An antigenic peptide for detecting Mycobacterium avium

Abstract

This invention relates to an antigenic peptide for detecting Mycobacterium avium. Specifically, this invention relates to an antigenic peptide, the amino acid sequence of which is shown in SEQ ID NO.1. The antigenic peptide and its encoding gene of this invention possess high species specificity, good secretibility, and excellent antigenicity, and can be used for molecular identification and rapid immunodiagnosis of Mycobacterium avium, as well as for rapid clinical screening of infected individuals.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and specifically to an antigenic peptide for detecting Mycobacterium avium. Background Technology

[0002] Nontuberculous mycobacteria (NTM) infection has become an increasingly serious public health challenge worldwide, with a significant upward trend in morbidity and mortality. Epidemiological data show that the prevalence of NTM infection has increased dramatically over the past three decades, and as of 2021, the proportion of NTM-related lung infections among mycobacterial lung diseases has increased significantly.

[0003] Because the clinical symptoms of NTM infection are highly similar to those of pulmonary tuberculosis, and it often coexists with underlying diseases such as chronic obstructive pulmonary disease, it is very easy to be misdiagnosed as drug-resistant tuberculosis or missed in diagnosis, which in turn leads to treatment delays, disease deterioration and even increased mortality. Therefore, there is an urgent need for clinically applicable specific and sensitive diagnostic techniques.

[0004] Mycobacterium avium complex ( Mycobacterium avium The avian mycobacterial complex (MAC) is the most common pathogen causing nontuberculous mycobacterial lung disease (NTM-PD). Within the avian mycobacterial complex, *Mycobacterium avium* (MAC) is the most prevalent pathogen. Mycobacterium avium ) is the most important. However, in routine clinical testing, *Mycobacterium avium* is easily confused with another major pathogenic bacterium in the same MAC genus, *Mycobacterium intracellulare* (…). Mycobacterium intracellulare The two species are highly similar in phenotype and some gene sequences, making rapid identification difficult using traditional methods. Equally important, *Mycobacterium avium* exhibits extensive zoonotic characteristics, not only transmitting to humans through animals with a wide host range, but also causing human infection through exposure to common environmental sources (such as water and soil), resulting in a complex environmental distribution. This characteristic significantly increases the complexity and difficulty of its prevention and control.

[0005] Currently, clinical and veterinary laboratory diagnosis of Mycobacterium avium mainly relies on the following three types of techniques, but all of them have significant limitations:

[0006] 1) Traditional microbiological and imaging methods: such as acid-fast staining of sputum smears, mycobacterial culture, drug sensitivity testing, and chest CT scans. While these methods are considered the "gold standard" for diagnosis, their long culture periods (one week or more) lag behind clinical decision-making needs, and their sensitivity is relatively low, especially for samples with low bacterial counts, where the positive culture rate is often less than 53%, easily leading to missed diagnoses. Furthermore, these traditional biochemical identification methods are too closely related and cannot effectively distinguish between Mycobacterium avium and intracellular mycobacteria.

[0007] 2) Advanced diagnostic technologies: such as metagenomic next-generation sequencing (mNGS), targeted next-generation sequencing (tNGS), and matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS). While these technologies have improved throughput and identification accuracy, they still face many bottlenecks, including expensive diagnostic equipment, high reagent costs, complex operating procedures, and high requirements for laboratory conditions and technical personnel. Furthermore, technologies such as mNGS are susceptible to interference from closely related species and host nucleic acid background, potentially leading to difficulties in differentiating positive cases and ruling out negative cases. Therefore, these technologies are difficult to widely promote and popularize in primary healthcare institutions, remote areas, and livestock farms.

[0008] 3) Serum RNA, serological markers, and biomarkers: such as microRNA (miRNA), specific cytokines (interleukin IL series), and lipoarabinomannan (LAM). Although these minimally invasive or non-invasive detection methods have the potential for convenience, the currently discovered markers generally suffer from insufficient specificity (easily cross-reacting with other mycobacteria) or unstable sensitivity, and lack large-scale clinical validation data to support them. At present, they can only be used as auxiliary diagnostic tools and cannot make independent diagnoses.

[0009] In summary, current technologies lack a precise identification technique for Mycobacterium avium that combines high specificity, high sensitivity, rapid response, low cost, and ease of deployment in grassroots laboratories and livestock farms. Therefore, discovering and validating novel biomarkers unique to Mycobacterium avium, and developing efficient and specific detection tools based on these biomarkers, is of urgent practical significance and important clinical application value for achieving early and rapid identification of this pathogen, guiding precise clinical medication, interrupting zoonotic transmission chains, and improving patient prognosis. Summary of the Invention

[0010] In view of this, the main objective of the present invention is to provide a detection method that is efficient, convenient and accurate for the detection and identification of Mycobacterium avium.

[0011] The first aspect of the present invention provides an antigenic peptide, characterized in that the amino acid sequence of the antigenic peptide is shown in SEQ ID NO.1.

[0012] A second aspect of the present invention provides an isolated or synthesized nucleic acid molecule encoding an antigenic peptide of the first aspect of the present invention.

[0013] In some implementations, the nucleotide sequence of the isolated or synthesized nucleic acid molecule is shown in SEQ ID NO.2.

[0014] A third aspect of the present invention provides a kit for detecting Mycobacterium avium, the kit comprising a detection reagent for detecting Mycobacterium avium in a sample, the detection reagent comprising an antigenic peptide of the first aspect of the present invention, a reagent for detecting the antigenic peptide of the first aspect of the present invention, or a reagent for detecting the isolated or synthesized nucleic acid molecule of the second aspect of the present invention.

[0015] A fourth aspect of the present invention provides the use of the antigenic peptide of the present invention, or the isolated or synthesized nucleic acid molecule of the present invention, in the preparation of a kit for detecting Mycobacterium avium.

[0016] The fifth aspect of this invention provides the use of the antigenic peptide of this invention, or the isolated or synthesized nucleic acid molecule of this invention, in the preparation of a vaccine for the prevention and / or treatment of Mycobacterium avium infection.

[0017] In some embodiments, the vaccine of the present invention is used in combination with one or more other chemical agents, targeted agents or vaccine agents for the prevention and / or treatment of Mycobacterium avium infection.

[0018] The sixth aspect of this invention provides a method for preparing antibodies, comprising:

[0019] Immunization was performed using an antigenic peptide with an amino acid sequence as shown in SEQ ID NO.1, and the resulting product was purified to obtain antibodies.

[0020] A seventh aspect of the present invention provides a primer composition comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.10 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.11.

[0021] The eighth aspect of the present invention provides the use of the primer composition of the present invention in the preparation of a kit for detecting Mycobacterium avium.

