Car transduction enhanced h3k27m mutation neoantigen combination peptide vaccine dct and application
By designing high-affinity H3K27M neoantigen peptides with CAR or CAR-like structures, DCART cells were prepared, solving the problem of poor treatment efficacy for H3K27M mutant gliomas in existing technologies, and achieving highly efficient killing and enhanced immune reactivity against H3K27M mutant tumors.
Patent Information
- Application Number
- CN202610479720.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-13
- Publication Date
- 2026-07-10
AI Technical Summary
Existing tumor vaccines and CAR-T therapy technologies have limited effectiveness in treating H3K27M-mutant gliomas, with difficulty in achieving complete remission and high relapse rates, especially in pediatric DIPG patients. There is a need to develop more effective treatment methods.
A CAR-transduction-enhanced H3K27M neoantigen combination peptide vaccine was designed. By redesigning the H3K27M neoantigen peptide to have high affinity for the HLA-A0201 or HLA-B1501 sites, and combining it with a CAR or CAR-like structure, DCART cells were prepared, which have the killing activity of CAR-T and TCR-activated T cells, for the treatment of H3K27M positive gliomas.
It improved the killing effect on H3K27M mutant tumors and enhanced the therapeutic effect, especially against H3K27M+ DIPG and DMG, achieving higher tumor killing ability and immune reactivity.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the CAR transduction-enhanced H3K27M mutant neoantigen combination peptide vaccine DCT and its application. Background Technology
[0002] Diffuse midline glioma (DMG) is a type of high-grade glioma, grade III-IV. The World Health Organization recently proposed a new classification standard, listing DMG with the H3K27M mutation as a separate category. Cases in which the tumor occurs in the brainstem are called diffuse endophytic midline glioma (DIPG, commonly known as brainstem glioma).
[0003] The association of H3K27M mutations with the onset and prognosis differs between adults and children. H3K27M mutations appear in pediatric DMG and DIPG cases and seem to be more strongly associated with treatment refractory and poor prognosis. Approximately 80% of pediatric DIPG patients also have H3K27M mutations (H3.1 / H3.2 / H3.3).
[0004] In recent years, reports of using tumor vaccines and H3K27M neoantigen vaccines for treatment have become quite common. The applicability of H3K27M neoantigen is limited to patients with the HLA-A0201 allele; clinical research results of tumor cell vaccines or H3K27M neoantigen vaccines show that the vaccine approach is time-consuming (about six months) and requires multiple treatment cycles; currently, complete remission cannot be guaranteed.
[0005] Besides tumor vaccines, CAR-T therapy is another hot topic in novel treatment technologies. Common CAR-T targets include GD2, B7H3, IL13Ra2, and EGFRvIII. CAR-T therapy can provide rapid remission in a short period, with significant effects, but most clinical studies do not achieve complete remission. The relapse rate is high.
[0006] Therefore, it is particularly necessary to develop therapeutic drugs or improve treatment methods such as H3K27M-positive glioma neoantigen vaccines. Summary of the Invention
[0007] In view of this, the technical problem to be solved by the present invention is to provide a CAR transduction-enhanced H3K27M mutant neoantigen combination peptide vaccine DCT and its application.
[0008] This invention provides a DCART cell generated by stimulation with H3K27M neoantigen combination peptides to enhance cytotoxicity via CAR or CAR-like transduction. The DCART cell is obtained by co-culturing antigen-presenting cells (DCs) with T cells after loading them with H3K27M neoantigen combination peptides, followed by infection with a virus containing a CAR or CAR-like structure. The redesigned H3K27M neoantigen combinatorial peptide has high affinity for the HLA-A0201 or HLA-B1501 sites; The CAR structure is a CAR structure related to anti-glioma membrane antigen; The CAR-like structure is the CAR structure that does not include the CD3zeta chain.
[0009] In this invention, the H3K27M neoantigen peptide combination peptides include, but are not limited to, KQLATKAAAM and RMAPSTLGV. In a specific embodiment of this invention, the H3K27M neoantigen peptide combination peptides are KQLATKAAAM and RMAPSTLGV.
[0010] Furthermore, the DCART cells are used to treat gliomas with H3.1K27M, H3.2K27M, or H3.3K27M. The target of the DCART cells is an antigen associated with H3K27M-positive gliomas, including H3.1K27M, H3.2K27M, or H3.3K27M-positive gliomas. The target molecules of the CAR structure and / or CAR-like structure are selected from antigens associated with H3K27M positive gliomas, and the antigens are preferably, but not limited to, GD2, B7H3, IL13Rα2 and / or EGFRvIII.
[0011] The CAR structure and / or CAR-like structure includes, but is not limited to: extracellular binding region, transmembrane region and intracellular structural region; The extracellular binding region is selected from single-chain antibodies (scFv) and / or nanobodies or humanized modified antibodies; The CAR structure includes, but is not limited to: aB7H3-CD8TM-CD28-4-1BB-CD3zeta and / or aGD2-CD8TM-CD28-4-1BB-CD3zeta.
