Preparation method and application of biopesticide nanostructure based on RNA tetrahedron self-assembly

Abstract

The application discloses an RNA tetrahedron which is formed by four RNA chains through base complementary pairing self-assembly, and the four RNA chains are obtained by in vitro transcription of DNA templates with sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 respectively. The application further discloses a method for preparing the RNA tetrahedron. The application further discloses a tetrahedron-dsRNA complex. The application further discloses application of the RNA tetrahedron and the tetrahedron-dsRNA complex in preparation of a biological pesticide for preventing and treating brown planthoppers. The application further discloses a biological pesticide for preventing and treating brown planthoppers. The application constructs an RNA tetrahedron and a tetrahedron-dsRNA complex delivery system, significantly improves stability and delivery efficiency, and has a strong prevention and treatment effect on brown planthoppers.

Description

Technical Field

[0001] This invention belongs to the field of biopesticide technology, specifically relating to a method for preparing and applying biopesticide nanostructures based on RNA tetrahedral self-assembly. Background Technology

[0002] Brown planthopper ( Nilaparvata lugens Rice slug is a major piercing-sucking pest in rice production. Its adults and nymphs gather at the base of rice plants and continuously suck sap, causing nutrient loss and stunted growth. In severe cases, it can cause large-scale "slug burn," leading to lodging and death of rice plants. Yield losses in a single season can reach 20% to 50%, or even total crop failure. At the same time, this pest is also a key vector for viral diseases such as rice straw dwarf disease, further exacerbating grain production losses.

[0003] The control of brown planthoppers currently faces multiple prominent challenges. First, brown planthoppers have an extremely high reproductive capacity, with multiple generations occurring annually under suitable conditions, and their populations can grow exponentially in a short period. Second, their migratory and dispersal capabilities are significant, enabling them to migrate long distances with the help of air currents, easily triggering large-scale regional outbreaks. Third, resistance to pesticides develops rapidly, with high levels of resistance already prevalent to commonly used insecticides such as organophosphates, carbamates, and neonicotinoids, leading to a continuous decline in the effectiveness of chemical control. Current chemical control strategies not only struggle to effectively address these challenges but also cause a series of problems such as pesticide residues, environmental pollution, and ecological imbalance. Therefore, there is an urgent need to develop new, highly efficient, targeted, and environmentally compatible control technologies for agricultural production.

[0004] Double-stranded RNA (dsRNA) targeting key genes of the brown planthopper, developed based on the principle of RNA interference (RNAi), is an emerging class of RNA biopesticides, providing a new approach for green and precise control of brown planthoppers. However, in practical field applications, the core active ingredient, naked dsRNA, faces two major technical bottlenecks: first, it exhibits poor stability in complex field environments, is easily degraded by nucleases, and cannot maintain effective activity; second, it struggles to penetrate cell membranes autonomously, resulting in low cellular uptake efficiency and significantly weakened RNAi effects with a short duration of action. These defects severely impact the field control efficacy of RNA biopesticides, becoming a core issue restricting their commercial application.

[0005] To address the technological bottlenecks in dsRNA delivery, nucleic acid nanomaterials are considered ideal delivery carriers, with DNA tetrahedra being the most widely studied and typical representative of this type of material due to their structural characteristics. However, when used as a dsRNA delivery carrier, this material still has significant limitations. It cannot directly encode and carry biologically active dsRNA in the backbone, requiring a complex loading process to achieve dsRNA loading, which is cumbersome and inefficient. At the same time, the B-type DNA helix, which depends on DNA tetrahedra, contains approximately 10.5 non-integer nucleotides per turn. When constructing more complex macroscopic nanostructures, it is prone to deviations in extension angle and orientation control problems, making it difficult to achieve controllable self-assembly of larger-sized nanostructures.