[0022] The beneficial effects of this invention are:

[0023] On the one hand, the antigenic peptide of the present invention can not only be expressed in bacteria, but also has significant secretion characteristics, can be transported to the extracellular space, and also has good immunogenicity, which can induce the production of antibodies with high specificity against Mycobacterium avium.

[0024] On the other hand, as demonstrated in the examples, the antigenic peptides of the present invention are enriched in high abundance in the secretory components, suggesting that they play an important biological function in the interaction between Mycobacterium avium and the host or in the bacterial secretion mechanism.

[0025] On the other hand, the antibodies obtained by immunization using the antigenic peptide of the present invention can be used efficiently to detect Mycobacterium avium, and can also distinguish Mycobacterium avium from intracellular mycobacteria and other pathogenic nontuberculous mycobacteria. The detection results have high interspecies specificity, indicating that the antigenic peptide of the present invention has the potential to serve as a novel serological diagnostic marker for distinguishing Mycobacterium avium infection from intracellular mycobacteria infection.

[0026] On the other hand, as demonstrated in the examples, the antibodies obtained using the antigenic peptides of the present invention maintain good detectability for Mycobacterium avium, even in mixed infections with relatively low Mycobacterium avium load or competitive inhibition, and have excellent detection sensitivity. Attached Figure Description

[0027] Figure 1 The mass spectrometry spectra of the seven peptides identified in Example 1 are shown in the secondary mass spectrometry spectrum.

[0028] Figure 2 This is a comparison of the similarity between the experimental and theoretical spectra of the seven peptides identified in Example 1.

[0029] Figure 3 The mass spectrum of the synthesized peptide RTYVDYDGML is compared with the original identified peptide spectrum.

[0030] Figure 4 for MAA44156_RS03465 A schematic diagram of its flanking sequences, start codon, and complete coding region.

[0031] Figure 5 for MAA44156_RS03465 The Western blot results of the encoded protein.

[0032] Figure 6 for MAA44156_RS03465 Abundance ranking of encoded proteins in whole-cell lysis proteins and secreted proteins of Mycobacterium avium.

[0033] Figure 7 The image shows the results of fluorescence PCR melting curve analysis in four patients with clinical infection.

[0034] Figure 8 The image shows the DNA microarray chip detection results of 4 patients with clinical infection.

[0035] Figure 9 The image shows the MALDI-TOF MS test results of four patients with clinical infection.

[0036] Figure 10 for MAA44156_RS03465 Western blot results of the encoded protein in clinical NTM-infected plasma samples.

[0037] Figure 11 for MAA44156_RS03465 Figure showing the results of gene sequence homology comparison in mycobacteria other than Mycobacterium avium.

[0038] Figure 12 for MAA44156_RS03465 Figure showing the results of protein sequence homology comparisons in mycobacteria other than Mycobacterium avium.

[0039] Figure 13 for MAA44156_RS03465 PCR results of the gene in NTM standard strain.

[0040] Figure 14 for MAA44156_RS03465 Figure showing the sequence alignment coverage of the gene in four subspecies of Mycobacterium avium.

[0041] Figure 15 for MAA44156_RS03465 A diagram showing the results of double sequence comparisons of genes in the genomes of bird and forest subspecies. Detailed Implementation

[0042] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0043] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood in the art to which this invention pertains. The following definitions supplement those in the art and relate to this application, but are not extrapolated to any relevant or unrelated circumstances, such as any conventionally used patent or application. While any methods and materials similar to or equivalent to those described herein may be used in practical testing, the materials and methods described herein are preferred. Therefore, the terminology used herein is intended to describe specific embodiments only and is not intended to limit the invention.

[0044] In this document, the terms “including,” “comprising,” and “having” are open-ended descriptions that include the specified steps described, as well as other steps that do not materially affect them, and are optional and not excluded.

[0045] In this document, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Unless otherwise stated, these features are not limited by these terms. These terms are used only to distinguish one concept from another. For example, without departing from the scope of the embodiments of this application, a first protein may also be referred to as a second protein, and similarly, a second protein may also be referred to as a first protein.

[0046] As mentioned above, existing avian mycobacterium identification techniques cannot meet the diagnostic needs for rapid, accurate, and readily accessible methods.

[0047] To address the aforementioned problems, the inventors of this invention, through a series of studies, integrated proteomics and precise proteogenomics technologies, successfully identifying the peptide encoded by the gene MAA44156_RS03465 in Mycobacterium avium. Further comparative genomics analysis and PCR amplification experiments confirmed that the gene MAA44156_RS03465 and its flanking sequences possess Mycobacterium avium species specificity. This characteristic makes it an ideal molecular marker for distinguishing Mycobacterium avium from other non-tuberculous mycobacteria, particularly intracellular mycobacteria, thus completing this invention.

[0048] The first aspect of the present invention provides an antigenic peptide, characterized in that the amino acid sequence of the antigenic peptide is shown in SEQ ID NO.1.

[0049] The antigenic peptide of this invention can be expressed in bacteria and also exhibits significant secretion properties, enabling it to be transported extracellularly. Furthermore, it possesses good immunogenicity and can induce the production of antibodies with high specificity against Mycobacterium avium. Antibodies obtained by immunization using the antigenic peptide of this invention can be efficiently used to detect Mycobacterium avium, with detection results showing high interspecies specificity. This indicates that the antigenic peptide of this invention has the potential to serve as a novel serological diagnostic biomarker for distinguishing Mycobacterium avium infection from intracellular mycobacteria.

[0050] In some embodiments, the amino acid sequence of the antigenic peptide can be a conserved variant sequence that does not affect its function, generated by adding mutations based on the sequence shown in SEQ ID NO.1. For example, one or more amino acids that do not affect its function can be added to the N-terminus or C-terminus of the above-mentioned antigenic peptide (e.g., adding a linker peptide, protein tag sequence, etc.).

[0051] In some implementations, the protein tag sequence includes, but is not limited to, His tag, GST tag, MBP tag, etc.

[0052] In some implementations, the linker peptide may include, but is not limited to, AAY, EAAAK, GGPPG, and GS-rich flexible linker peptides (such as GGGS).

[0053] In some embodiments, the amino acid sequence of the antigenic peptide can be a derived sequence obtained by one or more modifications based on the antigenic peptide of the present invention. For example, these modifications may include: phosphorylation, PEGylation, amidation, glycosylation, and biotinylation.

[0054] In addition, the present invention also provides a protein complex obtained by linking the antigenic peptide of the present invention with a first protein.

[0055] In a specific embodiment, the antigenic peptide of the present invention is linked to the first protein through a non-gene fusion method.

