Construction and application of ecorep-based continuous directed evolution reporter system for aminoacyl-trna synthetases
By combining a monofluorescent and fluorescent-chloramphenicol acetyltransferase dual reporter module in an E. coli orthogonal replication system with an in vivo continuous directed evolution system for aminoacyl-tRNA synthetase, the problems of long evolution time and false positives in yeast systems were solved, and rapid and efficient screening of aminoacyl-tRNA synthetase mutants was achieved.
Patent Information
- Application Number
- CN202610438419.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-03
- Publication Date
- 2026-07-10
AI Technical Summary
In the prior art, the evolution of aminoacyl-tRNA synthase based on dual-fluorescent reporter systems in yeast is a lengthy process, resulting in excessively long evolution time. Furthermore, the fluorescent reporter system is susceptible to non-specific incorporation of natural amino acids, leading to false positive results.
Based on the E. coli orthogonal replication system, an in vivo continuous directed evolution system for aminoacyl-tRNA synthetase was constructed. Combining a single fluorescent reporter module and a fluorescent-chloramphenicol acetyltransferase dual reporter module, efficient screening was achieved through flow cytometry sorting, and directed selection was enhanced by utilizing chloramphenicol survival pressure.
It significantly shortens the evolutionary cycle of aminoacyl-tRNA synthetase, improves screening accuracy, obtains highly specific and highly active aminoacyl-tRNA synthetase mutants, and reduces false positive results.
Smart Images

Figure CN122357589A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic code expansion and protein engineering technology, specifically relating to an in vivo continuous directed evolution reporter system for aminoacyl-tRNA synthetase (aaRS) based on the Escherichia coli orthogonal replication system (EcORep). Background Technology
[0002] Genetic Code Expansion (GCE) is a technique that uses exogenous aminoacyl-tRNA synthetase / tRNA orthogonal pairs to insert non-natural amino acids into target proteins in vivo. Non-natural amino acids containing different side-chain modification groups can provide novel chemical and physical properties, breaking the previous limitation of 20 natural amino acids and thus expanding protein function. This technology has wide applications in protein engineering, drug development, biomaterials, and other biotechnology fields.
[0003] The implementation of genetic code extension technology requires the following components:
[0004] Non-canonical amino acids (ncAA): These are amino acids that are artificially designed and synthesized, possessing special functional groups, which can endow proteins with new functions, in contrast to natural amino acids.
[0005] Stop codon: In genetic code expansion techniques, a stop codon that does not encode any standard amino acid (such as the amber stop codon TAG) is typically used as the coding codon for non-natural amino acids. The stop codon can be introduced into a specific site on a target protein using point mutation techniques to encode non-natural amino acids.
[0006] Orthogonal translation systems, also known as orthogonal aminoacyl-tRNA synthetases (aaRS) / tRNA pairs, are a set of translation tools that can function independently in the host organism. They consist of an aminoacyl-tRNA synthetase that recognizes non-natural amino acids and a paired tRNA. This system utilizes the amber stop codon (TAG) to specifically recognize and transfer non-natural amino acids to the paired tRNA, then inserts the non-natural amino acid into the protein. Orthogonal translation systems do not cross-react with endogenous aminoacyl-tRNA synthetases / tRNAs, thus ensuring that no natural amino acid is inserted and that the host cell's endogenous protein synthesis process is not interfered with. A common orthogonal translation system that has been developed and applied is the Methanococcus jannaschii tyrosine tRNA synthetase / tyrosine tRNA pair (MjTyrRS / tRNA). Tyr) and the pyrrolidone aminoacyl-tRNA synthetase / tRNA pair (Mb / MmPylRS / tRNA) of the methanogenic archaea Methanosarcina barkeri / Methanosarcina mazei Pyl )wait.
[0007] The key to realizing genetic codon expansion technology lies in the directed evolution of aminoacyl-tRNA synthases that can specifically recognize specific non-natural amino acids. Therefore, it is crucial to develop reporter systems capable of recognizing directed-evolved aminoacyl-tRNA synthases. Summary of the Invention
[0008] In the prior art, an evolutionary strategy for aminoacyl-tRNA synthetase based on a dual-fluorescent reporter system has been successfully developed in yeast. However, the long doubling time in yeast results in a lengthy evolutionary cycle for aminoacyl-tRNA synthetase. Therefore, this invention develops an in vivo continuous directed evolution system for aminoacyl-tRNA synthetase based on the E. coli orthogonal replication system. This system integrates a single-fluorescent reporter module and a fluorescent-chloramphenicol acetyltransferase dual-reporter module, effectively addressing the aforementioned technical shortcomings.