[0006] Existing RNA tetrahedral synthesis technologies generally employ a "single-strand transcription + self-folding" model. This model suffers from inefficient and random folding, and is prone to mismatches and aggregation during the folding process. This results in low RNA tetrahedral yield and poor purity, failing to meet the needs of system scale-up and industrial production, and making it difficult to effectively apply to dsRNA delivery and actual agricultural production.

[0007] In summary, current technologies for controlling brown planthoppers have many shortcomings. The core component of RNA biopesticides, dsRNA, faces dual bottlenecks in delivery and stability. Existing nucleic acid nanocarriers have application limitations, and the synthesis technology of RNA tetrahedra also has key defects. There is an urgent need to develop more suitable dsRNA delivery systems and corresponding preparation technologies to overcome the application difficulties of existing RNA biopesticides and achieve efficient and green control of brown planthoppers. Summary of the Invention

[0008] The purpose of this invention is to overcome the problems of poor stability of naked dsRNA in existing RNA biopesticides, easy degradation by nucleases, low cellular uptake efficiency, and the inability of existing DNA tetrahedral vectors to directly encode and carry active dsRNA, as well as the low folding efficiency and low yield of traditional RNA tetrahedral synthesis technology. Therefore, this invention provides a method for preparing and applying RNA tetrahedrons based on in vitro transcriptional self-assembly and their complexes with dsRNA as a nanodelivery system for biopesticides.

[0009] To achieve the above objectives, in a first aspect, the present invention provides an RNA tetrahedron, which is formed by the self-assembly of four RNA strands through complementary base pairing, wherein the four RNA strands are obtained by in vitro transcription using DNA templates with sequences as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, respectively. The sequences shown in SEQ ID NO:1~4 contain RNA interference target sequences that target the troponin T gene of brown planthopper.

[0010] A second aspect of the present invention provides a method for preparing RNA tetrahedrons as described above, comprising the following steps: S1. Provide four DNA template strands, the sequences of which are shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 respectively; S2. Using the DNA template strand obtained in step S1 as a template, in vitro transcription was performed to obtain four RNA single strands. S3. Mix the four RNA single strands obtained in step S2, and perform high-temperature melting and low-temperature annealing in Tm buffer to self-assemble into RNA tetrahedrons.

[0011] According to a preferred embodiment of the present invention, the high-temperature dechaining is performed at 95°C for 5 minutes, and the low-temperature annealing is performed at 25°C for 30 minutes.

[0012] A third aspect of the invention provides a tetrahedral dsRNA complex comprising RNA tetrahedra as described above.

[0013] According to a preferred embodiment of the present invention, the tetrahedral-dsRNA complex further includes double-stranded RNA, which is linked to the terminal cantilever of the RNA tetrahedron through complementary base pairing.

[0014] Preferably, the double-stranded RNA is a double-stranded RNA that targets the V-type proton ATPase subunit B1 gene of the brown planthopper; The sense strand sequence of the double-stranded RNA is shown in SEQ ID NO:6, and the antisense strand sequence is shown in SEQ ID NO:7.

[0015] A fourth aspect of the present invention provides the application of the RNA tetrahedron described above in the preparation of a biopesticide for controlling brown planthoppers.

[0016] A fifth aspect of the present invention provides the application of the tetrahedral-dsRNA complex as described above in the preparation of a biopesticide for controlling brown planthoppers.

[0017] In a sixth aspect, the present invention provides a biological pesticide for controlling brown planthoppers, comprising RNA tetrahedrons as described above.

[0018] A seventh aspect of the present invention provides a biological pesticide for controlling brown planthoppers, comprising the tetrahedral-dsRNA complex as described above.

[0019] The beneficial effects of this invention are as follows: 1. This invention synthesizes RNA tetrahedrons through in vitro transcription, directly encoding dsRNA sequences targeting key genes in brown planthoppers into the RNA tetrahedral backbone, thus achieving the integrated construction of nucleic acid pesticide active ingredients and nanocarriers. This RNA tetrahedron exhibits significantly superior stability compared to linear dsRNA, demonstrating stronger resistance to degradation under extreme conditions of pH 3.0–12.0. Furthermore, its delivery efficiency in rice stem tissue is approximately 40 times higher than that of linear dsRNA, effectively solving the core bottleneck of naked dsRNA's easy inactivation and difficult delivery in complex field environments.

