A synthetic astaxanthin-producing Yersinia lipophila strain, its construction method, and its application.

Abstract

This invention discloses a lipophilic yeast strain for synthesizing astaxanthin (Yersinia lipophila). Yarrowia lipolytica This invention relates to an engineered strain, its construction method, and its application. The engineered strain is a *Yersinia lipolytica* strain carrying CrtZ and CrtW. The invention utilizes genetic engineering methods to introduce a *Yersinia lipolytica* strain derived from *Rhodochophora* into a β-carotene-producing strain via genetic engineering. Haematococcus Pluvialis The β-carotene hydroxylase encoding gene (HpCrtZ) originates from the genus Paracoccus ( Paracoccus sp. The gene encoding β-carotene ketolase (PsCrtW) and the gene derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) Saccharomyces cerevisiae The method involves obtaining a genetically engineered *Yersinia lipolytica* strain that produces astaxanthin by constructing a fusion enzyme complex and fusing it with peroxisomes, endoplasmic reticulum, and lipid droplet-targeting signal peptides to obtain a *Yersinia lipolytica* strain with higher astaxanthin yield. The astaxanthin-producing genetically engineered strain constructed in this invention achieved an astaxanthin yield of 1.43 g / L in a 5 L bioreactor after pH control and continuous feeding optimization.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to an engineered strain of Yersinia lipophila that synthesizes astaxanthin, its construction method, and its application. Background Technology

[0002] Astaxanthin is a natural red tetraterpenoid compound, a derivative of β-carotene, and is considered one of the strongest antioxidants. Its powerful antioxidant properties give astaxanthin a wide range of biological activities, including anti-inflammatory, anti-aging, and immune-boosting effects. Astaxanthin has also been found to promote skin health and support vision health. Furthermore, as a natural pigment, astaxanthin has wide applications in the food, beverage, dietary supplement, cosmetic, and pharmaceutical industries. Natural astaxanthin is found in marine organisms and some microalgae, while the safety of chemically synthesized astaxanthin is a concern, thus its use is strictly limited. With increasing demand, astaxanthin requires sustainable and more environmentally friendly production methods. Utilizing microbial chassis to produce astaxanthin offers advantages such as shorter production cycles, large-scale and continuous production capacity, wide application, and low raw material costs.

[0003] Yarrowia lipolytica ( Yarrowia lipolytica Yersinia lipolytica is a generally recognized safe (GRAS) lipogenic yeast that can naturally accumulate lipids equivalent to approximately 20% of its stem cell weight, making it an ideal host for the synthesis of lipophilic compounds. Currently, Yersinia lipolytica has been widely used to synthesize lipophilic compounds such as lipids, fatty acids and their derivatives, carotenoids, terpenoids, and polyesters, demonstrating its potential as a genetically engineered bacterium for lipophilic compound synthesis. As a lipophilic compound, astaxanthin's synthetic potential in Yersinia lipolytica has been discovered by numerous research groups.

[0004] Peroxisomes are subcellular organelles in *Yarrowia lipolytica*, and their abundant hydrophobic environment is highly conducive to astaxanthin synthesis. Furthermore, peroxisomes also participate in fatty acid metabolism and cellular oxidative stress defense. First, fatty acids are degraded in peroxisomes via β-oxidation to produce acetyl-CoA, an essential precursor for astaxanthin synthesis. Second, the antioxidant properties of astaxanthin are consistent with the role of peroxisomes in maintaining cellular redox homeostasis. Peroxisomes can scavenge reactive oxygen species (ROS), reducing the reaction of astaxanthin with ROS due to their antioxidant properties, thus effectively protecting stored astaxanthin. In addition, peroxisomes contain carnitine acetyltransferase, which transfers acetyl-CoA from the cytoplasm to the peroxisome, providing more precursors for astaxanthin synthesis. In summary, peroxisomes possess numerous advantages and are ideal sites for the synthesis and storage of astaxanthin. However, the systematic co-localization of mevalonate and carotenoid biosynthetic pathways within peroxisomes, along with the optimization of acetyl-CoA supply and high-density continuous fermentation, have not yet been fully explored.

[0005] In addition to peroxidases, the endoplasmic reticulum and lipid droplets in Yersinia lipolytica are also hydrophobic environments, which are also conducive to the storage of lipophilic compounds. Localizing the astaxanthin synthesis pathway to the endoplasmic reticulum, lipid droplets and peroxidases can increase the astaxanthin production in Yersinia lipolytica. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides an engineered *Yersinia lipolytica* strain for synthesizing astaxanthin, its construction method, and its applications. This invention constructs an engineered *Yersinia lipolytica* strain for astaxanthin production based on an engineered strain that produces β-carotene. This invention obtains the engineered *Yersinia lipolytica* strain for astaxanthin production by introducing exogenous genes expressing β-carotene hydroxylase, β-carotene ketolase, and carnitine acetyltransferase. The engineered strain exhibits high astaxanthin yield.

[0007] To achieve the above objectives, the first aspect of this invention discloses a method for constructing an engineered strain of *Yersinia lipophila* that synthesizes astaxanthin, wherein the strain is derived from *Rhodotorula pulmonata* (…). Haematococcus Pluvialis β-carotene hydroxylase (HpCrtZ) is derived from Paracoccus spp. Paracoccus sp. β-carotene ketolase (PsCrtW) and β-carotene ketolase derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) Saccharomyces cerevisiae The carnitine acetyltransferase (ScCAT2) was transferred into a β-carotene-producing Yersinia lipolytica engineered strain. The sequence of the gene HpCrtZ is shown in SEQ ID NO.1, the sequence of the gene PsCrtW is shown in SEQ ID NO.2, and the sequence of the gene ScCAT2 is shown in SEQ ID NO.3.

[0008] The method further includes fusing the genes PsCrtW, HpCrtZ, and ScCAT2 with a peroxisome targeting signal peptide, wherein the nucleotide sequence encoding the targeting signal peptide is shown in SEQ ID NO.4.