[0009] Specifically, the core of the technical solution of the present invention is as follows: In an environment where non-natural amino acids are present, aminoacyl-tRNA synthetase with non-natural amino acid-specific recognition activity can embed non-natural amino acids into fluorescent protein sites containing amber stop codons (TAG) in the reporter module, driving the fluorescent protein to fold completely and express; based on this, cells carrying positive aminoacyl-tRNA synthetase can be accurately sorted by flow cytometry.
[0010] Furthermore, the fluorescent-chloramphenicol acetyltransferase dual reporter module in the system, by applying survival pressure through chloramphenicol, can enhance the directional selection effect during evolution, effectively alleviating the problem of evolutionary disorder caused by relying solely on the fluorescent reporter system, further shortening the evolutionary cycle and improving screening accuracy. The implementation of this invention provides a novel *E. coli* adaptation platform for the efficient directional evolution of aminoacyl-tRNA synthases.
[0011] Specifically, this invention relates to the following technical solutions:
[0012] On one hand, the present invention provides an in vivo continuous evolution reporter system for aminoacyl-tRNA synthetase based on an E. coli orthogonal replication system, the reporter system comprising:
[0013] sfGFP, a green fluorescent protein mutant containing the amber stop codon TAG N150TAG The green fluorescent protein mutant sfGFP N150TAG It is also connected to an arabinose operon;
[0014] A linear replicon containing aminoacyl-tRNA synthetase, wherein the linear replicon is also linked to a first resistance gene;
[0015] A reporter plasmid containing a positive transmissive DNA polymerase is used to continuously mutate the linear replicon to generate an in vivo aminoacyl-tRNA synthetase mutant library, wherein the positive transmissive DNA polymerase is also linked to a rhamnose operon.
[0016] tRNA, which is orthogonal to aminoacyl-tRNA synthetase, to achieve the insertion of non-natural amino acids and complete protein expression;
[0017] A second resistance gene, which is different from the first resistance gene, is used to enhance resistance pressure screening.
[0018] In some embodiments, the green fluorescent protein mutant sfGFP N150TAG The nucleotide sequence is shown in SEQ ID No. 2.
[0019] In some embodiments, the nucleotide sequence of the positive-transfer error DNA polymerase is shown in SEQ ID No. 1.
[0020] In some embodiments, the nucleotide sequence of the linear replicon is shown in SEQ ID No. 8.
[0021] In some embodiments, the nucleotide sequence of the tRNA is shown in SEQ ID No. 3.
[0022] In some implementations, the tRNA is constitutively expressed.
[0023] In some implementations, the linear replicon is also connected to a promoter as shown in SEQ ID No. 6.
[0024] In some embodiments, the first resistance gene and the second resistance gene are independently selected from ampicillin resistance genes, chloramphenicol resistance genes, kanamycin resistance genes, neomycin resistance genes, rifampin resistance genes, hygromycin resistance genes, streptomycin resistance genes, and tetracycline resistance genes.
[0025] In some embodiments, the first resistance gene is a kanamycin resistance gene, and optionally, the nucleotide sequence of the kanamycin resistance gene is shown in SEQ ID No. 15.
[0026] In some embodiments, the second resistance gene is a tetracycline resistance gene, optionally with the nucleotide sequence shown in SEQ ID No. 4.
[0027] In some embodiments, the nucleotide sequence of the rhamnose operon is shown in SEQ ID No. 10.
[0028] In some embodiments, the reporting system further includes the chloramphenicol acetyltransferase mutant CAT containing the amber stop codon TAG. D112TAG .
[0029] In some embodiments, the chloramphenicol acetyltransferase mutant CAT D112TAG It is a constitutive expression.
[0030] In some embodiments, the chloramphenicol acetyltransferase mutant CAT D112TAG The nucleotide sequence is shown in SEQ ID No. 14.
[0031] On the other hand, the present invention provides the application of the report system described above in screening aminoacyl-tRNA synthetase mutants that specifically recognize non-natural amino acids.
[0032] On the other hand, the present invention provides the application of the reporting system described above in genetic code expansion technology.
[0033] On the other hand, the present invention provides the application of the reporter system described above in the preparation of a kit for directed evolution of aminoacyl-tRNA synthetase.
[0034] On the other hand, the present invention provides a method for directed evolution of aminoacyl-tRNA synthetase, the method being performed using the reporter system described above.