[0020] 2. This invention further constructs a tetrahedral-dsRNA complex delivery system, utilizing the three-dimensional spatial structure of RNA tetrahedra to provide physical protection for dsRNA, and achieving precise ligation and synergistic delivery of multiple dsRNA molecules through terminal cantilevers. Indoor bioassay experiments show that this complex is significantly more effective against brown planthoppers than the single component, reducing the survival rate to 20.6% after 8 days of treatment, a significant improvement compared to the single RNA tetrahedral group (42.4%) and the single dsRNA group (61.3%). This provides important technical support for the development of efficient and environmentally friendly next-generation nucleic acid pesticides. Attached Figure Description

[0021] Figure 1 This is a tetrahedral structure image taken by a field emission electron microscope in Example 3; Figure 2 The results are from the pH stability test in Example 4; Figure 3 This is a comparison diagram of the effects of RNA tetrahedral and dsRNA microinjection in Example 6; Figure 4 This is a comparison chart of the bioassay results for RNA tetrahedron and dsRNA in Example 7; Figure 5 This is a comparison chart of gene knockdown effects in Example 8; Figure 6 This is a schematic diagram of the synthesis of the tetrahedral-dsRNA complex in Example 9; Figure 7 This is a comparison chart of the bioassay results of the tetrahedral-dsRNA complex and dsRNA in Example 10. Detailed Implementation

[0022] The present invention will be described in detail below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0023] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are all available through conventional commercial channels.

[0024] Example 1: Design of RNAi target fragments and RNA tetrahedral template strands In this embodiment, six 77 bp target fragments were designed for the troponin T gene (TnT), a target gene of brown planthopper RNA interference. The six target fragments were combined into four strands of an RNA tetrahedron, and a 462 bp dsRNA target sequence composed of the six 77 bp target fragments was used as a control group.

[0025] The four DNA template sequences of the RNA tetrahedron are as follows.

[0026] 1) Strand 1 (its DNA template sequence is shown in SEQ ID NO:1). SEQ ID The specific sequence of NO:1 is as follows: ACTTGAACATGACCTCAGCTCAAATGGAAAGGAACAAGACTAAGGAGCAGCTGGAGGAGGAGAAGAAGATCTCTCTGAAAGGTCATACGACGACAAGAAGAAGCTCTTCGAAG GTGGATACATTGAGCAGACGAAAGAAACCATGGAGAAGGTCTGGAAAAACGCAAGAAGCAAGAGGAGGAGCGCAGAGTGAAGGAGATCGAAGAGAAGAAACAGAGAGACATGGAAGAGAAAAGA.

[0027] 2) Strand 2 (its DNA template sequence is shown in SEQ ID NO:2). The specific sequence of SEQ ID NO:2 is as follows: AGTACGATCTGGAGGAACGCCAGAAGAGGCAGGACTACGATCTCAAAGAATTGAAAGAAAGACAAAAGCAGCAGCTGAAACCAGACCTTCTCCATGGTTTCTTTCGTTCTGCTCAATGTATCCACCTTCGAAGAGCTTCTTCTTGTCGTCGTATGACCAAAAAGAGGAAGTGAAGAAGGATGACGAAGTAGAGGAACCAGTCTTCGAAGCCGAAGAGGAAGAGGAGGAGGAGGCCGAG.

[0028] 3) Strand 3 (its DNA template sequence is shown in SEQ ID NO:3). The specific sequence of SEQ ID NO:3 is as follows: CAGCTGCTGCTTTTGTCTTCTTCAATTCTTTGAGATCGTAGTCCTGCCTCTTCTGGCGTTCCTCCAGATCGTACTAAAAAGAGTACATCGCCGAATGGCGCAAACAGAGGTCAAAGGAGGAGGATGATCTCAAAAAGCTCAAGGAGAAACAGGCCAAATCTTTTCTCTTCCATGTCTCTCTGTTTCTTCTCTTCGATCTCCTTCACTCTGCGCTCCTCCTCTTGCTTCTTGCGTT.