[0009] A further preferred approach is to fuse the C-terminus of PsCrtW with the N-terminus of HpCrtZ using a flexible linker peptide (GGGGSGGPGS), and target the fusion enzyme to the peroxisome. The nucleotide sequence encoding the flexible linker peptide is shown in SEQ ID NO.5.

[0010] A further preferred approach is to express three copies of the fusion protein formed by fusing the C-terminus of PsCrtW with the N-terminus of HpCrtZ using a flexible linker peptide. These three copies bind to the target signal peptides of the peroxisome, endoplasmic reticulum (ER), and lipid droplet (LD), respectively. The nucleotide sequence encoding the target signal peptide of the ER is shown in SEQ ID NO.6, and the nucleotide sequence encoding the target signal peptide of the lipid droplet is shown in SEQ ID NO.7.

[0011] In a second aspect, the present invention discloses an engineered strain of Yersinia lipolytica obtained by the aforementioned construction method for synthesizing astaxanthin.

[0012] A third aspect of the present invention is to provide a method for producing astaxanthin, comprising fermenting and culturing an engineered strain of Yersinia lipophila as described above to produce astaxanthin.

[0013] In a preferred embodiment, the fermentation culture temperature is 25-35 °C; and the culture is carried out under shaking conditions for 80-150 h at a shaking speed of 200-300 rpm. More specifically, fermentation is carried out using 24-well deep-well plates or 250 mL or 500 mL baffle shake flasks, wherein the fermentation culture temperature is 30 °C; and the culture is carried out under shaking conditions for 120 h at a shaking speed of 250 rpm.

[0014] Methods for producing astaxanthin also include fermenting the engineered strain of *Yarrowia lipolytica* as described above in a bioreactor to produce astaxanthin. Preferably, a continuously fed fermentation method is used, with the fermentation temperature at 25-35 °C, the pH in the fermenter controlled at 5.5-6.0, dissolved oxygen controlled at 25-35% before feeding, an aeration rate of 2-3 vvm, and carbon and nitrogen sources fed in after 15-25 h of culture. After feeding, the rotation speed is fixed at 750-850 rpm, the aeration rate is changed to 1.5-2.5 vvm, and the total fermentation time is 140-180 h.

[0015] More specifically, the genetically engineered bacteria described above were fermented in a 5 L bioreactor to produce astaxanthin. A continuously fed fermentation method was used, with the fermentation temperature at 30 °C. The pH in the fermenter was controlled at 5.8 using sodium hydroxide and pure acetic acid. Dissolved oxygen was controlled at 30% before feeding, and the aeration rate was 2.5 vvm. After 20 h of cultivation, carbon and nitrogen sources were fed in continuously. After feeding, the rotation speed was fixed at 800 rpm, and the aeration rate was changed to 2 vvm. The total fermentation time was 168 h.

[0016] Compared to existing technologies, this invention introduces a genetically engineered strain derived from *Rhodotorula rubra* into a β-carotene-producing *Yersinia lipophila* strain through genetic engineering. Haematococcus Pluvialis β-carotene hydroxylase (HpCrtZ) is derived from Paracoccus spp. Paracoccus sp. β-carotene ketolase (PsCrtW) and β-carotene ketolase derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) Saccharomyces cerevisiae The method involves synthesizing carnitine acetyltransferase (ScCAT2) to obtain a genetically engineered *Yersinia lipolytica* strain that produces astaxanthin. The method further includes constructing a fusion enzyme complex and fusing a targeting signal peptide with peroxisomes, endoplasmic reticulum, and lipid droplets to obtain a *Yersinia lipolytica* strain with higher astaxanthin yield. The genetically engineered strain constructed in this invention exhibits high yield; after pH control and continuous feeding optimization in a 5 L bioreactor, the astaxanthin yield can reach 1.43 g / L. Attached Figure Description

[0017] Figure 1-4 A map of the plasmids used in constructing the strain is provided. More detailed information can be found in the literature: Engineering amino acid-derived malonyl-CoA pathways to boost polyketide production in Yarrowia lipolytica . Metabolic Engineering, 2026, 94, 99-109; Figure 5 The results show the yields of β-carotene and astaxanthin in engineered strains of Yersinia lipophila under different expression methods of β-carotene hydroxylase and β-carotene ketolase. Figure 6 The results show the changes over time in various parameters and the yields of β-carotene and astaxanthin when the engineered strain was cultured by continuous fed fermentation in a 5 L bioreactor. Detailed Implementation

[0018] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the methods and equipment used in the present invention are conventional methods and equipment in this technical field.

[0019] Unless otherwise specified, all reagent kit materials used in the following examples are commercially available products.

[0020] Unless otherwise specified, the experimental methods described in this invention are conventional methods.

[0021] The starting strain used in this embodiment of the invention is the β-carotene-producing Yersinia lipolytica engineered strain C07. This starting strain can also be replaced by other existing β-carotene-producing Yersinia lipolytica engineered strains.

[0022] Example 1: Construction of an engineered strain Asta-1 with astaxanthin-producing ability (1) C07 (starting strain) is a β-carotene-producing Yersinia lipolytica engineered strain constructed in the laboratory in the early stage. The construction method is to target the β-carotene synthesis pathway and the mevalonic acid (MVA) pathway to Yersinia lipolytica. Yarrowia lipolytica Peroxisomes.

[0023] (2) The nucleotide sequence of the β-carotene hydroxylase gene (HpCrtZ, NCBI number KP866868.1) from Haematococcus pluvialis was found on NCBI. After codon optimization according to the codon preference of Yersinia lipolytica, the sequence was sent to Genewiz (Jiangsu, China) Co., Ltd. to synthesize the nucleotide sequence of the HpCrtZ gene (the nucleotide sequence after codon optimization is shown in SEQ ID NO.1).