[0012] The CAR-like structure includes, but is not limited to: aB7H3-CD8TM-CD28-4-1BB-sIL15-IL2.
[0013] In this invention, the antigen-presenting cells are antigen-presenting dendritic cells.
[0014] In this invention, the DCART cells possess both CAR-T and TCR-activated T cell killing activity and mechanisms against selected tumor target cells.
[0015] The ratio of antigen-presenting cells to T cells treated with the H3K27M neoantigen combination peptide is 1:1 to 1:10.
[0016] The redesigned H3K27M neoantigen combination peptide was used to treat antigen-presenting cells at a concentration of 30 μg / mL; the concentration ratio of KQLATKAAAM and RMAPSTLGV was 1:1.
[0017] In this invention, the antigen-presenting cells treated with the H3K27M neoantigen combination peptide further include a recombinant adenovirus infection step before the H3K27M neoantigen combination peptide treatment. The recombinant adenovirus is HBAD-DCML, which is converted into Ad5 adenovirus HBAD-CMV-DCML. Its preparation method is described in CN 112646020 B.
[0018] The present invention provides an antigen peptide combination comprising: antigen peptide 1 (peptide sequence 1) and antigen peptide 2 (peptide sequence 2), wherein antigen peptide 1 has a higher affinity for HLA-B1501 and its amino acid sequence is shown in SEQ ID NO:1, and antigen peptide 2 has a higher affinity for HLA-A0201 and its amino acid sequence is shown in SEQ ID NO:2.
[0019] In this invention, the number of peptides in the antigen peptide combination can be increased, for example, by adding patient-specific neoantigen peptides and peptide fragment sequences of tumor-related antigens, etc., and this invention does not limit this.
[0020] This invention, through screening and optimization, ultimately obtained peptide sequences 1 and 2 with significantly enhanced affinity for HLA-B1501 and HLA-A0201 in the H3K27M mutation. The peptides used in existing literature are all mutant peptide prototypes. The A0201-related mutant peptide RMSAPATGGV (or RMSAPSTGGV, both with equivalent affinity) does not meet the criteria for a neoantigen peptide in the database, and is therefore "insufficient" to produce significant therapeutic effects. The optimized peptide RMAPSTLGV used in this invention, by altering two amino acid sites, increases affinity by more than 60-fold, meeting the criteria for a neoantigen peptide. Then, through combination optimization, the two optimized peptides can be combined to cover glioma patients with HLA-A0201 or B1501.
[0021] This invention provides formulations for the prevention and / or treatment of gliomas, comprising the antigen peptide combination described herein.
[0022] Furthermore, the tumor includes tumors caused by or associated with the H3K27M mutation.
[0023] Furthermore, this is especially true for tumors with the HLA-A0201 or HLA-B1501 phenotype in the H3K27M mutation.
[0024] The present invention provides antigen-presenting cells, which are obtained by treating DC cells with the antigen peptide combination described in the present invention and / or the formulation described in the present invention.
[0025] Furthermore, in this invention, the concentration ratio of antigenic peptide 1 to antigenic peptide 2 is 1:1; the concentration of each of antigenic peptide 1 and antigenic peptide 2 is 30 μg / mL.
[0026] Furthermore, the antigen-presenting cells are dendritic cells (mature DC cells).
[0027] The present invention provides activated effector T cells (DCTs) obtained by co-culturing antigen-presenting cells and T cells as described in the present invention.
[0028] Furthermore, the concentration ratio of antigen-presenting cells to T cells is 1:1 to 1:10.
[0029] This invention provides DCART cells, obtained by infecting the activated effector T cells (DCTs) described in this invention with CAR-like or CAR lentiviruses.
[0030] The CAR-like and / or CAR lentiviruses mentioned herein include, but are not limited to: aB7H3-CD8TM-CD28-4-1BB-CD3zeta, aB7H3-CD8TM-CD28-4-1BB-sIL15-IL2 and / or aGD2-CD8TM-CD28-4-1BB-CD3zeta.
[0031] This invention, through redesign, yielded polypeptide sequences with significantly enhanced affinity for H3K27M-B1501 and HLA-A0201 patients. The invention redesigned the H3K27M mutant neoantigen peptide to enhance and validate the affinity of the HLA-A0201 allele for H3K27M. HLA frequency distribution data indicate that some HLA-A0201 and HLA-B1501 are coexisting haploid combinations, present in a certain proportion of the patient population. It is reasonable to hypothesize that a combination vaccine using the H3K27M mutant neoantigen (HLA-0201 and HLA-B1501) would be effective not only for HLA-0201 or HLA-B1501 patients but also for individuals with both HLA-0201 and HLA-B1501 haploids, resulting in a stronger therapeutic effect.
[0032] Based on previous and existing results, this invention presents a redesigned antigen peptide combination, KQLATKAAAM (peptide sequence 1) and RMAPSTLGV (peptide sequence 2), designed to target the H3K27M mutation. In vitro studies have demonstrated that this combination provides definitive immunogenicity, responsiveness, and efficacy of a vaccine. This combination simultaneously covers patient subgroups with HLA-A0201 or HLA-B1501, as well as patients with HLA-A0201 and HLA-B501 haplotypes.