[0029] 4) Strand 4 (its DNA template sequence is shown in SEQ ID NO:4). The specific sequence of SEQ ID NO:4 is as follows: CAGAGAGATCTTCTTCCTCCTCCAGCTGCTCCTTAGTCTTGTTCCTTTCCATTTGAGCTGAGGTCATGTTCAAGTAAAGGCCTGTTTCTCCTTGAGCTTTTTGAGATCATCCTCCTCCTTTGACCTCTGTTTGCGCCATTCGGCGATGTACTCTTAAACTCGGCCTCCTCCTCCTCTTCCTTCGGCTTCGAAGACTGGTTCCTCTACTTCGTCATCCTTCTTCACTTCCTCTT.

[0030] The control group's TnT target sequence (its sequence is shown in SEQ ID NO:5). The specific sequence of SEQ ID NO:5 is as follows: ACTTGAACATGACCTCAGCTCAAATGGAAAGGAACAAGACTAAGGAGCAGCTGGAGGAGGAGAAGAAGATCTCTCTGGGTCATACGACGACAAGAAGAAGCTCTTCGAAGGTGGATACATTGAGCAGACGAAAGAAACCATGGAGAAGGTCTGGAACGCAAGAAGCAAGAGGAGGAGCGCAGAGTGAAGGAGATCGAAGAGAAGAAACAGAGAGACATGGAAGAGAAAAGA AGTACGATCTGGAGGAACGCCAGAAGAGGCAGGACTACGATCTCAAAGAATTGAAAGAAAGACAAAAGCAGCAGCTGAAGAGGAAGTGAAGAAGGATGACGAAGTAGAGGAACCAGTCTTCGAAGCCGAAGAGGAAGAGGAGGAGGAGGCCGAGAAGAGTACATCGCCGAATGGCGCAAACAGAGGTCAAAGGAGGAGGATGATCTCAAAAAGCTCAAGGAGAAACAGGCC.

[0031] Example 2: In vitro transcription synthesis of RNA tetrahedral structure Based on the four DNA template sequences (SEQ ID NO: 1~4) provided in Example 1, a T7 promoter sequence 5'-TAATACGACTCACTATAGG-3' was inserted at the 5' end of each sequence, and EcoRI restriction enzyme sites were introduced at both ends of the sequences. The four modified sequences were then entrusted to Sangon Biotech (Shanghai) Co., Ltd. for whole-genome synthesis using the pUC57 vector to construct four template plasmids for in vitro transcription.

[0032] Table 1 Enzyme digestion reaction system

[0033] The four plasmids were digested with enzymes, and the reaction systems are shown in Table 1. After digestion, the products were recovered by gel extraction to obtain digested products 1, 2, 3, and 4. Simultaneously, in vitro transcription was performed using the four digested products as templates (the specific in vitro transcription reaction systems are shown in Table 2).

[0034] Table 2 In vitro transcription reaction system

[0035] Eight hours after the in vitro transcription reaction, 10 μL of DNase I was added to digest the DNA template. After reacting at 37°C for 1 hour, 10 μL of proteinase K was added to hydrolyze T7 RNA polymerase and DNase I, and the reaction was carried out at 56°C for 0.5 hours. The reaction solution was centrifuged at 12,000 rpm for 3 minutes, and the supernatant was added to a 30 kDa ultrafiltration tube for ultrafiltration to remove proteinase K and ions and other impurities, obtaining RNA tetrahedra and their polymers.

[0036] To promote the correct folding of RNA tetrahedral structure, the target RNA tetrahedron was obtained by high-temperature melting at 95°C for 5 min and low-temperature annealing at 25°C for 30 min under Tm buffer conditions.