[0035] In some implementations, the construction of the aminoacyl-tRNA synthetase mutant library requires multiple passages under rhamnose induction, in which case there is no need to add arabinose.
[0036] In some implementations, the number of generations is 0-100, 0-70, or 0-40, preferably 30 generations.
[0037] In some implementations, the reporting system is used in conjunction with flow cytometry cell sorting.
[0038] In some implementations, the cells used for flow cytometry sorting are obtained by arabinose induction, at which point there is no need to add rhamnose.
[0039] In some implementations, chloramphenicol is added before flow cytometry sorting for stress screening.
[0040] In some embodiments, the dosage of chloramphenicol is 0-50 µg / ml, 0-45 µg / ml, 0-40 µg / ml or 0-30 µg / ml, preferably 30 µg / ml.
[0041] In some implementations, the treatment time for chloramphenicol is 0-20 hours, 0-19 hours, 0-18 hours, 0-17 hours, 0-16 hours, 0-15 hours, 0-14 hours, 0-13 hours, 0-12 hours, 0-11 hours, or 0-10 hours, preferably 10 hours.
[0042] In some implementations, the chloramphenicol is applied every 0-20 generations.
[0043] On the other hand, the present invention provides a method for constructing the report system as described above, which includes constructing a single fluorescent reporter module and a single fluorescent-chloramphenicol acetyltransferase dual reporter module system by PCR and Gibson assembly.
[0044] On the other hand, the present invention provides aminoacyl-tRNA synthetase mutants, which are obtained by screening using the reporter system described above.
[0045] On the other hand, the present invention provides an aminoacyl-tRNA synthetase mutant, the nucleotide sequence of which is shown in SEQ ID No. 17 and SEQ ID No. 18.
[0046] Beneficial effects
[0047] This invention constructs an in vivo continuous evolution platform for aminoacyl-tRNA synthetase based on the *E. coli* orthogonal replication system. Compared to the yeast orthogonal replication system, *E. coli* has a shorter doubling time, significantly shortening the evolutionary cycle. Simultaneously, this invention introduces chloramphenicol acetyltransferase (CAT) into the fluorescent reporter system, constructing an sfGFP-CAT dual reporter system. Under suitable chloramphenicol selection pressure, cells containing aminoacyl-tRNA synthetase capable of efficiently recognizing non-natural amino acids can survive, forcing the aminoacyl-tRNA synthetase to evolve towards specifically recognizing target non-natural amino acids and embedding the non-natural amino acid at the CAT112 site to achieve its functional expression, thereby conferring chloramphenicol resistance to the cells. Furthermore, fluorescence-based flow cytometry analysis can effectively remove non-aminoacyl-tRNA synthetase-dependent false positive clones generated under chloramphenicol selection pressure. The combined use of the two reporter systems can significantly shorten the time to obtain positive mutants and increase the probability of obtaining positive mutants. In summary, the in vivo continuous evolution of aminoacyl-tRNA synthetase based on the E. coli orthogonal replication system utilizes E. coli with a short doubling time, and enhances the directionality of aminoacyl-tRNA synthetase evolution through fluorescence and chloramphenicol acetyltransferase reporter elements. This invention enables the efficient acquisition of highly specific and highly active aminoacyl-tRNA synthetase mutants in a shorter time. Attached Figure Description
[0048] Figure 1 This is an overview diagram of the evolutionary hierarchy of aminoacyl-tRNA synthases mediated by a single fluorescent reporter system based on the E. coli orthogonal replication system (EcORep).
[0049] Figure 2 This is a bar graph showing the fluorescence intensity of sfGFP in a single fluorescent reporter plasmid in the presence of MbPylRS (Methanococcus barkeri pyrrolysyl-tRNA synthetase) and BocK (Nε-tert-butoxycarbonyl-L-lysine). The horizontal axis represents the presence or absence of BocK, and the vertical axis represents the relationship between fluorescence intensity and OD. 600 The ratio of . Among them Figure 2 a: MbPylRS exists on circular plasmids, and sfGFP in single fluorescent reporter plasmids in the presence of 2 mM BocK. N150TAG The expression status was obtained from n = 3 biological replicates, and the data were presented as mean ± SD. Figure 2 b: MbPylRS is present on linear replicons and sfGFP in single fluorescent reporter plasmids. 150TAG The expression of .
[0050] Figure 3 The images show flow cytometry fluorescence images of each of the 30 generations using MbPylRS (Y349W-V366G) as the initial evolutionary template, and plate fluorescence images of sorted single-clonal colonies (excitation wavelength 485 (±20) nm, emission wavelength 535 (±25) nm; BocK concentration 2 mM).