[0033] RMAPSTLGV has a different structure from the mutant peptide RMSAPATGGV in the literature, and its affinity is increased by 67 times.
[0034] This invention optimizes the H3K27M neoantigen DC vaccine and co-cultures DCT cells in vitro to obtain highly specific TCR-activated DCT cells. These cells are then infected with lentiviruses expressing different CAR structures to obtain a novel cytotoxic cell that possesses both CAR-T cytotoxic activity and vaccine-activated TCR-T cytotoxicity; this is termed DCT-CAR cells (DCART).
[0035] Active T cells prepared by loading DCs with antigenic peptides were infected with lentiviruses targeting the DIPG target aB7H3-CAR and aGD2-CAR, resulting in unique DCART cells: possessing both CAR-T cell activity (IFNG release) and vaccine responsiveness (ELISPOT) against the H3K27M neoantigen. This is equivalent to a fusion cell of two killing mechanisms, exhibiting enhanced killing effects.
[0036] Functionally, DCART is an enhanced neoantigen vaccine T cell or a new type of killer cell.
[0037] If the CD3zeta sequence is removed from a traditional CAR structure, creating a CAR-like structure, this combination can still retain some cytotoxic ability and also has the ability to expand DCART cells in vivo. Therefore, it can also lead to a high degree of expansion of active T cells in DCART cell vaccines in vivo, enhancing the efficacy of the vaccine. As shown, DCART cells fused with the CAR-like structure hardly increase IFNG secretion when stimulated by target cells, but still retain a certain degree of cytotoxic ability.
[0038] The H3K27M mutation is a major representative mutation in DIPG and DMG in children, highlighting the need for novel treatments. This invention redesigns the H3K27M mutant neoantigen peptide, obtaining a polypeptide sequence with significantly enhanced affinity for HLA-B1501 and HLA-A0201 in patient populations with H3K27M. This polypeptide was then used to treat dendritic cells (DCs), and DCs were mixed with T cells to obtain DCT cells. Furthermore, DCT cells were infected with a virus to obtain DCART cells. Experiments showed that, compared to DCT cells, the DCART cells exhibited better tumor-killing effects against tumors with the H3K27M mutation. + DIPG and DMG bring new treatment technologies. Attached Figure Description
[0039] Figure 1 The affinity of three optimized peptides for mutant and wild-type CACO2 cells coated with DCs after loading and stimulating DCs is shown. Figure 2 The figures show the visible light field screenshots of two groups of aB7H3-28BBZ CART cells; B1 and B2 show the green fluorescence of GFP expressed in the CAR structure cells after viral infection in two groups of cells; C1 shows the ability of aB7H3-28BBZ CAR-Jurcat cells to express mouse anti-B7H3 scFv fragment against extracellular free B7H3 antigen after binding to an appropriate amount of biotin-B7H3 antigen and then developing with streptavidin-PE; C2 shows the result of normal expression of mouse anti-B7H3 scFv sequence on the T cell membrane surface during the construction of aB7H3-CAR after binding to an appropriate amount of biotin-goat anti-mouse IgG and then developing with streptavidin-PE. Figure 3 This demonstrates the process flow of DCT and CAR-T cell preparations. Figure 4 The results of aCD3-FITC and goat anti-mouse IgG-PE assays were shown after DCT cells were infected with lentivirus aB7H3-28BB-s152. Figure 5 There was no significant difference in cell growth rate between aB7H3-28BBZ DCART and aB7H3-28B-s152 DCART. Figure 6 The positive rate of CAR or CAR-like structure expression in DCART cells showing CAR or CAR-like structures; Figure 7 This demonstrates the responsiveness of CAR or CAR-like DCART cells to H3K27M mutant HLA-A0201; Figure 8 This demonstrates the responsiveness of CAR or CAR-like DCART cells to H3K27M mutant HLA-B1501; Figure 9 The study showed the expression of DCART-targeted B7H3 antigens in tumor cells, including K562, A549, U87, NALM6, and D283 Med. Figure 10 The image shows the expression of DCART-targeted antigens in tumor cells, where A represents the GD2 positivity of D283 Med, B represents the GD2 positivity of A549, C represents the GD2 positivity of K452, and D represents the GD2 positivity of CACO2. Figure 11 The co-culture of aB7H3-28BB-s152 DCART cells and glioblastoma U87 cells showed a lack of ability to stimulate increased release of gamma interferon (IFN-γ or γIFN); Figure 12 The study showed that co-culturing aB7H3-28BBZ DCART cells with glioblastoma D283 Med stimulated the release of gamma interferon. Figure 13 The linear relationship between the lethality of aB7H3-28BBZ DCART at effective-to-target ratios of 2.5:1, 5:1, and 10:1 is shown. Figure 14 This demonstrates the destructive power of the aGD2-28BBZ DCART. Figure 15 The aB7H3-28BBZ DCART showed that the killing effect on target cells in the antigen peptide-coated group was higher than that in the uncoated peptide-coated target cell group. Figure 16 The aGD2-28BBZ (aGD2-CD8-28BBZ) DCART showed that it had a higher killing effect on target cells in the antigen peptide-coated group than on the uncoated peptide-coated target cells group. Figure 17 The aB7H3-28BB-s152 DCART showed that the killing effect on target cells in the antigen peptide-coated group was higher than that in the uncoated peptide-coated target cell group. Detailed Implementation
[0040] This invention provides a CAR-transduction enhanced H3K27M mutant neoantigen combination peptide vaccine DCT and its application. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to implement and apply the technology of this invention.