[0037] Example 3: Electron micrograph of RNA tetrahedron In this embodiment, the tetrahedrons prepared in Example 2 were diluted with DEPC water to 400 ng / μL. The native conformation of the tetrahedrons was preserved using a cryo-sampling technique, and high-resolution microstructures were obtained using field emission electron microscopy (FET). After starting the FET and adjusting the parameters, the amorphous ice region was located, the target structure was focused, and images were captured. The RNA tetrahedron structure captured by the electron microscope is shown below. Figure 1 As shown, each side of this RNA tetrahedron consists of 77 base pairs, with a theoretically calculated side length of approximately 20 nm. Electron microscopy images clearly show that a single RNA tetrahedron exhibits a typical equilateral triangular projection shape. Combined with a scale bar measurement, its side length is approximately 20 nm. The measured result highly matches the theoretical design value, confirming the precise assembly of the tetrahedral structure.

[0038] Example 4: pH stability experiment The digestion of food in most insects (such as Lepidoptera, Diptera, and Hemiptera) takes place mainly in the midgut. The pH range of the insect midgut is relatively large (4.5~11.0). Different pH environments can directly affect the stability and activity of nucleic acid molecules, and thus affect the efficacy of drugs.

[0039] This embodiment analyzes and compares the pH stability of tetrahedral and dsRNA molecules.

[0040] Prepare citrate-sodium citrate buffer (pH 3.0), Tris-HCl buffer (pH 7.5), and Na₂HPO₄-NaOH buffer (pH 12.0). Dilute nucleic acid samples to a final concentration of 200 ng / μL with each buffer, while adding an RNase inhibitor (final concentration 0.5 U / μL) to eliminate nuclease interference. Incubate all samples at 37°C to simulate room temperature storage conditions. Take samples at 1h, 2h, 4h, and 8h of incubation. Store at 20℃ to prevent possible degradation. After sample collection, perform agarose gel electrophoresis to analyze the degradation of nucleic acid molecules.

[0041] Figure 2 The results show the pH stability of RNA tetrahedrons and dsRNA. After 8 hours of treatment at pH 7.5, both RNA tetrahedrons and dsRNA maintained good stability, with no degradation or diffusion of electrophoretic bands. Under acidic conditions at pH 3.0, RNA tetrahedrons showed partial degradation after 1 hour of treatment, and the diffusion of the bands gradually increased with prolonged treatment time (2 hours, 4 hours, 8 hours), but clear characteristic bands were still observable until 8 hours, indicating incomplete degradation. Correspondingly, the dsRNA group showed significant degradation after 1 hour of treatment, with a significant decrease in the brightness of the characteristic bands, and almost complete degradation into small nucleic acid fragments by 8 hours. Under strongly alkaline conditions at pH 12.0, RNA tetrahedrons degraded faster than under acidic conditions; the bands began to degrade and diffuse after 1 hour of treatment, and the target bands were completely degraded into small fragments by 8 hours. Under these conditions, the stability of dsRNA was much lower than that of RNA tetrahedrons; the target bands were almost completely degraded after only 1 hour of treatment, and the nucleic acid fragments generated by degradation became further fragmented with prolonged treatment time. By comparing the stability differences under different pH conditions, the study fully verified that RNA tetrahedrons have a more prominent structural stability advantage than linear dsRNAs, providing a new direction for the development of novel insect control agents based on RNA interference.

[0042] Example 5: Detection of exogenous RNA content in rice stems and leaves To compare the delivery efficiency of tetrahedral RNA and linear dsRNA in rice, rice roots were soaked in a 350 ng / μL tetrahedral RNA / linear dsRNA solution for 1 hour. Then, samples were taken from the stems and leaves that had not been exposed to the solution, and total RNA was extracted using the TRIzol method. The total RNA samples were treated with ribonuclease T1 (37°C, 30 min) to hydrolyze single-stranded RNA, retaining double-stranded RNA. The samples were then treated with proteinase K at 56°C for 30 min to hydrolyze ribonuclease T1. Next, the samples were treated at 95°C for 10 min to dissolve the double-stranded RNA and then immediately placed on ice to maintain the single-stranded state. Using the treated RNA samples as templates, cDNA was obtained by reverse transcription using the HiScript IV RT SuperMix for qPCR (+gDNA wiper) reverse transcription kit. The reaction system is shown in Table 3.