[0024] (3) The amino acid sequence of the β-carotene ketolase gene of Paracoccus genus (PsCrtW, NCBI number BAA09591.1) was found on NCBI. After codon optimization according to the codon preference of Yersinia lipolytica, it was sent to Genewiz (Jiangsu, China) Co., Ltd. to synthesize the nucleotide sequence of the PsCrtW gene (the nucleotide sequence after codon optimization is shown in SEQ ID NO.2).

[0025] (4) The nucleotide sequence of the peroxisome carnitine acetyltransferase (ScCAT2, NCBI number NC_001145.3) gene from Saccharomyces cerevisiae was found on NCBI. After codon optimization according to the codon preference of Saccharomyces lipolyticus, the sequence was sent to Genewiz (Jiangsu, China) Co., Ltd. to synthesize the nucleotide sequence of the ScCAT2 gene (the codon-optimized nucleotide sequence is shown in SEQ ID NO.3).

[0026] (5) Using pYLXP' as the expression vector, construct the plasmid pYLXP'-HpCrtZ -PTS ,pYLXP'-PsCrtW -PTS and pYLXP'-ScCAT2 -PTS First, the linearized pYLXP' vector (double-digested with SnaBI and KpnI) recovered from the gel was amplified by high-fidelity PCR using the Gibson Assembly method (using the synthesized genes HpCrtZ, PsCrtW, and ScCAT2 as templates, and primer XP-HpCrtZ). -PTS -F、XP-HpCrtZ -PTS -R、XP-PsCrtW -PTS -F、XP-PsCrtW -PTS -R、XP-ScCAT2 -PTS -F, XP-ScCAT2 -PTS The nucleotide sequence of -R is shown in SEQ ID NO.12-17. This yields HpCrtZ fused with a peroxisome targeting signal peptide (the nucleotide sequence of which is shown in SEQ ID NO.4 in the sequence listing). -PTS ,PsCrtW- PTS and ScCAT2 -PTS Gene fragments were ligated separately using the ClonExpress II One Step Cloning Kit at 50 °C for 1 hour, and then transformed into various gene sequences. E. coil DH5α competent cells were evenly spread on LB solid medium containing 100 μg / ml ampicillin and incubated at 37 ℃. Positive transformants were confirmed by colony PCR and transferred to LB liquid medium containing ampicillin for overnight culture and sequencing verification. After successful verification, the plasmid pYLXP'-HpCrtZ was obtained. -PTS ,pYLXP'-PsCrtW -PTS and pYLXP'-ScCAT2 -PTS .

[0027] The pYLXP' plasmid is a laboratory deposit and carries a leucine expression cassette for the auxotroph selection gene, the resistance marker gene Amp, the promoter TEF, intron sequences, and the terminator XPR2. The nucleotide sequence of plasmid pYLXP' is shown in SEQ ID NO. 8, and its map is shown below. Figure 1 As shown.

[0028] (6) Based on the integrative plasmid vector pUC-Leu-A08 constructed in the laboratory, the integrative plasmid pUC-Leu-A08-ScCAT2 was constructed. -PTS The plasmid pYLXP'-ScCAT2 constructed in Example 1(5) -PTS Using XPR2-Leu-R and A08-TEF-F as templates, high-fidelity PCR amplification was performed using primers XPR2-Leu-R and A08-TEF-F (nucleotide sequences shown in SEQ ID NO. 18-19). The linearized pUC-Leu-A08-ScCAT2 gel was then recovered from the gel. -PTS The plasmid pUC-Leu-A08-ScCAT2 was ligated with the purified PCR product after double digestion with AvrII and NheI using a seamless cloning kit. Subsequent steps were the same as in Example 1(5) to obtain the plasmid pUC-Leu-A08-ScCAT2. -PTS .

[0029] The pUC-Leu-A08 plasmid was preserved in the laboratory and carries a leucine expression cassette for the auxotroph selection gene, the resistance marker gene Amp, and a homologous recombination arm. The nucleotide sequence of plasmid pUC-Leu-A08 is shown in SEQ ID NO.9, and its map is shown below. Figure 2 As shown.

[0030] (7) The integration plasmid pUC-Leu-A08-ScCAT2 constructed in Example 1(6) -PTS Based on this, the integration plasmid pUC-Leu-A08-ScCAT2 was constructed. -PTS -PsCrtW -PTS The plasmid pYLXP'-PsCrtW constructed in Example 1(5) -PTS Using XPR2-TEF-R as a template, high-fidelity PCR amplification was performed using primers A08-TEF-F and XPR2-TEF-R (nucleotide sequences shown in SEQ ID NO. 19-20). Then, pUC-Leu-A08-ScCAT2, linearized after AvrII digestion, was... -PTS The purified PCR product was ligated using a seamless cloning kit, and subsequent steps were the same as in Example 1(5) to obtain plasmid pUC-Leu-A08-ScCAT2. -PTS -PsCrtW -PTS .

[0031] (8) The plasmid pUC-Leu-A08-ScCAT2 constructed in Example 1(7) -PTS -PsCrtW -PTS Based on this, the integration plasmid pUC-Leu-A08-ScCAT2 was constructed. -PTS -HpCrtZ -PTS -PsCrtW -PTS The plasmid pYLXP'-HpCrtZ constructed in Example 1(5) -PTS Using XPR2-TEF-R as a template, high-fidelity PCR amplification was performed using primers A08-TEF-F and XPR2-TEF-R (nucleotide sequences shown in SEQ ID NO. 19-20). Then, pUC-Leu-A08-ScCAT2, linearized after AvrII digestion, was... -PTS -PsCrtW -PTS The purified PCR product was ligated using a seamless cloning kit, and subsequent steps were the same as in Example 1(5) to obtain plasmid pUC-Leu-A08-ScCAT2. -PTS -HpCrtZ -PTS -PsCrtW -PTS .