[0041] polypeptide sequence: Peptide sequence 1: KQLATKAAAM, SEQ ID NO:1; Peptide sequence 2: RMAPSTLGV, SEQ ID NO:2; Peptide sequence 3: RMSAPSTGGV, SEQ ID NO:3; Peptide sequence 4: MMAPSTLGV, SEQ ID NO:4; Peptide sequence 5: RKSAPATGGV, SEQ ID NO:5; Peptide sequence 6: RMSAPATGGV, SEQ ID NO: 6; Nucleic acid sequence Peptide sequence 7: KQLATKAARK (SEQ ID NO:10); Peptide sequence 8: KQLATKAARM (SEQ ID NO:11); This invention does not evaluate the best activity of a particular peptide, but rather uses optimized peptides with high activity to form a complex stimulus for individuals with HLA-A0201 or HLA-B1501.
[0042] The CACO2 cell line originates from human colon adenocarcinoma, and its HLA typing is fixed; it is an HLA-A2 restricted cell line, meaning that CACO2 cells themselves are HLA-A2 restricted cells. 02:01 Positive cells; In this invention, target cell CACO2 is equivalent to target cell CACO2 (HLA-A0201); β2 microglobulin originates from tumor cells. If the β2 microglobulin gene is knocked out in tumor cells, pMHCI will not be formed. When the coating peptide is co-cultured with cells of the corresponding allele phenotype, it will form a pMHCI complex with the MHC of the cell membrane and the β2 microglobulin secreted by the target cells.
[0043] Activated effector T cells are formed by co-culturing DC+T cells; coating homologous (HLA) cells with the corresponding peptide forms a reactive stimulus pMHCI, which can stimulate activated DCTs to release gamma interferon.
[0044] Nalm6 cells, or Nalm-6 (full name NALM-6 or NALM6), are a human B-lymphoblastic leukemia cell line that is an HLA-A0201 / B1501 double-positive haplotype.
[0045] D283 Med cell line, abbreviated as D283, is a human medulloblastoma cell line; A549 cells are the most commonly used human lung adenocarcinoma cell line; K562 cells are an important model for studying chronic myeloid leukemia, established by isolating cells from the pleural effusion of a 53-year-old female patient with chronic myeloid leukemia (CML) in the blast crisis; U-87 (or U87) is a human astrocytoma cell line.
[0046] When DCT cells are co-incubated with target cells coated with antigen peptides, assessing their affinity usually refers to detecting the strength of the interaction between T cells and target cells. This is often used in immunology to study antigen presentation efficiency, cell adhesion before T cell activation, etc.
[0047] aB7H3-28BBZ DCART is only effective against B7H3-targeted tumor cells and tumor cells expressing DC-loaded antigens.
[0048] aGD2-28BBZ DCART has a strong killing effect on D283 cells, and may have a small killing effect on other cells that weakly express GD2.
[0049] Generally, if the theoretical affinity (IC50 value) obtained is below 1000 nM (the smaller the IC50 value, the higher the affinity), or the ordination percentage is between 0.01 and 2.0, the mutant peptide can be considered to have the potential to stimulate the host immune system to produce immune resistance as an antigenic peptide.
[0050] H3K27M mutations are primarily found in diffuse midline gliomas (DMGs), which are the most typical and common tumor type with H3K27M mutations. It was officially defined as a separate subtype of glioma by the WHO in 2016. Regardless of histological morphology, any tumor located in a midline structure and carrying the H3K27M mutation is classified as this type, and its WHO grade is IV. It commonly occurs in the midline regions of the brain, including the pons (DIPG), thalamus, and spinal cord. Approximately 70%–90% of children with DIPGs and 50%–60% of high-grade gliomas in children carry this mutation; about 10% of gliomas in adults have the H3K27M mutation. Other rare tumors, such as ependymomas, pilocytic astrocytomas, gangliogliomas, and diffuse astrocytomas in children, may also show H3K27M mutations, but the prognosis for these tumors is significantly better than that for typical diffuse midline gliomas.
[0051] Figures 13-15 The comparison of cytotoxicity between uncoated and coated CAR-T cells showed that in the absence of CD3zeta, the cytotoxicity of CD3zeta-based CAR-T cells was reduced; however, it did not affect the cytotoxicity based on TCR activation.
[0052] Furthermore, the numerical ranges and parameters used to define this application are approximate values, and the relevant values in the specific embodiments have been presented as precisely as possible. However, any numerical value inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise explicitly stated, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately." Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.