[0056] In some implementations, the first protein is a carrier protein.

[0057] In exemplary embodiments, the carrier proteins include, but are not limited to, KLH, BSA, OVA, and TT (tetanus toxoid).

[0058] The linking of the antigenic peptide to the carrier protein in the protein complex can be carried out in a manner well known to those skilled in the art, such as by chemical cross-linking (e.g., thiol-maleimide method, EDC / NHS method, or glutaraldehyde method).

[0059] In some implementations, the first protein is an MHC molecule.

[0060] In specific implementation schemes, MHC molecules include, but are not limited to, class I MHC molecules, class II MHC molecules, and MHC multimers (such as MHC single-chain trimers).

[0061] The linking of the antigenic peptide to the MHC molecule in the protein complex can be carried out in a manner well known to those skilled in the art, such as chemical loading (incubating the peptide and MHC molecule in a buffer solution).

[0062] In addition, the present invention provides a fusion protein comprising the antigenic peptide and the second protein of the present invention, and an optional linking peptide therebetween.

[0063] In specific implementation schemes, the second protein can be an Fc fragment (such as the human IgG Fc fragment), an MHC molecule, or a cell-penetrating peptide (such as TAT ​​or cell-penetrating peptide).

[0064] Those skilled in the art can select a suitable fusion sequence for fusion proteins. For example, when the second protein is a cell-penetrating peptide, the cell-penetrating peptide is preferably located at the N-terminus of the fusion protein, which is beneficial for the function of its N-terminal cation cluster.

[0065] The present invention also provides a composition comprising:

[0066] The present invention includes antigenic peptides, protein complexes or fusion proteins; and adjuvants.

[0067] As defined in this article, an adjuvant is a non-antigenic substance that, when mixed with an antigen and injected into an animal, can significantly enhance the body's specific immune response to that antigen, thereby helping to produce higher titers and longer-lasting antibodies.

[0068] Specifically, adjuvants can be Freund's adjuvant, aluminum adjuvant, etc.

[0069] The present invention also provides an isolated or synthesized nucleic acid molecule that encodes the antigenic peptide or fusion protein of the present invention.

[0070] In some implementations, the nucleotide sequence of the isolated or synthesized nucleic acid molecule encoding the antigenic peptide is shown in SEQ ID NO. 2.

[0071] Based on the amino acid sequence and codon rules of the antigenic peptide provided by this invention, those skilled in the art can obtain the nucleotide sequence of the nucleic acid molecule encoding the above-mentioned antigenic peptide. Due to the degeneracy of codons, the nucleotide sequence encoding a single amino acid sequence is not unique, and all nucleic acid molecules capable of encoding the above-mentioned antigenic peptide are within the protection scope of this invention.

[0072] In some implementations, nucleic acid molecules include DNA or RNA.

[0073] In some implementations, RNA includes mRNA.

[0074] The present invention also provides a carrier comprising the nucleic acid molecules isolated or synthesized according to the present invention.

[0075] In some implementations, the vector includes an expression vector, i.e., a construct capable of expression in vivo or in vitro. In some specific implementations, the expression vector includes a self-amplifying RNA replicon, plasmid, bacteriophage, or virus.

[0076] In some embodiments, the viral vector includes, but is not limited to, adenovirus vectors, adeno-associated virus (AAV) vectors, herpesvirus vectors, retrovirus vectors, lentivirus vectors, and baculovirus vectors. Preferably, the vector can transfer the isolated or synthesized nucleic acid molecules of the present invention into cells. In some embodiments, the vector is capable of sustained high-level expression in dendritic cells.

[0077] In some implementations, the lentiviral vector may include: the lentiviral expression vector pLenti (addgene).

[0078] The present invention also provides a host cell, which includes the nucleic acid molecule isolated or synthesized by the present invention or the vector of the present invention.

[0079] While the host cell can be any cell type, mammalian cells, including human cells, are preferred. In other embodiments, the host cell includes chicken cells from poultry. In specific embodiments, these cells can originate from any type of tissue or be cells at any developmental stage.

[0080] In some embodiments, when host cells or related cell populations are administered, the host cells may be allogeneic or autologous to mammals. Preferably, the cells are autologous to mammals.

[0081] In some embodiments, mammal means any mammal, including but not limited to: rodents such as mice and rats, and lagomorphs such as rabbits; or animals from the order Artiodactyla such as sheep, or from the order Perissodactyla including equines (horses); most preferably, mammals from the order Primates, or from the suborder Anthropoidea (humans and apes). Particularly preferred is the mammal human.

[0082] The present invention also provides a kit for detecting Mycobacterium avium, the kit comprising detection reagents for detecting Mycobacterium avium in a sample, the detection reagents comprising reagents for detecting the antigenic peptide of the present invention, or reagents for detecting the isolated or synthesized nucleic acid molecules of the present invention.

[0083] The present invention also provides a kit for identifying Mycobacterium avium from other pathogenic nontuberculous mycobacteria. The kit includes detection reagents for identifying Mycobacterium avium from other pathogenic nontuberculous mycobacteria in a sample. The detection reagents include reagents for detecting the antigenic peptides of the present invention, or reagents for detecting the isolated or synthesized nucleic acid molecules of the present invention.

[0084] It should be understood that the kit of the present invention can be used to detect Mycobacterium avium, to differentiate between Mycobacterium avium and intracellular mycobacteria, or to distinguish between Mycobacterium avium and other pathogenic nontuberculous mycobacteria. This expands the scope of clinical application, making it easier to adapt to different scenarios based on actual conditions, thus facilitating faster and more accurate identification of pathogens and benefiting clinical diagnosis and treatment.

[0085] In some embodiments, the kit of the present invention is a nucleic acid detection kit, a protein / peptide detection kit, or an immunoassay kit. In some specific embodiments, the nucleic acid detection kit is a PCR detection kit. In other specific embodiments, the immunoassay kit is an ELISA kit, a colloidal gold kit, or a chemiluminescence kit.

[0086] The present invention also provides detection reagents for detecting Mycobacterium avium or for differentiating Mycobacterium avium from other pathogenic nontuberculous mycobacteria in a sample. The detection reagents include the antigenic peptide of the present invention, reagents for detecting the antigenic peptide of the present invention, or reagents for detecting the isolated or synthesized nucleic acid molecules of the present invention.

[0087] The present invention also provides the use of the antigenic peptide of the present invention, or the isolated or synthesized nucleic acid molecule of the present invention, in the preparation of a kit for detecting Mycobacterium avium.

[0088] The present invention also provides the use of the antigenic peptide of the present invention, or the isolated or synthesized nucleic acid molecule of the present invention, in the preparation of a kit for identifying Mycobacterium avium and Mycobacterium intracellulare in a sample.