[0043] The specific reaction conditions were: incubation at 50℃ for 15 minutes, followed by treatment at 85℃ for 5 seconds. Quantitative polymerase chain reaction (qPCR) was then performed. The reaction system and conditions are shown in Tables 4 and 5, respectively.

[0044] Table 3 Reverse transcription system

[0045] Table 4 qPCR reaction system

[0046] Table 5 qPCR reaction conditions

[0047] Table 6. Ratio of exogenous RNA content in rice stems and leaves

[0048] The results are shown in Table 6. The ratio of RNA tetrahedron to straight-chain dsRNA in rice stems was as high as 41.8, indicating that it has a much better stability and delivery efficiency than straight-chain dsRNA in plants, especially in stem tissues with well-developed vascular systems. The ratio reached 6.7 in rice leaves, further indicating that RNA tetrahedron has better distribution and retention capabilities in different plant tissues.

[0049] Example 6: Comparison of Microinjection Effects This embodiment compares the control effects of tetrahedral RNA and linear dsRNA. GFP (green fluorescent protein) dsRNA was used as a non-target control. dsRNA was introduced into brown planthoppers via microinjection, and the survival rate was statistically analyzed to compare the effects of the two methods.

[0050] Third-instar brown planthopper nymphs were selected, and 100 nL of dsRNA at a concentration of 200 ng / μL was injected into the area between the bases of the second pair of legs. To eliminate mechanical damage, surviving brown planthoppers were selected three hours after injection and placed in glass test tubes containing rice seedlings. The test tubes were then placed in an artificial climate chamber with a daytime temperature of 28℃, a nighttime temperature of 22℃, a light duration of 16 hours / day, and a relative humidity of 75%-80%. Observations and statistics were collected regularly.

[0051] Figure 3 The image shows a comparison of the effects of RNA tetrahedral and dsRNA microinjection, as shown in the figure. Figure 3As shown, after microinjection, the dsRNA treatment group had a faster onset of action, and the survival rate decreased at a faster rate than the RNA tetrahedron group 3 days after treatment. With prolonged treatment, the RNA tetrahedron group showed a better sustained effect: by day 5, the survival rates of the two groups were similar (RNA tetrahedron group 34.3% vs. dsRNA group 37.0%); from day 5 to day 8, the survival rate of the RNA tetrahedron group continued to decrease more rapidly than that of the dsRNA group, eventually dropping to 9.4%, significantly lower than the dsRNA group (22.2%). The GFP control group maintained a survival rate of 80% throughout, significantly higher than all treatment groups.

[0052] In summary, while RNA tetrahedrons have a relatively slow onset of action in microinjection experiments, they exhibit superior persistence and can exert a sustained preventive and therapeutic effect, ultimately demonstrating a more thorough lethal effect than straight-chain dsRNA. This proves their clear advantage in prolonging the RNAi action cycle.

[0053] Example 7: Indoor Bioassay Experiment This embodiment uses a micro-quantitative spray device for indoor biological testing. The roots of four-leaf stage rice seedlings were wrapped with moist cotton balls and inoculated into 50 mL glass test tubes. Third-instar brown planthopper nymphs of uniform developmental stage were selected as test insects, with 10 nymphs in each tube, and three replicates for each treatment. RNA tetrahedrons and target dsRNA were prepared at 1000 ng / μL using DEPC water, and 500 μL was sprayed into each tube. GFP dsRNA treatment served as the control group. The treated test tubes were immediately transferred to an artificial climate chamber, with temperature, light, and other conditions set as above. Survival and phenotypic changes were observed and recorded regularly. Two days after treatment, three brown planthoppers were collected per group, with three groups for each treatment, for gene knockdown level determination.