[0032] (9) The plasmid pUC-Leu-A08-ScCAT2 -PTS -HpCrtZ -PTS -PsCrtW -PTS Enzyme digestion yielded expression cassette fragment P TEFin -ScCAT2 -PTS -T xpr2- P TEFin -HpCrtZ -PTS -T Xpr2 -P TEFin -PsCrtW -PTS -T Xpr2 (with homologous recombination arms on both sides), and then using the lithium acetate conversion method (Reference: One-step transformation of the dimorphicyeast) Yarrowia lipolytica(Applied Microbiology and Biotechnology, 1997, 48(2), 232–235.) The integration was performed on the A08 site of the C07 genome of the engineered *Yarrowia lipolytica* strain. The successfully integrated strain, Asta-1, was screened on a leucine-deficient plate (CSM-Leu). Yeast culture medium formulation: CSM-Leu liquid seed medium contained 20 g / L glucose, 1.7 g / L amino-free yeast nitrogen source, 5 g / L ammonium sulfate, and 0.7 g / L CSM-Leu. Solid culture medium required the addition of 20 g / L agar powder.

[0033] Example 2: Construction of an engineered strain Asta-2 with astaxanthin-producing ability (1) Using pYLXP' as the expression vector, construct the plasmid pYLXP'-(PsCrtW~HpCrtZ) -PTS pYLXP'-HpCrtZ constructed according to Example 1(5) -PTS and pYLXP'-PsCrtW -PTS High-fidelity PCR amplification was performed using XP-(PsCrtW~HpCrtZ) as the template. -PTS -1F、XP-(PsCrtW~HpCrtZ) -PTS -1R、XP-(PsCrtW~HpCrtZ) -PTS -2F、XP-PsCrtW -PTS The nucleotide sequences of -2R are shown in SEQ ID NO.21-24, and gene fragments (PsCrtW~HpCrtZ) are obtained by linking with a flexible linker peptide and fusing with a peroxisome targeting signal peptide. -PTS Then, the linearized pYLXP' vector was ligated to the purified PCR product using a seamless cloning kit. The subsequent steps were the same as in Example 1(5) to obtain the plasmid pYLXP'-(PsCrtW~HpCrtZ). -PTS .

[0034] (2) The integration plasmid pUC-Leu-A08-ScCAT2 constructed in Example 1(6) -PTS Based on this, the integration plasmid pUC-Leu-A08-ScCAT2 was constructed. -PTS -(PsCrtW~HpCrtZ) -PTS pYLXP'-(PsCrtW~HpCrtZ) constructed according to Example 2(1) -PTSUsing XPR2-TEF-R as a template, high-fidelity PCR amplification was performed using primers A08-TEF-F and XPR2-TEF-R (nucleotide sequences shown in SEQ ID NO. 19-20). Then, pUC-Leu-A08-ScCAT2, linearized after AvrII digestion, was... -PTS The purified PCR product was ligated using a seamless cloning kit, and subsequent steps were the same as in Example 1(5) to obtain plasmid pUC-Leu-A08-ScCAT2. -PTS -(PsCrtW~HpCrtZ) -PTS .

[0035] (3) The plasmid pUC-Leu-A08-ScCAT2 -PTS -(PsCrtW~HpCrtZ) -PTS Expression cassette fragment P obtained by enzyme digestion TEFin -ScCAT2 -PTS -T xpr2 -P TEFin -(PsCrtW~HpCrtZ) -PTS -T xpr2 Following the method described in Example 1 (9), the strain Asta-2 was obtained by integrating the strain into the C07 genomic locus A08 of the engineered Yeast lipophila.

[0036] Example 3: Construction of an engineered strain Asta-3 with astaxanthin-producing ability (1) Using pYL31 as the expression vector, construct the plasmid pYL31-(PsCrtW~HpCrtZ) -ERTS High-fidelity PCR amplification was performed using the synthesized genes HpCrtZ and PsCrtW as templates, with primer 31-(PsCrtW~HpCrtZ) used. -ERTS -1F、31-(PsCrtW~HpCrtZ) -ERTS- 1R、31-(PsCrtW~HpCrtZ) -ERTS -2F、31-PsCrtW -ERTS The nucleotide sequences of -2R are shown in SEQ ID NO.25-28, resulting in (PsCrtW~HpCrtZ) after being fused with an endoplasmic reticulum targeting signal peptide (the nucleotide sequence of the targeting signal peptide gene is shown in SEQ ID No.6 in the sequence listing) using a flexible linker peptide. -ERTS Gene fragments. The linearized pYL31 vector (digested with BamHI and MluI) recovered from the gel was ligated with the purified PCR product using a seamless cloning kit. The subsequent steps were the same as those in Example 1(5). After verification, the plasmid pYL31-(PsCrtW~HpCrtZ) was obtained. -ERTS .

[0037] The pYL31 plasmid was preserved in the laboratory and carries a leucine expression cassette for the auxotroph selection gene, the resistance marker gene Amp, the promoter FBA, and the terminator PEX20. The nucleotide sequence of plasmid pYL31 is shown in SEQ ID NO.10, and its map is shown below. Figure 3 As shown.

[0038] (2) The integration plasmid pUC-Leu-A08-ScCAT2 constructed in Example 1(6) -PTS Based on this, the integration plasmid pUC-Leu-A08-ScCAT2 was constructed. -PTS -(PsCrtW~HpCrtZ) -PTS -(PsCrtW~HpCrtZ) -ERTS The plasmid pYL31-(PsCrtW~HpCrtZ) constructed in Example 3(1) -ERTS And the plasmid pYLXP'-(PsCrtW~HpCrtZ) constructed in Example 2(1) -PTS Using pUC-Leu-A08-ScCAT2 as a template, high-fidelity PCR amplification was performed using primers 31-WZ-F, 31-WZ-R, tPEX20-TEF-F, and XPR2-TEF-R (nucleotide sequences shown in SEQ ID No. 29-31 and SEQ ID No. 20, respectively). -PTS The purified PCR product was ligated using a seamless cloning kit, and subsequent steps were the same as in Example 1(5) to obtain plasmid pUC-Leu-A08-ScCAT2. -PTS -(PsCrtW~HpCrtZ) -PTS -(PsCrtW~HpCrtZ) -ERTS .