[0053] The test materials used in this invention are all common commercially available products. The invention is further illustrated below with reference to embodiments: Example 1: Optimized peptide selection for H3K27M mutant HLA-A0201 Preparation of dendritic cells (DCs): Venous blood was collected from healthy individuals with the HLA-A0201 phenotype, peripheral blood mononuclear cells (PBMCs) were isolated and counted; the cells were adhered to a culture medium for 90 minutes; the adherent cells were cultured in serum-free medium containing 1000 units / mL GM-CSF and 500 units / mL IL-4 or 150 units / mL IL-15 as Day 1, and the medium was changed every two days.
[0054] T cell preparation: counting suspension T cells and cryopreservation.
[0055] On day 5, recombinant adenovirus adjuvant HBAD-DCML (i.e., Ad5 adenovirus HBAD-CMV-DCML, the preparation method of which can be found in CN 112646020 B) was added to infect DC cells; On day 6, sensitization was achieved by adding 30 μg / mL of the neoantigen peptide RMSAPSTGGV (peptide sequence 3, which is equivalent to peptide sequence 6 RMSAPATGGV), or RMAPSTLGV (peptide sequence 2) or MMAPSTLGV (peptide sequence 4). On day 7, add 50 ng / mL TNF. To allow DC to mature; Resuscitate and prepare cryopreserved suspension T cells and target cells CACO2 (HLA-A0201).
[0056] On day 8, DCs were collected and cultured in a DC:T ratio of 1:5 to activate effector T cells (DCT cells).
[0057] On day 9, target cells were cultured in CACO2 medium with either 15 μg / mL of wild-type peptide RKSAPATGGV (peptide sequence 5) or mutant peptide RMSAPATGGV (peptide sequence 6) added, and co-cultured for 16 hours. This resulted in the formation of a type I histocompatibility complex containing MHC I (HLA-A). 02:01+Wild-type peptide / mutant peptide+β2 microglobulin, pMHCI complex (pMHC requires the addition of a coating peptide to form) target cells.
[0058] On day 10, activated effector T cells and target cells were mixed at an effector-to-target ratio of 2:1 or 3:1 and seeded into 96-well microplates with polyvinylidene fluoride (PVDF) membranes coated with γ-interferon antibody at the bottom. The plates were then washed and subjected to peroxidase colorimetric reaction according to the requirements of the γ-interferon Elispot kit.
[0059] The experimental results are shown in Figure 1After loading and stimulating dendritic cells (DCs) with three optimized peptides, the DCT showed a higher affinity for HLA-A0201 for the mutant peptide RMSAPATGGV (peptide sequence 6) + MHC + β2 complex coated with CACO2 model cells than for the wild-type peptide RKSAPATGGV (peptide sequence 5) complex. The optimized peptide RMAPSTLGV (peptide sequence 2) showed the highest affinity and also exhibited stronger ELISPOT (solid-phase enzyme-linked immunospot) reactivity.
[0060] Predictive affinity analysis data obtained from the industry-recognized database NetMHC 4.0 is shown in the table below (NetMHC version 4.0, NetMHC 4.0-DTU Health Tech-Bioinformatic Services, https: / / services.healthtech.dtu.dk / services / NetMHC-4.0 / ):
[0061] Table 1. Comparison of affinity between H3K27M mutation and HLA-A0201-related wild-type peptides, mutant peptides, and optimized peptides.
[0062] Theoretical analysis shows that RMAPSTLGV has a more than tenfold higher affinity for HLA-A0201 than the mutant peptide RMSAPATGGV, reaching the theoretical value for a practical neoantigen and being the only usable neoantigen peptide sequence. Therefore, RMAPSTLGV (HLA-A0201) was selected as one of the H3K27M mutant neoantigen combination peptides and combined with the optimized peptide KQLATKAAAM (HLA-B1501, CN112646020B) to form a DC-loaded stimulating peptide.
[0063] Table 2. Comparison of affinity between H3K27M mutation and HLA-B1501-related wild-type peptides, mutant peptides, and optimized peptides.
[0064] Example 2 Lentiviral Packaging
[0065] The commercially available pLV3-EF1a-MCS-IRES-Puro or the modified pGWLV-EF1a-MCS-IRES-EGFP vector from Genewiz were used, with a three-plasmid packaging system (pLV3 main plasmid + psPAX2 + pMD2.G) (plasmid ratio 4:3:1, linear PEI transfection reagent MW40000). Lentiviral viruses were purified and concentrated by ultracentrifugation (105000 rpm, 90 min).
[0066] Table 3. Structure and types of CAR-expressing lentiviruses
[0067] Taking the GWLV-aB7H3-CD8TM-CD28-4-1BB-CD3zeta-GFP (provided by Genewiz) lentivirus as an example, the T-cell tumor cell line Jurcat was infected with GWLV-aB7H3-CD8TM-CD28-4-1BB-CD3zeta-GFP with MOI=100 to obtain aB7H3-28BBZ CART cells (aB7H3-28BBZ CAR-Jurcat cells).