[0089] The present invention also provides the use of the antigenic peptide of the present invention, or the isolated or synthesized nucleic acid molecule of the present invention, in the preparation of a kit for identifying Mycobacterium avium in a sample from other pathogenic nontuberculous mycobacteria.

[0090] In some implementations, other pathogenic nontuberculous mycobacteria come from other species in the Mycobacterium family.

[0091] In some implementations, other pathogenic nontuberculous mycobacteria are derived from the Mycobacterium avium complex.

[0092] Specifically, other pathogenic nontuberculous mycobacteria can be one or more of the following: intracellular mycobacteria, Mycobacterium smegmatis, Mycobacterium bovis, Mycobacterium scrofula, Mycobacterium tuberculosis (complex), Mycobacterium guilloché, Mycobacterium simianum, Mycobacterium chrysogenum, Mycobacterium gardense, Mycobacterium kansasii, Mycobacterium abscessum, Mycobacterium chrysogenum, Mycobacterium urinaria, Mycobacterium terrestris, Mycobacterium nonchromogenic, Mycobacterium sugaense, Mycobacterium Malmosii, or Mycobacterium bufo. Intracellular mycobacteria are preferred.

[0093] In some implementations, the sample is selected from one or more of the subject's clinically isolated bacterial strains, tissue samples, or body fluid samples. In some specific implementations, the body fluid sample includes, but is not limited to, plasma, serum, cerebrospinal fluid, urine, and exosomes derived from the above-mentioned body fluids.

[0094] The present invention also provides the use of the antigenic peptide of the present invention, or the isolated or synthesized nucleic acid molecule of the present invention, in the preparation of vaccines for the prevention and / or treatment of Mycobacterium avium infection.

[0095] In some implementations, vaccines include DNA vaccines, mRNA vaccines, circRNA vaccines, peptide vaccines, dendritic cell vaccines (DC vaccines), etc. Taking an mRNA vaccine as an example, an mRNA vaccine may include mRNA encoding the aforementioned antigenic peptides. Taking a DC vaccine as an example, the DC vaccine can be prepared by loading DCs with peptides.

[0096] In some implementations, the vaccine can be used to directly immunize patients who have the aforementioned antigenic peptides.

[0097] As used herein, the term "treatment" refers to the administration of one or more pharmaceutically acceptable substances to a patient or subject suffering from or exhibiting symptoms of a disease, in order to cure, alleviate, reduce, improve, or affect the disease or its symptoms. As used herein, the term includes prevention of the worsening of a disease, condition, or related symptoms. It should be understood that the term "treatment," as used herein, may not be effective for all subjects seeking treatment. However, preferably, the term should require that a statistically significant proportion of subjects suffering from the disease or condition described herein can be successfully treated. Statistical significance can be determined using various known statistical assessment tools, such as confidence interval determination, p-value determination, t-test, Mann-Whitney test, etc.

[0098] The term "prevention" refers to maintaining health associated with the disease or condition described herein in subjects over a period of time. It should be understood that this period of time can depend on the amount of the pharmaceutically acceptable substance administered and individual factors of the subject. It should be understood that prevention may not be effective in all subjects treated. However, preferably, the term requires effective prevention of a statistically significant proportion of subjects in a group or population suffering from the disease or condition described herein or its accompanying symptoms. Statistical significance can be determined using various known statistical assessment tools, such as confidence interval determination, p-value determination, t-test, Mann-Whitney test, etc.

[0099] As used herein, "therapeutic effective amount" is intended to include the amount of an mRNA vaccine or pharmaceutical composition thereof that is sufficient to achieve treatment of the disease (e.g., by weakening, improving, or maintaining the existing disease or symptoms of one or more diseases) when administered to a patient for the treatment of Mycobacterium avium infection. This "therapeutic effective amount" may depend on the mRNA vaccine or pharmaceutical composition thereof, how the agent is administered, the disease and its severity, and the patient's medical history, age, weight, family history, genetic makeup, stage of the pathological process, type of prior or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0100] As used herein, a “preventive effective dose” refers to an amount of mRNA vaccine or a pharmaceutical composition thereof sufficient to prevent or improve one or more symptoms of the disease or condition when administered to a subject who has not yet experienced or exhibited symptoms of Mycobacterium avium infection but may be susceptible to the disease. Improving the disease includes slowing its progression or reducing the severity of subsequent disease development. This “preventive effective dose” can depend on the mRNA vaccine, how the agent is administered, the level of risk for the disease, and the subject’s medical history, age, weight, family history, genetic makeup, type of prior or concomitant treatment (if any), and other individual characteristics of the subject.

[0101] "Therapeutic effective amount" or "prophylactic effective amount" also includes the amount of the mRNA vaccine or pharmaceutical composition thereof that produces a desired local or systemic effect at a reasonable benefit / risk ratio suitable for any treatment. The mRNA vaccine or pharmaceutical composition thereof used in the methods of this disclosure may be administered in an amount sufficient to produce a reasonable benefit / risk ratio suitable for such treatment.

[0102] In some embodiments, the vaccine of the present invention is used in combination with one or more other chemical agents, targeted agents or vaccine agents for the prevention and / or treatment of Mycobacterium avium infection.

[0103] The present invention also provides a method for preparing antibodies, comprising:

[0104] Immunization is performed using the antigenic peptide or composition of the present invention, and the resulting product is purified to obtain antibodies.

[0105] In some implementations, the prepared antibody may be a monoclonal antibody or a polyclonal antibody.

[0106] The present invention also provides a primer composition comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer includes, but is not limited to, that shown in SEQ ID NO. 10, and the nucleotide sequence of the downstream primer includes, but is not limited to, that shown in SEQ ID NO. 11.

[0107] The primer composition of the present invention has excellent specificity, and can accurately identify Mycobacterium avium, accurately distinguish Mycobacterium avium from intracellular mycobacteria and other pathogenic nontuberculous mycobacteria, with high accuracy.

[0108] The present invention also provides a method for treating Mycobacterium avium, comprising:

[0109] Obtain test samples suspected of being infected with Mycobacterium avium;

[0110] The samples obtained from the test samples were tested using the primer composition of the present invention or the kit of the present invention; and

[0111] Obtain and analyze the results.

[0112] The following describes preferred embodiments of the present invention, but the scope of protection of the present invention is not limited to these preferred embodiments. It should be noted that any modifications and improvements made by those skilled in the art based on this inventive concept are within the scope of protection of the present invention. All reagents used, unless otherwise specified, are commercially available conventional products.

