0105] 3. Test Methods

[0106] 3.1 Animal grouping and administration

[0107] Twenty mice were randomly divided into four groups of five each:

[0108] .

[0109] Fast for 4 hours before administration (water is not prohibited), administer by gavage at a volume of 10 mL / kg body weight.

[0110] 3.2 General Clinical Observation

[0111] Observe the patient continuously for 10 days after administration, and record the following daily: weight changes, food intake, and clinical symptoms (hair, activity, respiration, defecation, death, etc.).

[0112] 3.3 Serum biochemical marker detection

[0113] On the last day after drug administration, blood was collected from the orbital venous plexus of mice, and serum was separated. The following indicators were detected using a fully automated biochemical analyzer:

[0114] Liver function tests: alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein (TP); kidney function tests: blood urea nitrogen (BUN), creatinine (Cr), uric acid (UA).

[0115] 3.4 Histopathological examination

[0116] Mice were euthanized after blood collection, and liver and kidney tissues were taken, fixed with 4% paraformaldehyde tissue fixative, embedded in paraffin, stained with hematoxylin and eosin (HE), and observed under a light microscope for histopathological changes.

[0117] 3.5 Statistical Analysis

[0118] Statistical analysis was performed using GraphPad Prism software. All data are expressed as mean ± standard deviation (x̄ ± SD). One-way ANOVA was used for comparisons among multiple groups, followed by Dunnett's test for multiple comparisons. A p-value < 0.05 was considered statistically significant.

[0119] 4. Test Results

[0120] 4.1 General Clinical Observation

[0121] No animal deaths were observed in any of the dosage groups within 7 days after administration. No significant differences were found in body weight, food intake, and activity level between the low- and medium-dose groups and the control group. The high-dose group showed a transient decrease in activity and a slight decrease in body weight starting on day 5 after administration. See the body weight change graph below. Figure 8 Detailed weight data are shown in Table 6.

[0122] Table 6. Effect of Alternaria 7-5 fermentation supernatant on mouse body weight (g, ±SD, n=5)

[0123] .

[0124] *P < 0.05 vs control group (Dunnett's test). No subscript indicates no significant difference. The same applies below.

[0125] The results showed that there was no significant difference in body weight between the experimental group and the control group (P>0.05), suggesting that the 7-5 fermentation supernatant had no significant effect on mouse body weight.

[0126] 4.2 Serum biochemical indicators

[0127] Table 7 Effects of Alternaria 7-5 fermentation supernatant on serum liver biochemical parameters in mice ( ±SD, n=5)

[0128] .

[0129] Table 8 Effects of fermentation supernatant on serum renal biochemical parameters in mice ( ±SD, n=5)

[0130] .

[0131] *P < 0.05 vs control group (Dunnett's test).

[0132] Liver function: Compared with the control group, there were no significant differences in ALT, AST, ALP, and TP in the low- and medium-dose groups (P>0.05). AST was significantly elevated in the high-dose group (P<0.05), but ALP, ALP, and TP showed no significant changes (P>0.05), indicating that the fermentation supernatant did not cause hepatocellular damage or cholestasis. The elevated AST observed at high doses is more likely to reflect transient energy metabolism regulation in muscles or the heart, rather than hepatotoxicity.

[0133] Renal function: There were no significant differences in BUN and Cr levels between the control and all dosage groups (P>0.05), indicating that the fermentation supernatant had no significant effect on mouse renal function within the specified dosage range. The significant increase in UA in the high-dose group (P<0.05), in the context of completely normal renal function, is more likely due to the regulatory effect of the fermentation supernatant on purine synthesis or degradation pathways. This metabolic interference effect is not equivalent to nephrotoxicity, but rather suggests that the fermentation supernatant may have biological activity affecting nucleic acid metabolism.