[0068] Figure 2 Images A1 and A2 show visible light field screenshots of aB7H3-28BBZ CAR-Jurcat cells. Figure 2 B in the image shows the green fluorescence of GFP expressed in CAR structural cells after viral infection; Figure 2 C1 showed that aB7H3-28BBZ CAR-Jurcat cells bound to an appropriate amount of biotin-B7H3 antigen, and were then stained with streptavidin-PE to examine the ability of the membrane-expressed mouse anti-B7H3 scFv fragment to resist extracellular free B7H3 antigen. Figure 2 In C2, it was shown that aB7H3-28BBZ CAR-Jurcat cells were bound to an appropriate amount of biotin-goat anti-mouse IgG, and then developed with streptavidin-PE, which showed that the mouse anti-B7H3scFv sequence in the aB7H3-CAR construction was normally expressed on the surface of T cell membrane.
[0069] Example 3: DCT and CAR-T cell preparation process flow
[0070] I. Preparation of DCT cells
[0071] Fresh peripheral blood of HLA-A0201 and HLA-B1501 haploidentical individuals (peripheral blood from healthy individuals possessing both A0201 and B1501 haploidentical individuals, obtained from a hospital according to the ELISPOT (enzyme-linked immunospot) technique to be tested) or cryopreserved PBMCs were used. PBMCs obtained after lymphocyte separation were separated into suspension cells and adherent cells (monuclear and immature dendritic cells) by adhesion separation. These cells were then treated with GM-CSF (1000 units / mL) and IL-4 (500 units / mL). After 4 days of culture, on the fifth day, recombinant adenovirus adjuvant HBAD-DCML was added. On the sixth day, a mixed peptide solution loaded with the H3K27M mutant optimized neoantigen combination KQLATKAAAM (peptide sequence 1) and RMAPSTLGV (peptide sequence 2) was prepared, with a final concentration of 30 μg / mL (peptide sequence 1 to peptide sequence 2 concentration ratio of 1:1). On the seventh day, TNFα (50 ng / mL) was added to obtain mature DCs. On the eighth day, DCs were co-cultured with T cells (concentration ratio of 1:1) to obtain activated effector T cells (DCT).
[0072] II. Lentiviral Infection
[0073] On day 9, 1 million DCT cells were collected and infected with CAR or CAR-like lentiviruses expressed as shown in Table 3 of Example 2, followed by amplification and culture. From day 13 to day 15, the cells were enriched with magnetic beads and then analyzed. A schematic diagram of the process flow is shown below. Figure 3 .
[0074] 1. Results of DCT cells infected with aB7H3-28BB-s152 lentivirus
[0075] After DCT cells were infected with aB7H3-CD8TM-CD28-4-1BB-sIL15-IL2 (CAR-like, abbreviated as aB7H3-28BB-s152) lentivirus, they underwent 3-5 days of culture, amplification, sorting, enrichment, and flow cytometry analysis. Detection with aCD3-FITC and goat anti-mouse IgG-PE yielded approximately 80% or more CAR-like positive DCT-CAR cells (DCART). Figure 4 ).
[0076] Example 4 Comparison of DC-CAR-T and DC-CAR-like-T cells
[0077] I. Differences in cell growth and expression positivity rate
[0078] Lentiviral viruses aB7H3-CD8TM-CD28-4-1BB-CD3zeta (CAR, abbreviated as aB7H3-28BBZ), aB7H3-CD8TM-CD28-4-1BB-sIL15-IL2 (CAR-like, abbreviated as aB7H3-28BB-s152), and aGD2-CD8TM-CD28-4-1BB-CD3zeta (CAR, abbreviated as aGD2-28BBZ) were prepared (as shown in Table 3 of Example 2).
[0079] Peripheral blood from healthy individuals or cryopreserved PBMCs (HLA-A0201 / HLA-B1501) were collected. On the ninth day after co-culturing with DCT, 1 million DCT cells were infected with three different lentiviruses. DCT-CAR or DCT-CAR-like fusion cells (DCART) were obtained and cultured and expanded for 3-5 days.
[0080] There was no significant difference in the growth rate of aB7H3-28BBZ and aB7H3-28B-s152 DCART cells. Figure 5 The positive rate of CAR or CAR-like structure expression was not affected, even for different CAR targets (GD2). Figure 6 ).
[0081] II. Differences in the responsiveness of DCART cells
[0082] For H3K27M neoantigen combination peptide-activated DCT and novel DCART cells, the ELISPOT model cell was Nalm6, a tumor cell with HLA-A0201 / B1501 haploids; the coating antigen peptides were the mutant peptide prototypes: RMSAPATGGV (peptide sequence 6, equivalent to RMSAPSTGGV, HLA-A0201) and KQLATKAARM (peptide sequence 8, HLA-B1501), each at 15 μg / mL.