[0113] Example 1: Mycobacterium avium gene MAA44156_RS03465 Confirmation of protein expression and secretion characteristics

[0114] Deep-coverage proteomics was used to study Mycobacterium avium and its representative strain, including the standard strain DSM 44156 of Mycobacterium avium. T The study was conducted. Based on the reference protein library of this strain in the NCBI database, a proteomics mass spectrometry data search engine, such as pFind software (v3.2.0), was used to perform a database search analysis on the deep coverage dataset.

[0115] The results are as follows Figure 1 As shown, a total of 7 high-quality, fully digested peptides were identified, including 2 pairs of mirror peptides "MGEPKPPPYSLEDSQPEVEELLADFKR" and "RMGEPKPPPYSLEDSQPEVEELLADFK", "TYVDYDGMLK" and "RTYVDYDGML"; and 3 single peptides "RMAIALI", "ATDRSPDEVLR" and "RDLEQQWAT", thus confirming the expression of the protein encoded by the gene MAA44156_RS03465.

[0116] Of the seven peptides mentioned above, one peptide, RTYVDYDGML (i.e., ...), was identified in both whole-cell proteomics and secretory proteomics. Figure 1 (a) Two peptides were individually identified in the whole-cell proteome: MGEPKPPPYSLEDSQPEVEELLADFKR and RMGEPKPPPYSLEDSQPEVEELLADFK (i.e. Figure 1 (b and c in the text); Four peptides were individually identified in the secretory proteome: TYVDYDGMLK, RMAIALI, ATDRSPDEVLR, and RDLEQQWAT (i.e., ... Figure 1 (d, e, f, g in the spectrum). The secondary mass spectra of all identified peptides showed continuous b / y ion series matching, low background clutter signals, high spectral confidence, and reliable results. Figure 2The similarity scores (Cosine values) between the experimental and theoretical spectra were compared. All seven peptide spectra showed similarity scores above 0.96 compared to the MS2 spectra predicted from the peptide sequences, thus confirming the reliability of the peptides identified in this invention.

[0117] To further verify the authenticity of the identification results and confirm its secretory characteristics, the common peptide "RTYVDYDGML" from whole-cell and secretory proteome samples was selected for chemical synthesis. The synthesized peptide was analyzed by liquid chromatography-mass spectrometry, and its secondary mass spectra were compared with those of the natural peptide obtained through large-scale identification.

[0118] The results are as follows Figure 3 As shown, the fragment ion distribution patterns of the two are highly consistent, with a spectral similarity (Cosine value) as high as 0.99. This result not only confirms the accuracy of the identification results of deep coverage proteomics technology, but also strongly proves the gene... MAA44156_RS03465 The encoded protein is not only expressed within the bacterial cell, but also has significant secretory properties, enabling it to be transported extracellularly.

[0119] Gene MAA44156_RS03465 The amino acid sequence of the encoded product is shown in SEQ ID NO.1:

[0120] VPDERSGKESLRMAIALIRARMGEPKPPPYSLEDSQPEVEELLADFKRTYVDYDGMLKGGMQSLVVGLLIEVSRATDRSPDEVLRDLEQQWAT (SEQ ID NO. 1)

[0121] The location of the start codon, the complete coding region, and the flanking sequences of this gene coding region on the genome is as follows: Figure 4 As shown, the complete DNA sequence was obtained by consulting the genome location information online, and the coding sequence of the gene MAA44156_RS03465 was obtained as shown in SEQ ID NO.2.

[0122] GTGCCGGATGAGCGAAGTGGCAAAGAGAGCCTCAGGATGGCGATTGCCCTCATACGCGCCCGAATGGGCGAACCGAAGCCGCCGCCGTATTCTCTCGAAGACTCGCAGCCCGAAGTAGAGGAGTTGCTTGCCGACTTCAAA CGGACGTACGTCGATTACGACGGCATGCTTAAGGGCGGTATGCAGAGCCTCGTCGTGGGGCTACTCATTGAGGTCAGTAGGGCGACGGACAGGAGTCCCGACGAGGTACTGCGGGACCTGGAACAACAGTGGGCCACATAA (SEQ ID NO.2)

[0123] The sequences of the seven peptides identified by deep coverage proteomics technology in this embodiment are shown below:

[0124] MGEPKPPPYSLEDSQPEVEELLADFKR (SEQ ID NO.3)

[0125] RMGEPKPPPYSLEDSQPEVEELLADFK (SEQ ID NO.4)

[0126] TYVDYDGMLK (SEQ ID NO.5)

[0127] RTYVDYDGML (SEQ ID NO.6)

[0128] RMAIALI (SEQ ID NO.7)

[0129] ATDRSPDEVLR (SEQ ID NO.8)

[0130] RDLEQQWAT (SEQ ID NO.9)

[0131] Example 2: Mycobacterium avium MAA44156_RS03465 Preparation of rabbit polyclonal antibodies encoding proteins

[0132] 1) Antibody design and immunization regimen

[0133] 1. MAA44156_RS03465 Synthesis of encoded proteins: Based on previous proteogenomics data, proteins with high expression levels and strong secretion capabilities... MAA44156_RS03465 The encoded protein was used as a diagnostic marker molecule for Mycobacterium avium and recombinantly expressed in Escherichia coli, and purified to obtain pure protein. MAA44156_RS03465The encoded protein is shown as a single band in SDS-PAGE electrophoresis.

[0134] 2. Animal immunization: Healthy New Zealand white rabbits (weighing approximately 2.0 kg) were selected as the immunization host.

[0135] First, MAA44156_RS03465 The encoded protein (500 µg / rabbit) was emulsified with complete Freund's adjuvant and injected subcutaneously at multiple sites into two rabbits.

[0136] Booster immunization: Booster immunizations were administered every 2 weeks after the initial immunization, for a total of 4 times. The booster immunizations used synthetic peptides (450 µg / animal) emulsified with incomplete Freund's adjuvant.

[0137] Blood collection: Rabbit blood was collected 10-14 days after the last immunization, and the serum was separated to obtain a crude extract of polyclonal antibodies.

[0138] II) Antibody Purification

[0139] 1. Ammonium sulfate precipitation

[0140] Centrifuge the serum at 8500 rpm for 20 min. After centrifugation, collect the supernatant, add saturated ammonium sulfate solution while mixing to precipitate the antibody, then centrifuge at 8500 rpm for 25 min at 4°C, discard the supernatant, and dissolve the precipitate with phosphate-buffered saline (PBS).

[0141] 2. Antibody affinity purification:

[0142] Pre-packed column preparation: Equilibrate the pre-packed column to room temperature, open the bottom cap, allow the liquid inside the column to drain completely, and then rinse the chromatography column with coupling buffer.