[0134] 4.3 Histopathological examination

[0135] like Figure 9 As shown in Figure A, regarding the liver: Under light microscopy, the liver lobule structure of the control group mice was intact, the hepatic cords were neatly arranged, and the hepatocyte morphology was normal. In the low-dose group (10 mg / kg), there was no significant difference in liver structure compared to the control group. In the medium-dose group (100 mg / kg), the liver lobule structure was basically normal, with occasional small vacuoles in individual hepatocytes showing very mild fatty degeneration. In the high-dose group (500 mg / kg), mild pathological changes were observed in the liver, mainly manifested as focal vacuolar degeneration of hepatocytes, accounting for approximately 10-20% of the liver lobule area, with cell nuclei compressed to the edge of the cell membrane, exhibiting typical vesicular fatty degeneration; no hepatocyte necrosis, inflammatory infiltration, or fibrosis was observed. No obvious hepatocyte damage or inflammatory response was observed in any group.

[0136] like Figure 9 As shown in Figure B, the kidneys: the glomeruli of mice in each group were clearly defined, the renal tubular epithelial cells were intact, the brush border was clear, and no obvious renal tubular dilation, atrophy, cell shedding, or protein cast formation was observed. There were no significant pathological differences among the groups.

[0137] Conclusion: The fermentation supernatant showed no visible toxicity to the liver and kidneys of mice at low and medium doses (10 and 100 mg / kg). At a high dose (500 mg / kg), it only caused mild, reversible hepatic steatosis without progressing to necrosis or inflammation, and the kidney tissue structure remained intact. Combined with serum biochemical indicators (normal ALT and BUN / Cr), this indicates that the fermentation supernatant has good liver and kidney safety, and the liver changes at high doses are within the scope of adaptive responses rather than progressive damage.

[0138] Combined with the results of in vitro cytotoxicity assays (CC50 = 11.04 mg / mL, selectivity index SI = 102.6), the fermentation supernatant showed no significant toxicity to mice at the therapeutic dose (10 mg / kg) and within 10 times the safety margin (100 mg / kg), with only mild, reversible hepatocyte damage occurring at 50 times the therapeutic dose (500 mg / kg). In summary, the fermentation supernatant exhibits a wide safety window (>50 times the therapeutic dose) and good safety profile.

[0139] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. An artificially isolated Alternaria alternata 7-5, the preservation number of which is CCTCC NO: M2026443.

2. The fermentation broth of Alternaria 7-5 as described in claim 1, or its fermentation supernatant.

3. A drug for combating porcine reproductive and respiratory syndrome virus, wherein the drug contains Alternaria 7-5 as described in claim 1, the fermentation broth of Alternaria 7-5 as described in claim 2, or the fermentation supernatant thereof.

4. The use of Alternaria alternata 7-5 as described in claim 1, the fermentation broth of Alternaria alternata 7-5 as described in claim 2 or its fermentation supernatant, or the drug against porcine reproductive and respiratory syndrome virus as described in claim 3 in the preparation of a drug for treating or preventing porcine reproductive and respiratory syndrome virus infection, wherein the genotype of porcine reproductive and respiratory syndrome virus is genotype 2.

5. The use of Alternaria alternata 7-5 as described in claim 1, the fermentation broth of Alternaria alternata 7-5 as described in claim 2 or its fermentation supernatant, or the drug against porcine reproductive and respiratory syndrome virus as described in claim 3 in the preparation of an inhibitory agent against porcine reproductive and respiratory syndrome virus, wherein the genotype of porcine reproductive and respiratory syndrome virus is genotype 2.

6. The use of Alternaria alternata 7-5 as described in claim 1, the fermentation broth of Alternaria alternata 7-5 as described in claim 2 or its fermentation supernatant, or the drug against porcine reproductive and respiratory syndrome virus as described in claim 3 in the preparation of a drug for treating or preventing porcine reproductive and respiratory syndrome virus, wherein the genotype of porcine reproductive and respiratory syndrome virus is genotype 2.

Images