[0039] (3) The plasmid pUC-Leu-A08-ScCAT2 -PTS -(PsCrtW~HpCrtZ) -PTS -(PsCrtW~HpCr--tZ) -ERTS Expression cassette fragment P obtained by enzyme digestion TEFin -ScCAT2 -PTS -T xpr2 -P TEFin -(PsCrtW~-HpCrtZ) -PTS -T xpr2 -P FBA -(PsCrtW~HpCrtZ) -ERTS -T Pex20Following the method described in Example 1 (9), the strain Asta-3 was obtained by integrating the strain into the C07 genomic locus A08 of the engineered Yeast lipophila.

[0040] Example 4: Construction of an engineered strain Asta-4 with astaxanthin-producing ability (1) Using pYL24 as the expression vector, construct the plasmid pYL24-(PsCrtW~HpCrtZ) -LDTS High-fidelity PCR amplification was performed using the synthesized genes HpCrtZ, PsCrtW, and the lipid droplet targeting signal peptide LDTS as templates. The primers were 24-(PsCrtW~HpCrtZ). -LDTS -1F, 24-(PsCrtW~HpCrtZ) -LDTS -1R, 24-(PsCrtW~HpCrtZ) -LDTS -2F, 24-(PsCrtW~HpCrtZ) -LDTS -2R, 24-(PsCrtW~HpCrtZ) -LDTS -3F, 24-(PsCrtW~HpCrtZ) -LDTS -3R (the nucleotide sequence of the lipid droplet targeting signal peptide LDTS is shown in SEQ ID NO.7, and the nucleotide sequences of the primers are shown in SEQ ID NO.32-37), yielding (PsCrtW~HpCrtZ) fused with the lipid droplet targeting signal peptide after being linked by a flexible linker peptide. -LDTS Gene fragments. The linearized pYL24 vector fragment (digested with XbaI and KpnI) recovered from the gel was ligated with the purified PCR product using a seamless cloning kit. The subsequent steps were the same as those in Example 1(5). After verification, the plasmid pYL24-(PsCrtW~HpCrtZ) was obtained. -LDTS .

[0041] The pYL24 plasmid was preserved in the laboratory and carries a leucine expression cassette for the auxotrophic selection gene, the resistance marker gene Amp, the promoter TDH1, and the terminator MIG1. The nucleotide sequence of plasmid pYL24 is shown in SEQ ID NO.11, and its map is shown below. Figure 4 As shown.

[0042] (2) The integration plasmid pUC-Leu-A08-ScCAT2 constructed in Example 1(6) -PTS Based on this, the integration plasmid pUC-Leu-A08-ScCAT2 was constructed. -PTS -(PsCrtW~HpCrtZ) -PTS -(PsCrtW~HpCrtZ) -ERTS -(PsCrtW~HpCrtZ) -LDTSThe plasmid pYL24-(PsCrtW~HpCrtZ) constructed in Example 4(1) -LDTS Example 3(1) constructs the plasmid pYL31-(PsCrtW~HpCrtZ) -ERTS And the plasmid pYLXP'-(PsCrtW~HpCrtZ) constructed in Example 2(1) -PTS Using pUC-Leu-A08-ScCAT2 as a template, high-fidelity PCR amplification was performed using primers 24-WZ-F, 24-WZ-R, tMIG1-pFBA-F, 31-WZ-R, tPEX20-TEF-F, and XPR2-TEF-R (nucleotide sequences shown in SEQ ID NO. 38-40, SEQ ID NO. 30-31, and SEQ ID NO. 20, respectively). -PTS The purified PCR product was ligated using a seamless cloning kit, and subsequent steps were the same as in Example 1(5) to obtain plasmid pUC-Leu-A08-ScCAT2. -PTS -(PsCrtW~HpCrtZ) -PTS -(PsCrtW~HpCrtZ) -ERTS -(PsCrtW~Hp--CrtZ) -LDTS .

[0043] (3) The plasmid pUC-Leu-A08-ScCAT2 -PTS -(PsCrtW~HpCrtZ) -PTS -(PsCrtW~HpCr--tZ) -ERTS -(PsCrtW~Hp--CrtZ) -LDTS Expression cassette fragment P obtained by enzyme digestion TEFin -ScCAT2 -PTS -T xpr2 -P TEFin -(PsCrtW~HpCrtZ) -PTS -T xpr2 P FBA -(PsCrtW~HpCrtZ) -ERTS -T Pex20 -P TDH1 -(PsCrtW~Hp---CrtZ~Oleosin) -LDTS -T Mig1 Following the method described in Example 1 (9), the strain Asta-4 was obtained by integrating the strain into the A08 site of the C07 genome of the engineered Yeast lipophila.