[0143] 3. Purify the antibody:

[0144] 1) Add coupling buffer to the chromatography column, then add water-dissolved antigen; after antigen binding is complete, wash the chromatography column with coupling buffer, and wash the top cap and bottom cap at the same time.

[0145] 2) Add blocking buffer and invert at 4°C to mix and block. After blocking, add coupling wash buffer and PBS to wash the column sequentially.

[0146] 3) Add the antiserum to the chromatography column and incubate overnight at 4°C. After binding, place the column on a rack to allow the agarose gel to precipitate, and collect the flow-through into a centrifuge tube for storage.

[0147] 4) Wash the chromatography column three times with 0.5M PBS, and then four times with 10x PBS;

[0148] 5) Pre-elute the column with 0.2 mL of elution buffer, then elute with 3 mL of elution buffer;

[0149] 6) Take a dialysis bag of suitable length, boil it in ultrapure water for 20 minutes, then rinse it with ultrapure water before use, or cool it and store it in 20%-50% ethanol at 4°C. Dialyze the antibody for 2-3 hours, then change the dialysate and dialyze overnight. Change the dialysate again the next day, dialyze for 2-3 hours, and then recover and purify the antibody.

[0150] Example 3: Mycobacterium avium MAA44156_RS03465 Immunological verification of the secretion properties of encoded proteins

[0151] To further confirm MAA44156_RS03465 The secretion characteristics of the encoded protein were assessed using the specific rabbit polyclonal antibody prepared in Example 2 against Mycobacterium avium. DSM 44156 T Western blot analysis was performed on samples of the strain's secreted proteins. The results are as follows: Figure 5 As shown, a clear, specific, and strongly signaling immunoreactivity band was detected at the position corresponding to the theoretically calculated molecular weight of the protein (approximately 10.5 kDa). This result strongly confirms... MAA44156_RS03465 The gene-encoded protein is not only expressed, but also has significant extracellular secretion properties and good immunogenicity, which can induce the production of highly specific antibodies.

[0152] Further quantitative analysis by mass spectrometry was performed, and the results were as follows: Figure 6 As shown, this protein exhibits high expression abundance in the secretory proteome. In the whole-cell proteome, its abundance ranks 3,381st in the Trypsin digestion group (approximately 87.55% of all identified proteins) and 1,875th in the LysargiNase digestion group (approximately 51.15%). However, in the secretory proteome, its ranking rises to 799th (25.72%) in the Trypsin digestion group and 523rd (18.29%) in the LysargiNase digestion group. This high abundance enrichment in the secretory component suggests that this protein may play an important biological role in the interaction between Mycobacterium avium and its host or in the bacterial secretion mechanism.

[0153] Example 4: MAA44156_RS03465 Diagnostic value assessment of encoded proteins in clinical Mycobacterium avium infection samples

[0154] For evaluation MAA44156_RS03465 To explore the potential of encoded proteins as clinical diagnostic biomarkers for Mycobacterium avium infection, this study collected plasma samples from four patients with nontuberculous mycobacterial infections detected at the hospital. All samples from these four patients were validated at the hospital using bacterial culture (the gold standard).

[0155] First, three commonly used clinical methods for auxiliary diagnosis of mycobacteria were used to test these four samples. The specific methods used were as follows:

[0156] 1) Mycobacterium identification kit (fluorescent PCR melting curve method), such as the product of Xiamen Zhishan Biotechnology Co., Ltd. (product technical number: National Medical Device Registration Certificate 20223401419). Its detection principle is based on probes designed according to the specific sequences of ITS fragments of different mycobacteria, and the identification of mycobacteria is carried out using specific fluorescence channels and melting points. See Table 1 for specific indicators.

[0157] Table 1. Reference Indicators for Strain Identification by Fluorescent PCR Melting Curve Method

[0158]

[0159] 2) Mycobacterium Species Identification Kit (DNA Microarray Chip Method), kit from Beijing Biochip Biotechnology Co., Ltd., product technical number: National Medical Device Registration Certificate 20173401340. Its detection principle involves designing specific PCR amplification primers and species-specific oligonucleotide probes for common clinical mycobacteria. Using pathogenic bacterial DNA isolated from clinical samples as a template, a unique asymmetric PCR technology is employed for amplification. Because the primer ends are labeled with fluorescent molecules, the DNA molecule to be detected is amplified into a DNA fragment carrying fluorescent molecules during the amplification process. The PCR amplification product labeled with fluorescent molecules is hybridized with the probe on the chip under certain conditions. According to the principle of base complementarity, the sequence-matched PCR amplification product and probe form a stable secondary structure.

[0160] 3) Autof ms1000, the instrument and database are from Zhengzhou Antu Biotechnology Co., Ltd. (AutobioDiagnostics Co., Ltd.), the detection principle is MALDI-TOF MS (matrix-assisted laser desorption / ionization time-of-flight mass spectrometry).

[0161] Results from fluorescence PCR melting curve analysis, DNA microarray analysis, and MALDI-TOF MS mass spectrometry are as follows: Figures 7 to 9 As shown, from Figures 7 to 9 The infection status of the four samples is analyzed as follows:

[0162] Sample 1: The results of fluorescence PCR melting curve method, DNA microarray chip method and MALDI-TOF MS mass spectrometry all showed that it was a simple Mycobacterium avium infection.

[0163] Sample 2: The results of fluorescence PCR melting curve method and MALDI-TOF MS mass spectrometry both showed intracellular mycobacterial infection; DNA microarray chip method detected co-infection of Mycobacterium avium and intracellular mycobacterium (the former signal was 3.26 times that of the latter).

[0164] Sample 3: The results of both the fluorescence PCR melting curve method and the DNA microarray chip method showed intracellular mycobacterial infection; the MALDI-TOF MS mass spectrometry results showed co-infection of intracellular mycobacterial and Mycobacterium masei species in the Mycobacterium avium (MAC).

[0165] Sample 4: The results of fluorescence PCR melting curve method and MALDI-TOF MS mass spectrometry both showed intracellular mycobacterial infection; DNA microarray chip method detected co-infection of intracellular mycobacterium and avian mycobacterium (the former signal was 30.77 times that of the latter).

[0166] Based on the combined results of three auxiliary diagnostic detection techniques for the isolated strains from patients, the samples were classified as follows:

[0167] Single infection group: P1 diagnosed as M. avium Single infection (results from all three testing methods are consistent).

[0168] Mixed infection / difficult-to-distinguish group: DNA microarray results for P2 and P4 are as follows M. avium and M. intracellulare Co-infection. Fluorescent PCR melting curve and DNA microarray assays for P3 both indicated intracellular mycobacterial infection, while MALDI-TOF MS mass spectrometry showed co-infection of intracellular mycobacteria and Mycobacterium masei within the Mycobacterium avium (MAC) group. Due to significant discrepancies in species identification between different traditional detection techniques, this was defined as a typical difficult sample.