[0054] Figure 4 The results of the comparison between RNA tetrahedral and dsRNA bioassays are as follows: Figure 4 As shown, three days after spraying, there were significant differences in the survival rate of brown planthoppers among the experimental groups. By the eighth day after treatment, the RNA tetrahedron treatment group showed the best control effect, with the survival rate decreasing to 29.0%; the survival rate of the straight-chain dsRNA treatment group was 61.3%, while the survival rate of the control group remained at 83.3%. The significant differences among the groups indicate that, under spraying conditions, RNA tetrahedrons have a better control effect than straight-chain dsRNAs. This result confirms that RNA tetrahedrons, as a highly efficient delivery system, can effectively promote the absorption of active ingredients by brown planthoppers through plant tissues, thereby maximizing their biological activity and achieving better field control potential.

[0055] Example 8: Comparison of gene knockdown effects In this embodiment, total RNA was extracted from brown planthopper samples using the Trizol method, and cDNA was synthesized by reverse transcription according to the reaction system shown in Table 3. The synthesized cDNA was diluted 6-fold and then subjected to qPCR, with the reaction system and parameter settings as shown in Tables 4 and 5.

[0056] Figure 5 For comparison results of gene knockdown effects, such as Figure 5 As shown, both RNA tetrahedrons and straight-chain dsRNAs effectively knocked down target gene expression, with their relative expression levels decreasing to 34.2% and 58.3% of the control group, respectively. The gene silencing effect was more significant in the RNA tetrahedron treatment group, confirming its stronger gene silencing efficiency as a delivery vector.

[0057] Example 9: Design of Tetrahedral-dsRNA Complex Nucleic acid pesticides are usually linear dsRNA molecules. Their spatial structure increases the resistance to crossing the cell membrane, resulting in low intracellular delivery efficiency. In addition, linear molecules are prone to aggregation in complex environments, which further limits the efficacy of the pesticide.

[0058] This embodiment designs a delivery system based on the RNA tetrahedron framework. Figure 6 This is a schematic diagram of the synthesis of the tetrahedral-dsRNA complex in Example 9, combined with... Figure 6 This system employs a tetrahedral design with four terminal cantilevers of nucleic acid strands, precisely linking them to four dsRNA molecules via base complementarity to construct a tetrahedral-dsRNA complex delivery system. In this design, the tetrahedron reduces the aggregation of linear dsRNA molecules through frame charge regulation and steric hindrance, increasing delivery efficiency. Furthermore, the stable three-dimensional structure of the tetrahedron provides physical protection for the dsRNA, preventing its hydrolysis by nucleases. Additionally, the four dsRNA molecules can be designed to target different sites of the same target gene or different signaling pathways for synergistic regulation, enhancing gene silencing effects and improving overall drug efficacy.

[0059] The four dsRNA molecules in this embodiment have the same sequence and are derived from the brown planthopper target V-type protonATPase subunit B1. Their dsRNA sequences are as follows.

[0060] Justice Chain (its sequence is shown in SEQ ID NO:6). The specific sequence of SEQ ID NO:6 is as follows: AGGCUGGUCUUGUCAAACUGCCAGGAAAGUCAGUUCUCGAUGACUCUGAGGACAACUUUGCUAUUGUAUUCGCAGCCAUGGGAGUCAACAUGGAAACUGCUCGAUUCUUCAAACAGGAUUUCGAGGAGAAUGGUUCUAUGGAGAACGUGU.

[0061] Antisense chain (its sequence is shown in SEQ ID NO:7). The specific sequence of SEQ ID NO:7 is as follows: ACACGUUCUCCAUAGAACCAUUCUCCUCGAAAUCCUGUUUGAAGAAUCGAGCAGUUUCCAUGUUGACUCCCAUGGCUGCGAAUACAAUAGCAAAGUUGUCCUCAGAGUCAUCGAGAACUGACUUUCCUGGCAGUUUGACAAGACCAGCCU.