[0044] The nucleotide sequence of the gene HpCrtZ in SEQ ID NO.1: ATGCTGTCTAAGCTGCAGTCTATCTCTGTGAAGGCCCGACGAGTGGAGCTGGCCCGAGACATCACCCGACCCAAGGTGTGTCTGCACGCTCAGCGATGTTCTCTCGTGAGACTGAGAGTCGCCGCCCCTCAGACCGAAGAGGCCGTCGGAACTCAGCAAGCCGCTGGAGCCGGCGACGAACACTCCGCCGACGTGGCCCTGCAACAGCTCGACCGAGCCATCGCCGAGCGACGAGCCCGACGAAAGCGAGAGCAGCTGTCTTACCAAGCCGCTGCCATCGCCGCCTCTATCGGCGTGTCTGGCATCGCCATCTTCGCCACCTACCTGCGATTCGCCATGCACATGACTGTCGGCGGCGCTGTCCCCTGGGGAGAAGTGGCCGGCACTCTCCTGCTGGTGGTCGGAGGCGCTCTGGGAATGGAGATGTACGCCCGATACGCCCACAAGGCCATCTGGCACGAGTCTCCCCTGGGCTGGCTGCTGCACAAGTCTCACCACACCCCCCGAACCGGCCCCTTCGAGGCCAACGACCTGTTCGCCATCATCAACGGCCTGCCCGCCATGCTGCTGTGTACCTTCGGCTTCTGGCTGCCCAACGTGCTGGGCACCGCCTGTTTCGGCGCCGGCCTGGGCATCACCCTGTACGGCATGGCCTACATGTTCGTGCACGACGGCCTGGTGCACCGACGATTCCCCACCGGCCCCATCGCCGGCCTGCCCTACATGAAGCGACTGACCGTGGCCCATCAGCTGCACCACTCTGGCAAGTACGGCGGCGCCCCCTGGGGCATGTTCCTGGGCCCCCAAGAGCTGCAACACATCCCCGGAGCCGCCGAAGAGGTGGAGCGACTGGTGCTGGAGCTGGACTGGTCTAAGCGATAA Nucleotide sequence of gene PsCrtW: SEQ ID NO.2 ATGTCTGCCCACGCCCTGCCCAAGGCCGACCTGACCGCCACCTCTCTGATCGTGTCCGGCGGCATCATCGCCGCTTGGCTGGCCCTGCATGTCCACGCCCTGTGGTTCCTGGACGCTGCCGCCCACCCCATCCTGGCCATCGCCAACTTCCTGGGCCTGACCTGGCTGTCTGTGGGCCTGTTCATCATTGCCCACGACGCCATGCACGGCTCTGTGGTGCCCGGCCGACCTCGAGCTAACGCCGCCATGGGACAGCTGGTGCTGTGGCTGTACGCCGGCTTCTCTTGGCGAAAGATGATCGTGAAGCACATGGCCCACCACCGACACGCCGGCACCGACGATGACCCTGATTTTGACCACGGCGGCCCCGTGCGATGGTACGCCCGATTCATCGGCACCTACTTCGGCTGGCGAGAGGGCCTGCTCCTGCCCGTGATCGTGACCGTGTACGCCCTGATCCTGGGCGACCGATGGATGTACGTGGTGTTCTGGCCCCTGCCCTCTATCCTGGCCTCTATCCAACTGTTCGTGTTCGGCACCTGGCTGCCCCACCGACCCGGCCATGACGCCTTCCCCGACCGACACAACGCCCGATCTTCTCGAATCTCTGACCCCGTGTCTCTGCTGACCTGTTTCCACTTCGGCGGCTACCACCACGAGCACCACCTGCACCCCACCGTGCCCTGGTGGCGACTGCCCTCTACCCGAACCAAGGGCGACACCGCCTAA Nucleotide sequence of gene ScCAT2: SEQ ID NO.3 SEQ ID NO.4 Peroxisome targeting signal peptide nucleotide sequence: TCCAAGCTG The nucleotide sequence of the flexible linker peptide in SEQ ID NO.5: GGCGGCGGAGGCTCTGGCGGACCCGGCTCT SEQ ID NO.6 Endoplasmic reticulum targeting signal peptide nucleotide sequence: AAGGACGAGCTG SEQ ID NO.7 Lipid droplet targeting signal peptide nucleotide sequence: ATGGCCGACCGAGACCGAAGCGGCATCTACGGCGGCGCCCACGCTACCTACGGCCAGCAGCAGCAGGGCGGCGGTGGACGACCTATGGGCGAGCAGGTCAAGGGCATGCTGCACGACAAGGGCCCCACTGCCTCCCA GGCCCTCACCGTTGCCACCCTGTTCCCCCTGGGCGGCCTCCTTCTCGTGCTTTCCGGTCTTGCCCTGACTGCCTCCGTGGTCGGCCTGGCTGTCGCCACTCCCGTCTTCCTCATCTTCTCCCCCGTCCTCGTCCCCGCCG CCCTTCTTATCGGCACCGCCGTCATGGGCTTCCTGACCTCTGGCGCCCTGGGCCTCGGCGGTCTTTCCTCTCTCACCTGCCTTGCCAACACCGCCCGACAGGCCTTTCAGCGAACCCCCGACTACGTCGAGGAGGCCCAC CGACGAATGGCCGAGGCCGCTGCTCACGCCGGTCACAAGACCGCCCAGGCCGGACAGGCCATCCAGGGACGAGCCCAGGAGGCCGGTGCCGGTGGTGGTGCTGGTGCTGGAGCCGGAGGCGGTGGTCGAGCTTCCTCCTAA Table 1 Primer Sequences

[0045]

[0046] Example 5: Cultivation of engineered strains capable of producing astaxanthin in 24-well deep-well plates. (1) The engineered strains Asta-1 and Asta-2 from Examples 1 and 2 were cultured in 3 mL of YPD medium for 12 hours to serve as seed culture for 24-well deep-well plates. The YPD medium consisted of 20 g / L glucose, 10 g / L yeast extract and 20 g / L peptone.

[0047] (2) Inoculate a portion of the seed culture into 3.5 mL of YPD80 fermentation medium placed in a 24-well deep plate to induce an initial OD. 600 The pH was 0.2. The 24-well deep-well plate was placed in a shaker and cultured for 5 days at 30 °C and 250 rpm. The YPD80 fermentation medium consisted of 80 g / L glucose, 10 g / L yeast extract, and 20 g / L peptone.

[0048] (3) After fermentation, take 100 μL of fermentation broth, centrifuge at 13000 rpm for 2 min, discard the supernatant, suspend the cells in 900 μL of dimethyl sulfoxide (DMSO), incubate at 50 ℃ for 60 min until the cells are bleached, then add 450 μL of methanol, mix and centrifuge, filter through a 0.22 μm organic nylon membrane for later use.

[0049] (4) Measurement of 600 nm (OD) using a UV-Vis spectrophotometer 600 The optical density of cells is used to measure cell concentration, such as... Figure 5 As shown.