[0169] Disease progression and technical comparison of complex cases (P2 and P4):

[0170] Patient P2 (disease duration 16 months): Gene chip analysis in September 2024 (16 months prior to sampling) indicated... M. avium Positive; Follow-up examination in September 2025 (2 months before sampling) showed... M. avium and M. intracellulare Co-infection was observed; in January 2026, the cultures were re-examined using three different methods, and the results showed discrepancies. The melting curve method was interpreted as indicating a single infection. M. intracellulare Infection, gene chip indications M. avium and M. intracellulare Co-infection (signal intensity difference was significant, the former being 3.26 times that of the latter), MALDI-TOF MS results showed that... M. intracellulare subsp. intracellulare and Mycobacterium intracellulare subsp. chimaera Subspecies (scoring values ​​of 8.70±0.41 and 7.89±0.14 respectively). Culture species identification includes... M. intracellulare subsp. intracellulare and Mycobacterium intracellulare subsp. chimaera Two subspecies.

[0171] P4 patient (disease duration 18 months): detected in bronchoalveolar lavage fluid in July 2024 (18 months prior to sampling). M. avium In September 2025 (three months prior to sampling), the gene chip was converted to... M. intracellulare Positive; in January 2026, the culture was retested using three different methods, and the melting curve method determined it to be a single virus. M. intracellulare Infection and gene chip re-examination results M. intracellulare and M. avium Co-infection (signal intensity difference was significant, the former being 30.77 times stronger than the latter), MALDI-TOF MS results showed two intracellular mycobacterial subspecies ( M. intracellulare subsp. intracellulare and M. intracellulare subsp. chimaera The scores were 7.43±0.64 and 6.80±0.28 respectively. Identification of bacterial strains in cultures included... M. intracellulare subsp. intracellulare and M. intracellulare subsp. chimaera Two subspecies.

[0172] Signal strength differences and limitations of traditional technologies

[0173] In co-infected P2 and P4 samples, DNA microarray analysis revealed significant differences in signal intensity. Specifically, in P2 samples... M. avium The signal strength (3,572) is M. intracellulare (1,097) was 3.26 times higher; however, in the P4 sample, M. intracellulare The signal strength (33,820) is M. avium The signal intensity was 30.77 times that of (1,099). This fold, even order of magnitude, difference in signal intensity caused inconsistencies between the interpretation results of the melting curve method and those of gene chips or MALDI-TOF MS, highlighting the limitations of traditional techniques. For P4 patients, both fluorescent PCR melting curve method and MALDI-TOF MS only detected the signal intensity that was absolutely dominant in the DNA microarray method. M. intracellulare However, in the P2 sample, both the traditional methods of fluorescent PCR melting curve analysis and MALDI-TOF only detected the weaker signals found in the microarray method. M. intracellulare This result indicates that traditional techniques have significant detection bottlenecks when processing co-infected samples from closely related species with vastly different pathogen loads, making it difficult to comprehensively and accurately reflect the true situation of all pathogens in the sample.

[0174] Next, the antibody prepared in Example 2 was used for detection.

[0175] Detection method: Patient plasma was processed using a laboratory-established high-abundance protein removal technique to enrich low-abundance protein components. Subsequently, the plasma prepared in Example 2 was analyzed. MAA44156_RS03465 Western blot analysis was performed using a specific rabbit polyclonal antibody. Results are as follows: Figure 10 As shown, it can be seen that:

[0176] Specific detection: In all three samples infected with Mycobacterium avium (samples 1, 2, and 4), clear specific bands were detected at the expected molecular weight positions, and the immune response signal was significant.

[0177] Negative control: No target band was detected in samples infected with Mycobacterium intracellulare and Mycobacterium masei (sample 3), confirming the high species specificity of the antibody and target protein for Mycobacterium avium and effectively eliminating cross-interference from closely related Mycobacterium intracellulare.

[0178] Semi-quantitative trend: The signal intensity of samples infected with Mycobacterium avium alone was significantly higher than that of mixed infection samples (1.47 times and 1.87 times, respectively). This may be related to the relatively low load of Mycobacterium avium in mixed infection or the presence of competitive inhibition, but good detectability was still maintained.

[0179] The above results indicate that MAA44156_RS03465 The encoded protein is present in a detectable form in the bloodstream of patients with Mycobacterium avium infection and exhibits extremely high species specificity. This protein has the potential to serve as a novel serological diagnostic biomarker for differentiating Mycobacterium avium infection from intracellular Mycobacterium endothelial infections.

[0180] In summary, the application involves the following: MAA44156_RS03465 The encoded protein and the antibody prepared from it exhibit excellent detection performance:

[0181] 1) Detectability: In complex mixed infection samples, this MAA44156_RS03465 The protein-encoding signal remained stable and detectable, unaffected by background interference.

[0182] 2) Load Correlation: Data shows that P1 is a single M. avium The WB hybridization signal intensity of infected samples was significantly higher than that of mixed-infection samples (1.47 times and 2.02 times that of P2 and P4, respectively). This difference reflects the higher intensity of hybridization in mixed infections. M. avium The bacterial cell load was relatively low or there was interspecies competitive inhibition, but this MAA44156_RS03465 The specific antibody encoding the protein was not missed, demonstrating its high sensitivity at low loading levels.

[0183] 3) Specificity verification: In M. intracellulare In a single infected sample, MAA44156_RS03465 The antibodies corresponding to the encoded protein did not show non-specific cross-reactivity, demonstrating its extremely high species specificity.

[0184] The above results strongly prove that: MAA44156_RS03465 The encoded protein and its specific antibody can effectively distinguish complex clinical blood samples. M. avium and M. intracellulare Infection. Even in co-infection scenarios where traditional molecular biology and mass spectrometry techniques fail due to significant differences in bacterial count and detection bias (e.g., in P3 patients, MALDI-TOF MS indicated Mycobacterium masei, a species within the Mycobacterium avium group). M. chimaera and intracellular mycobacterial subspecies ( M. intracellulare subsp. intracellulare and M. intracellulare subsp. chimaera Despite co-infection, this novel immunoassay technology can still accurately detect low viral loads. M. avium Infection signal. This signifies the protein's great potential as a next-generation diagnostic biomarker, which may help solve... M. avium The clinical challenge of differentiating between other NTM species.