[0083] The results showed that, between aB7H3-28BBZ and aB7H3-28BBs152, the TCR (T cell receptor) activity of aB7H3-28BBs152 was slightly lower, but there was no significant difference. ELISPOT results demonstrated the effects of novel DCART cells on H3K27M mutant HLA-A0201 (…). Figure 7 ) and HLA-B1501 ( Figure 8 TCR responsiveness in the population. This responsiveness of novel DCART cells is significantly higher than that of DCT (…). Figure 7 ).
[0084] III. Expression of DCART-targeted antigens in tumor cells
[0085] To demonstrate that tumor cells express the DCART-targeted antigen, RT-qPCR was used for validation. Real-time quantitative PCR data analysis employed the 2-ΔΔCT method to analyze the relative expression levels of the gene. The internal reference gene β-actin was used as the normalized gene expression. Primer sequences: B7H3-F: cctggctttcgtgtgctgga (SEQ ID NO:12), B7H3-R: tgtttcagaggctgcagggc (SEQ ID NO:13); ACTINB-F: gagctacgagctgcctgacg (SEQ ID NO:14), ACTINB-R: tcattgtgctgggtgccagg (SEQ ID NO:15). Graphs were plotted using GraphPad Prism 5.0 (GraphPad Software, CA, USA) software (standard error n=3). Results showed that B7H3 was expressed in K562, A549, U87, NALM6, and D283 cells. Figure 9 ).
[0086] GD2 is a small glycoside molecule, and the D283 Med cell line was found to be GD2 positive in the literature. Appropriate amounts of D283 Med (A), A549 (B), K562 (C), and CACO2 (D) cells were collected at a density of 1.6E6 cells / mL. 5E5 cells were added to 1.5mL centrifuge tubes, followed by 1mL of flow cytometry buffer. The tubes were centrifuged at 1000rpm for 5min. The supernatant was discarded, and the cell pellet was resuspended in 50µL PBS. One tube was used as a blank sample, and the other as a sample with 2.5µL of GD2 antibody (Biolegend CAT357313). Flow cytometry analysis showed that D283 Med was strongly positive for GD2. Figure 10 These cells can be used as target cells for aGD2-28BBZ DCART function detection; A549, K452 and CACO2 cells all have weak GD2 expression and are not suitable as target cells for GD2-CAR-T or DCART.
[0087] IV. Differences in DCART Gamma Interferon Release Capacity
[0088] When aB7H3-28BBZ DCART cells and aB7H3-28BB-s152 DCART cells are co-cultured with tumor cells expressing B7H3, aB7H3-28BBZ DCART cells, as reported in the literature, release a certain amount of free gamma interferon; however, CAR-like aB7H3-28BB-s152 DCART cells with the CD3zeta sequence removed lack the ability to stimulate increased gamma interferon release (co-cultured with glioblastoma U87 cells). Figure 11 ). Figure 12 Co-culturing aB7H3-28BBZ with glioblastoma D283Med stimulated the release of gamma interferon.
[0089] When tumor cell lines K562 and A549 were co-cultured with aB7H3-28BBZ DCART cells at a ratio of 1:5, an increase in the release of free gamma interferon in the culture medium could be detected; while CAR-like aB7H3-28BB-s152 DCART cells with the CD3zeta sequence removed lacked the ability to increase the release of gamma interferon. Figure 11 and Figure 12 This suggests that the ability of CAR-T cells to release gamma interferon depends almost entirely on the presence of the CD3 zeta chain structure.
[0090] V. Differences in lethality
[0091] The cytotoxicity of DCART was assessed using CFSE labeling. K562 cells were covalently labeled with green fluorescent CFSE dye and co-cultured with DCART cells. Then, red permeable dye PI was added for secondary labeling of membrane-damaged or dead cells. Cells showing double-positive (red:green) results were identified using flow cytometry and defined as cells killed by DCART. aB7H3-28BBZ DCART showed a positively correlated cytotoxicity, exhibiting a linear relationship at effector-to-target ratios of 2.5:1, 5:1, and 10:1. Figure 13 Under the condition of equivalent target ratio of 5:1, the killing power of CAR-like aB7H3-28BB-s152 DCART cells was significantly lower than that of aB7H3-28BBZ DCART cells, indicating that the lack of CD3 zeta chain expression significantly reduced the killing power of DCART cells. Figure 14 However, the presence of CAR-like aB7H3-28BB-s152 DCART cells suggests that the killing power of DCART cells does not entirely depend on the activation of the CD3 zeta chain to kill tumor cells. Figure 14 This demonstrates the lethality of the aGD2-28BBZ DCART.