[0050] (5) The extract was analyzed by high performance liquid chromatography (HPLC). The HPLC used was an Agilent 1260 Infinity II equipped with a variable wavelength detector (VWD). A C18 column (4.6 mm × 100 mm or 4.6 mm × 250 mm) was used. The chromatographic conditions were as follows: column temperature: 35 ℃; mobile phase: phase A (water; 0.1% formic acid), phase B (acetonitrile-methanol-isopropanol (5:3:2, v / v)); elution time: 20 min; total flow rate: 1 mL / min; detection wavelength: 475 nm; gradient elution was applied starting from 80% phase B, increasing to 100% phase B within 4 minutes, and then eluted with 100% phase B for 15 minutes; injection volume: 10 μL.

[0051] High-performance liquid chromatography (HPLC) analysis showed that the astaxanthin production of engineered strains cultured in 24-well deep-well plates was as follows: Figure 5 As shown.

[0052] (6) Figure 5 The results showed that the astaxanthin production of strain Asta-2 reached 30.34 mg / L in a 24-well plate.

[0053] Example 6: Culturing an engineered strain capable of producing astaxanthin in a 250 mL baffle shake flask. (1) The engineered strain Asta-2 in Example 1 was cultured in 3 mL YPD medium for 12 hours as seed culture for 24-well deep plate culture.

[0054] (2) Inoculate a portion of the seed culture into 25 mL of YPD80 fermentation medium in a 250 mL baffle shake flask to induce an initial OD of 25 mL. 600 The concentration was 0.2. A 250 mL baffled shake flask was placed in a shaker and incubated for 5 days at 30 °C and 250 rpm.

[0055] (3) OD was measured according to the method in Examples 5(3)-(5). 600 And astaxanthin production, the results are as follows Figure 5 As shown.

[0056] Example 7: Culturing an engineered strain capable of producing astaxanthin in a 500 mL baffle shake flask. (1) The engineered strains Asta-1, Asta-2, Asta-3 and Asta-4 in Examples 1-4 were cultured in 3 mL YPD medium for 12 hours to serve as seed culture for 24-well deep-well plates.

[0057] (2) Inoculate a portion of the seed culture into 50 mL of YPD80 fermentation medium in a 500 mL baffle flask to induce an initial OD of 50 mL. 600 The concentration was 0.2. A 500 mL baffled shake flask was placed in a shaker and incubated for 5 days at 30 °C and 250 rpm.

[0058] (3) OD was measured according to the method in Examples 5(3)-(5). 600 And astaxanthin production, the results are as follows Figure 6 As shown.

[0059] (4) Figure 5 The results showed that the astaxanthin production of strain Asta-4 reached 530.54 mg / L in a 500 mL baffle shake flask.

[0060] Example 8: Cultivating an engineered strain capable of producing astaxanthin in a 5 L bioreactor (1) The engineered strain Asta-4 in Example 4 was cultured in 25 mL YPD medium for 12 hours to obtain a primary seed liquid. Then, it was inoculated into 160 mL YPD medium at a ratio of 10% to obtain a secondary seed liquid.

[0061] (2) All secondary seed culture was inoculated into 1440 mL of fermentation medium in a 5 L bioreactor and fermented at 30 °C. Before feeding, the dissolved oxygen level was controlled at 30%, the stirring speed was controlled at 600 rpm, and the aeration rate was 2.5 vvm. The pH value during fermentation was adjusted to 6 using pure acetic acid and 6 mol / L sodium hydroxide. An antifoaming agent was added to prevent foam formation. After 20 h of culture, carbon source was added at a rate of 6 g / L / h. The added carbon source was 800 g / L glucose. At the same time, the aeration rate was changed to 2 vvm, and the stirring speed was fixed at 800 rpm. The total culture time was 168 h. Samples were collected every 12 h for subsequent data measurement. The formulation of the bioreactor fermentation medium was 40 g / L glucose, 3.3 g / L peptone, 6.7 g / L yeast extract, and 10 g / L urea.

[0062] (3) The change in stem cell weight (DCW) during fermentation was determined by freeze drying, and the OD was measured according to the methods in Examples 5(3)-(5). 600 And astaxanthin production.

[0063] Example 9: pH optimization for culturing astaxanthin-producing engineered strains in a 5 L bioreactor (1) The secondary seed culture of engineered strain Asta-4 was obtained according to the method of Example 8 (1).

[0064] (2) All secondary seed culture was inoculated into 1440 mL of fermentation medium in a 5 L bioreactor. The fermentation process conditions were basically the same as those in Example 8 (2), except that pure acetic acid and 6 mol / L sodium hydroxide were used to adjust the pH value to 5.8 during the fermentation process.

[0065] (3) The change in stem cell weight (DCW) during fermentation was determined by freeze drying, and the OD was measured according to the methods in Examples 5(3)-(5). 600 And astaxanthin production.

[0066] Example 10: Optimization of nitrogen source for astaxanthin-producing engineered strains cultured in a 5 L bioreactor (1) The secondary seed culture of engineered strain Asta-4 was obtained according to the method of Example 8 (1).

[0067] (2) All the secondary seed culture was inoculated into 1440 mL of fermentation medium in a 5 L bioreactor. The fermentation conditions were basically the same as those in Example 8(2), except that after 20 h of culture, carbon source was added at a rate of 6 g / L / h and nitrogen source was added at a flow rate of 0.375 g / L / h. The added carbon source was 800 g / L glucose, and the nitrogen source was a mixed solution of 33 g / L peptone, 67 g / L yeast extract, 80 g / L urea and 20 g / L ammonium sulfate.

[0068] (3) The change in stem cell weight (DCW) during fermentation was determined by freeze drying, and the OD was measured according to the methods in Examples 5(3)-(5). 600 And astaxanthin production.

[0069] Example 11: Optimization of pH and nitrogen source for astaxanthin-producing engineered strains cultured in a 5 L bioreactor (1) The secondary seed culture of engineered strain Asta-4 was obtained according to the method of Example 8 (1).