[0185] Example 5: Genes encoding Mycobacterium avium MAA44156_RS03465 Species-specific verification

[0186] To confirm the gene MAA44156_RS03465 This study constructed a biomarker for Mycobacteriaceae (Mycobacteriaceae) as a potential marker for specificity of Mycobacteria. Mycobacteriaceae A phylogenetic dataset of standard strains. Complete genomes and annotated protein sequences of a total of 209 standard strains were systematically retrieved and downloaded from the NCBI database. This dataset covers genera including: Mycobacterium (85 strains), Mycolicibacter (17 strains), Mycobacteroides (7 plants) and Mycolicibacillus (3 strains).

[0187] by The DNA sequences of the genes and their encoded protein sequences were analyzed using BLASTN and BLASTP for homology comparison of the whole genome and protein sequences of the 209 bacterial strains. The results are as follows: MAA44156_RS03465 and Figure 11 As shown.

[0188] Based on the above results, a strict positive threshold was set: sequence coverage ≥ 60% and sequence similarity ≥ 70%. The comparison results show:

[0189] 1) Intraspecific conservation: The gene and its encoded protein showed 100% sequence identity in all strains of Mycobacterium avium, indicating that it is highly conserved within the species.

[0190] 2) Interspecies specificity: No significant matching sequences meeting the above thresholds were detected in any of the more than 200 Mycobacterial strains (including closely related nontuberculous mycobacteria) except for Mycobacterium avium.

[0191] In other words, genes Figure 12 It exists only in *Mycobacterium avium* and is highly conserved, while it is absent or varies greatly in other species of the Mycobacteriumceae family. Based on this, this study will... MAA44156_RS03465 Defined as a highly specific coding gene for Mycobacterium avium, it possesses excellent characteristics as a molecular identification target for this species.

[0192] Example 6: Validation of species specificity for detection using specific primer combinations

[0193] Based on as shown in SEQ ID NO. 2 MAA44156_RS03465 Specific PCR primers were designed using Primer Premier (version 5.0) for sequences near the coding region of the gene. The sequences involved are as follows:

[0194] Forward primer F: 5'-TCGGCTATGAAACCACGGAT-3' (SEQ ID NO. 10);

[0195] Reverse primer R: 5'-CGGCTAAGCAAGGCAACTCG-3' (SEQ ID NO. 11).

[0196] Sequences near the coding region (including primers, primer sequences are underlined, coding region sequences are bolded): MAA44156_RS03465 TCGGCTATGAAACCACGGAT (SEQ ID NO.12).

[0197] Extraction including Mycobacterium avium CGAGTTGCCTTGCTTAGCCG T Total DNA of the tested strains, including those from the *Mycobacterium tuberculosis* strains. Other non-tuberculous mycobacterial standard strains were collected from clinical hospitals, and 16S RNA gene sequencing, alignment, and NCBI sequence submission have been completed. The tested strains are shown in Table 2.

[0198] Table 2. Selected relevant strains

[0199]

[0200] DNA fragments from each strain were amplified and subjected to polymerase chain reaction (PCR) using the aforementioned F / R primers.

[0201] The PCR system (25 μL) consisted of dd H2O (9.5 μL), 2X Taq PCR MasterMix (TIANGEN, 12.5 μL), primer F (10 μM, 1 μL), primer R (10 μM, 1 μL), and DNA template (1 μL).

[0202] Amplification program: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 1 min, 58℃ annealing for 45 s, 72℃ extension for 90 s, for a total of 35 cycles, followed by a 72℃ extension for 10 min.

[0203] The amplification products were detected by electrophoresis in 1.2% agarose gel and 1×TBE electrophoresis buffer. The results are as follows: DSM 44156 As shown, it can be seen that:

[0204] Specific amplification: The expected location (1,420 bp) of the positive control for Mycobacterium avium showed a clear and bright specific amplification band.

[0205] Negative results: No amplification bands were detected in any of the other nontuberculous mycobacterial control standard strains.

[0206] Key identification: Of particular importance, the target band was not found in samples of intracellular mycobacteria that are closely related to Mycobacterium avium and are difficult to identify by conventional methods.

[0207] PCR results showed that the primer combination had high species specificity and could accurately distinguish between Mycobacterium avium and its closely related species (especially intracellular Mycobacterium), and the experimental results were completely consistent with expectations.

[0208] In addition to the complete genomes and annotated protein sequences of a total of 209 standard strains from the NCBI database mentioned above ( Figure 13 and Figure 11In addition to external data, 76 sets of Mycobacterium avium data that had completed high-quality genome sequencing were further downloaded from the NCBI database, including 9 bird subspecies ( Figure 12 ), 34 human-derived subspecies (M) Mycobacterium avium subsp. avium ), 32 paratuberculous subspecies ( Mycobacterium avium subsp. hominissuis Mycobacterium avium ), 1 forest subspecies ( subsp. paratuberculosis Then, sequence comparison was performed, and the experimental results are as follows: Mycobacterium avium subsp. silvaticum and Figure 14 As shown:

[0209] It can be seen Figure 15 MAA44156_RS03465 The gene was matched with homologous sequences only in the data of Mycobacterium avium subsp. avium and Mycobacterium avium forestii, and the sequences were completely identical. No homologous sequences were found in other Mycobacterium avium subsp. avium data, further demonstrating its specificity and high conservation. It can be used for the precise identification of Mycobacterium avium subsp. avium and Mycobacterium avium forestii with strains in other MAC complexes, and even other NTMs.

[0210] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention.

Claims

1. An antigenic peptide, characterized in that, The amino acid sequence of the antigenic peptide is shown in SEQ ID NO.

1.

2. A nucleic acid molecule that is isolated or synthesized, characterized in that, The isolated or synthesized nucleic acid molecule encodes the antigenic peptide of claim 1, and the nucleotide sequence of the isolated or synthesized nucleic acid molecule is shown in SEQ ID NO.

2.

3. A method for detecting Mycobacterium avium ( Mycobacterium avium The reagent kit is characterized by, The kit includes a detection reagent for detecting and / or identifying Mycobacterium avium in a sample, the detection reagent including the antigenic peptide of claim 1, a reagent for detecting the antigenic peptide of claim 1, or a reagent for detecting the isolated or synthesized nucleic acid molecule of claim 2.

4. The use of the antigenic peptide of claim 1, or the isolated or synthesized nucleic acid molecule of claim 2, in the preparation of a kit for detecting Mycobacterium avium.

5. The use of the antigenic peptide of claim 1, or the isolated or synthesized nucleic acid molecule of claim 2, in the preparation of a vaccine for the prevention and / or treatment of Mycobacterium avium infection.

6. A method for preparing antibodies, characterized in that, The method includes: The antibody was obtained by immunization with an antigenic peptide whose amino acid sequence is shown in SEQ ID NO.1, and the resulting product was purified.

Images