[0092] When target cells are coated with neoantigens, the killing ability of DCART is equal to the sum of the killing results of the two killing mechanisms, "CAR-T" and "TCR-T," which is significantly higher than that for uncoated target cells. Taking D283 Med target cells as an example, DCT cells prepared from HLA-A0201 peripheral blood were loaded with H3K27M combined antigens, and then DCART cells were prepared by infecting them with CAR aB7H3-28BBZ, CAR aGD2-28BBZ, or CAR-like aB7H3-28BB-s152 virus, respectively. After CFSE labeling, the inoculated D283 Med target cells were divided into three groups: A: uncoated antigen peptides; B: coated peptide FQAYVMASV; and C: coated peptide RMSAPATGGV. Figure 15 The results showed that aB7H3-28BBZ DCART had a higher killing effect on target cells in the antigen peptide-coated group than on target cells in the uncoated peptide-coated group. Figure 16 The aGD2-28BBZ DCART showed higher cytotoxicity against target cells coated with the antigen peptide than against those without. This enhanced cytotoxicity represents the TCR-T killing mechanism and is unrelated to the CD3zeta killing mechanism in classic CAR-T. The aB7H3-28BB-s152 DCART, with its CAR-like structure, showed similar levels of "CAR-T" and enhanced "TCR-T" cytotoxicity. Figure 17 These results indicate that DC-T cells prepared using a combination of H3K27M mutant neoantigens can enhance their killing effect on target cells by introducing CAR or CAR-like structures (without the CD3 zeta chain). Theoretically, the presence of CAR or CAR-like structures could allow DC-T cells to expand in vivo, further enhancing their killing ability or therapeutic efficacy. Removal of the CD3 zeta chain may significantly reduce adverse reactions in CAR-T cells, requiring further investigation.
[0093] Summary of the invention: This invention discloses a technical method for preparing dendritic cells (DCs) by loading them with a novel antigen combination peptide optimized by the H3K27M mutation, and then co-culturing them with T cells to obtain antigen-specific activated T cells (DCTs). The DCTs are then infected with lentiviruses such as aB7H3-28BBZ to ultimately obtain a novel cytotoxic cell type, aB7H3-28BBZ DCART. These cells simultaneously recognize the tumor cell H3K27M mutant peptide pMHC and the membrane antigen B7H3, and simultaneously possess CAR-T cell activity, cytotoxicity, and the ability to activate TCRs.
[0094] The H3K27M mutation neoantigen combination includes two different sequences with affinity for HLA-A0201 and HLA-B1501. The aB7H3-28BBZ DCART prepared by loading these antigens can cover H3K27M mutation-positive DMG patients expressing different HLA alleles. The DCT prepared by loading the H3K27M mutation neoantigen combination can be transduced with other different but glioma-related CARs such as aGD2-CAR, aIL3Ra2-CAR, and aEGFR vIII-CAR to obtain DCARTs with different fusions.
[0095] In DCART technology, the CD3zeta chain in the classic CAR structure can be removed to prepare CAR-like DCART cells, such as aB7H3-28BB-s152 DCART. aB7H3-28BB-s152 DCART lacks the ability of classic CAR cells to secrete and release gamma interferon upon stimulation, but retains lower cytotoxicity. This characteristic may be helpful in studying how to delay DCART cell exhaustion, prolong the duration of DCART cell action, or reduce side effects, and warrants further investigation.
[0096] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. DCART cells, characterized in that, DCT cells were obtained by co-culturing antigen-presenting cells (DCs) with T cells after loading H3K27M neoantigen combination peptides with antigen-presenting cells, and then infected with viruses containing CAR or CAR-like structures. The H3K27M neoantigen combination peptide has a high affinity for the HLA-A0201 or HLA-B1501 sites; The CAR structure is a CAR structure related to anti-glioma membrane antigen; The CAR-like structure is the CAR structure that does not include the CD3zeta chain.
2. The DCART cell according to claim 1, characterized in that, The H3K27M neoantigen peptide combination peptides include, but are not limited to, KQLATKAAAM and RMAPSTLGV.
3. The DCART cell according to claims 1 and 2, characterized in that, The DCART cells are used to treat gliomas with H3.1K27M, H3.2K27M, or H3.3K27M.
4. The DCART cell according to claim 1, characterized in that, The target molecules of the CAR structure and / or CAR-like structure are selected from antigens associated with H3K27M positive gliomas, including but not limited to GD2, B7H3, IL13Rα2 and / or EGFRvIII.
5. The DCART cell according to claim 1, characterized in that, The CAR structure and / or CAR-like structure includes: an extracellular binding region, a transmembrane region, and an intracellular structural region; The extracellular binding region is selected from single-chain antibodies (scFv) and / or nanobodies.
6. The DCART cell according to claim 5, characterized in that, The CAR structure includes, but is not limited to: aB7H3-CD8TM-CD28-4-1BB-CD3zeta and / or aGD2-CD8TM-CD28-4-1BB-CD3zeta.
7. The DCART cell according to claim 5, characterized in that, The CAR-like structure includes, but is not limited to: aB7H3-CD8TM-CD28-4-1BB-sIL15-IL2.
8. The DCART cell according to claim 6 or 7, characterized in that, The DCART cells possess both CAR-T and TCR-activated T cell killing activity and mechanisms against selected tumor target cells.
9. The DCART cell according to claims 2 and 3, characterized in that, The H3K27M neoantigen peptide combination includes, but is not limited to, personalized antigens for H3K27M-positive glioma patients and glioma-associated antigens.
Citation Information
Patent Citations
Antigenic peptides based on histone H3 K27M mutant peptide and their applications
CN112646020B