[0070] (2) All the secondary seed culture was inoculated into 1440 mL of fermentation medium in a 5 L bioreactor. The fermentation conditions were basically the same as those in Example 8(2), except that pure acetic acid and 6 mol / L sodium hydroxide were used to adjust the pH to 5.8 during the fermentation process, and carbon source was added at a rate of 6 g / L / h and nitrogen source was added at a flow rate of 0.375 g / L / h after 20 h of culture. The added carbon source was 800 g / L glucose, and the nitrogen source was a mixed solution of 33 g / L peptone, 67 g / L yeast extract, 80 g / L urea and 20 g / L ammonium sulfate.

[0071] (3) The change in stem cell weight (DCW) during fermentation was determined by freeze drying, and the OD was measured according to the methods in Examples 5(3)-(5). 600 And astaxanthin production.

[0072] Example 12: Optimization of fermentation conditions for cultivating astaxanthin-producing engineered strains in a 5 L bioreactor (1) By comparing the results of Examples 8 to 11, the optimal conditions were determined as follows: fermentation at 30 °C, dissolved oxygen at 30% before feeding, stirring speed at 600 rpm, aeration rate at 2.5 vvm, pH adjusted to 5.8 using pure acetic acid and 6 mol / L sodium hydroxide, addition of defoamer to prevent foam formation, and feeding of carbon source at a rate of 6 g / L / h and nitrogen source at a flow rate of 0.375 g / L / h after 20 h of cultivation, while changing the aeration rate to 2 vvm and fixing the stirring speed at 800 rpm. The total cultivation time was 168 h. The supplemented carbon source was 800 g / L glucose, and the nitrogen source was a mixed solution of 33 g / L peptone, 67 g / L yeast extract, 80 g / L urea, and 20 g / L ammonium sulfate. The astaxanthin yield in the engineered strain was improved by adjusting the pH and optimizing the continuous feeding method.

[0073] (2) The changes in cell dry weight, astaxanthin yield and content with fermentation time under the obtained optimal fermentation conditions are as follows: Figure 6 As shown, the results indicate that after 168 h of fermentation, the highest yield (titer) of astaxanthin reached 1.43 g / L, the highest cellular content of astaxanthin reached 14.87 mg / g DCW, the production rate of astaxanthin was approximately 8.51 mg / L / h, and the yield based on glucose conversion (glucose conversion efficiency, astaxanthin production / glucose consumption) was 3.32 mg / g.

[0074] The above-described embodiments are merely illustrative of several implementations of the present invention, and their descriptions are relatively specific and detailed. These embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. It should be noted that, for those skilled in the art, several variations, combinations, and improvements can be made to the above embodiments without departing from the concept of this patent, and these all fall within the scope of protection of this patent. Therefore, the scope of protection of this patent is determined by the claims.

Claims

1. A method for constructing an engineered strain of *Yersinia lipophila* that synthesizes astaxanthin, characterized in that, The method includes processing materials derived from Haematococcus pluvialis (… Haematococcus Pluvialis β-carotene hydroxylase (HpCrtZ) is derived from Paracoccus spp. Paracoccus sp. β-carotene ketolase (PsCrtW) and β-carotene ketolase derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae) Saccharomyces cerevisiae The carnitine acetyltransferase (ScCAT2) was transferred into a β-carotene-producing Yersinia lipolytica engineered strain. The nucleotide sequence of the gene HpCrtZ is shown in SEQ ID NO.1, the nucleotide sequence of the gene PsCrtW is shown in SEQ ID NO.2, and the nucleotide sequence of the gene ScCAT2 is shown in SEQ ID NO.

3.

2. The method for constructing a *Yarrowia lipolytica* engineered strain for synthesizing astaxanthin according to claim 1, characterized in that, It also includes the genes HpCrtZ, PsCrtW, and ScCAT2, all of which are fused with the peroxisome targeting signal (PTS) peptide SKL, with the nucleotide sequence encoding SKL shown in SEQ ID NO.

4.

3. The method for constructing a *Yarrowia lipolytica* engineered strain for synthesizing astaxanthin according to claim 1, characterized in that, It also includes forming a fusion enzyme complex PsCrtW~HpCrtZ by connecting the N-terminus of the gene HpCrtZ and the C-terminus of the gene PsCrtW with a flexible linker peptide GGGGSGGPGS, and then fusing it with the peroxisome targeting signal peptide SKL, wherein the nucleotide sequence encoding the flexible linker peptide is shown in SEQ ID NO.

5.

4. The method for constructing a *Yersinia lipophila* engineered strain for synthesizing astaxanthin according to claim 3, characterized in that, It also includes copies expressing three fusion genes PsCrtW~HpCrtZ, which are fused to target signal peptides of the peroxisome, endoplasmic reticulum (ER), and lipid droplet (LD), respectively. The nucleotide sequence encoding the target signal peptide of the ER is shown in SEQ ID NO.6, and the nucleotide sequence encoding the target signal peptide of the lipid droplet is shown in SEQ ID NO.

7.

5. The engineered strain of Yersinia lipophila that synthesizes astaxanthin obtained by the construction method according to any one of claims 1-4.

6. A method for producing astaxanthin, characterized in that, This includes fermenting and culturing the engineered strain of Yersinia lipophila as described in claim 5 to produce astaxanthin.

7. The method according to claim 6, characterized in that, The fermentation temperature is 25-35 ℃; the culture is carried out under shaking conditions for 80-150 h, and the shaking speed is 200-300 rpm.

8. A method for producing astaxanthin, characterized in that, This includes using a bioreactor to ferment and culture the engineered strain of Yersinia lipophila as described in claim 5 to produce astaxanthin.

9. The method according to claim 8, characterized in that, Using a continuously fed fermentation method, the fermentation temperature is 25-35℃, the pH value in the fermenter is controlled at 5.5-6.0, the dissolved oxygen is controlled at 25-35% before feeding, the aeration rate is 2-3 vvm, and after 15-25 h of cultivation, carbon and nitrogen sources are fed in continuously. After feeding, the rotation speed is fixed at 750-850 rpm, and the aeration rate is changed to 1.5-2.5 vvm. The total fermentation time is 140-180 h.

Images