[0062] Example 10: Indoor Bioassay of Tetrahedral-dsRNA Complex In this embodiment, to evaluate the efficacy of the tetrahedral-dsRNA complex, an indoor bioassay experiment was conducted using a spray method. The tetrahedral-dsRNA complex and dsRNA were prepared at concentrations of 1000 ng / μL and 500 μL, respectively, for quantitative spraying. Other experimental conditions were the same as in Example 6, and nymphal survival was observed and recorded periodically.

[0063] Figure 7 Bioassay results showed that the survival rates of the groups were similar two days after treatment, with no significant efficacy observed. By day 3, a clear differentiation in survival rates emerged among the groups, with the tetrahedral-dsRNA treatment group exhibiting the best insecticidal effect. After 8 days of treatment, the survival rate of brown planthoppers in the tetrahedral-dsRNA treatment group was only 20.6%; the survival rates of the RNA tetrahedral treatment group and the dsRNA treatment group were 42.4% and 61.3%, respectively; while the survival rate of the control group remained at 90%. These results fully demonstrate that the constructed tetrahedral-dsRNA complex can effectively enhance the insecticidal effect, significantly superior to single-component treatments. This finding not only verifies the design rationality of the RNA tetrahedral delivery system but also provides important technical ideas and experimental evidence for the development of a new generation of highly efficient nucleic acid pesticides.

[0064] The above description is merely a preferred embodiment for explaining the present invention and is not intended to limit the present invention in any way. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included within the scope of protection intended by the present invention.

Claims

1. An RNA tetrahedron, characterized in that, The RNA tetrahedron is formed by the self-assembly of four RNA strands through complementary base pairing. The four RNA strands are obtained by in vitro transcription using DNA templates with sequences as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, respectively. The sequences shown in SEQ ID NO:1~4 contain RNA interference target sequences that target the troponin T gene of brown planthopper.

2. A method for preparing the RNA tetrahedron of claim 1, characterized in that, Includes the following steps: S1. Provide four DNA template strands, the sequences of which are shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 respectively; S2. Using the DNA template strand obtained in step S1 as a template, in vitro transcription was performed to obtain four RNA single strands. S3. Mix the four RNA single strands obtained in step S2, and perform high-temperature melting and low-temperature annealing in Tm buffer to self-assemble into RNA tetrahedrons.

3. The method according to claim 2, characterized in that, The high-temperature depolymerization is performed at 95°C for 5 minutes, and the low-temperature annealing is performed at 25°C for 30 minutes.

4. A tetrahedral dsRNA complex, characterized in that, It includes the RNA tetrahedron as described in claim 1.

5. The tetrahedral-dsRNA complex according to claim 4, characterized in that, The tetrahedral-dsRNA complex also includes double-stranded RNA, which is linked to the RNA tetrahedron via base complementary pairing through a terminal cantilever.

6. The tetrahedral-dsRNA complex according to claim 5, characterized in that, The double-stranded RNA is a double-stranded RNA that targets the V-type proton ATPase subunit B1 gene of the brown planthopper. The sense strand sequence of the double-stranded RNA is shown in SEQ ID NO:6, and the antisense strand sequence is shown in SEQ ID NO:

7.

7. The application of the RNA tetrahedron according to claim 1 in the preparation of a biological pesticide for controlling brown planthoppers.

8. The use of the tetrahedral-dsRNA complex according to any one of claims 4 to 6 in the preparation of a biopesticide for controlling brown planthoppers.

9. A biological pesticide for controlling brown planthoppers, characterized in that, It includes the RNA tetrahedron as described in claim 1.

10. A biological pesticide for controlling brown planthoppers, characterized in that, It comprises the tetrahedral-dsRNA complex according to any one of claims 4 to 6.

Images