[0051] Figure 4 To verify and identify highly active MbPylRS mutants that can specifically recognize BocK. Figure 4 a: Figure 3 BocK-dependent fluorescence characterization of strong green fluorescent monoclonal cells from passage 100 on a plate; Figure 4 b: Amino acid sequence analysis of monoclonal aminoacyl-tRNA synthetases with BocK-dependent fluorescence enhancement properties; Figure 4 c: Figure 4 b. Fluorescence intensity bars for BocK recognition activity of different MbPylRS mutants, n = 3 biological replicates. Data are shown as mean ± SD. Excitation wavelength 485 (±20) nm, emission wavelength 535 (±25) nm. 4, 6, 7, and 22 represent different clones.
[0052] Figure 5 for Figure 4 sfGFP mediated by clones 6 and 7 N150BocK Mass spectrometry identification results of the protein, sfGFP N150BocKTheoretical molecular weight: 27,941 Da; actual observed molecular weights: 27,940 Da and 27,943 Da, respectively. Where 'a' represents clonal 6-mediated sfGFP. N150BocK Mass spectrometry identification results of the protein: b is clonal 7-mediated sfGFP. N150BocK Mass spectrometry identification results of the protein.
[0053] Figure 6 A schematic diagram illustrating the directed evolution of aminoacyl-tRNA synthase mediated by the E. coli orthogonal replication system (EcORep) fused with fluorescence and chloramphenicol acetyltransferase.
[0054] Figure 7 This study demonstrates the exploration of the optimal concentration and duration of action of chloramphenicol in evolutionary systems. Figure 7 a: Using MbPylRS as a positive control, screen the optimal concentration of Cm suitable for the continuous evolution system of MbPylRS (Y349W-V366G); Figure 7 b: Positive control group MbPylRS, at the optimal concentration of Cm, the cytotoxic effect on cells at different time gradients was detected (expressed as OD). 600 The bar chart reflects the bacterial concentration and corresponding fluorescence intensity, with the bar graph representing the bacterial OD. 600 The line graph represents fluorescence intensity; n = 3 biological replicates, and the data are presented as mean ± SD; Figure 7 c: Experimental group MbPylRS (Y349W-V366G), at the optimal concentration (Cm), the cytotoxic effect on cells at different time gradients was detected (expressed as OD). 600 The bar chart reflects the bacterial concentration and corresponding fluorescence intensity, with the bar graph representing the bacterial OD. 600 The line graph represents fluorescence intensity; n = 3 biological replicates, and the data are presented as mean ± SD.
[0055] Figure 8 Flow cytometry images of generation 0 and generation 30 using MbPylRS(Y349W-V366G) as the initial template for evolution, and plate fluorescence imaging of sorted single-clonal colonies (excitation wavelength 485 (±20) nm, emission wavelength 535 (±25) nm; BocK concentration 2 mM).
[0056] Figure 9 To verify and identify highly active MbPylRS mutants that can specifically recognize BocK. Figure 9 a: Figure 7 BocK-dependent fluorescence characterization of strong green fluorescent monoclonal cells from passage 30 cells on a plate; Figure 9 b: Amino acid sequence analysis of monoclonal aminoacyl-tRNA synthetases with BocK-dependent fluorescence enhancement properties; Figure 9 c: Figure 4 Fluorescence intensity bars for BocK recognition activity of different MbPylRS mutants in b, n = 3 biological replicates, data are shown as mean ± SD, excitation wavelength 485 (±20) nm, emission wavelength 535 (±25) nm.
[0057] Figure 10 for Figure 9 sfGFP mediated by clonal 2c and 8c N150BocK Mass spectrometry identification results of the protein, sfGFP N150BocK Theoretical molecular weight: 27,941 Da; actual observed molecular weights are 27,940 Da and 27,943 Da, respectively. Here, 'a' represents clonal 2c-mediated sfGFP. N150BocK Mass spectrometry identification results of the protein: b represents sfGFP mediated by clone 8c. N150BocK Mass spectrometry identification results of the protein. Detailed Implementation
[0058] The embodiments of this application will be clearly and completely described below. The technical solutions in the embodiments described below are exemplary and only possible technical implementations of this application, not all possible implementations. Those skilled in the art can combine the embodiments of this application to obtain other embodiments without creative effort, and these embodiments are also within the protection scope of this application.
[0059] In this invention, the term "orthogonal" refers to molecules (e.g., orthogonal tRNA (O-tRNA) and / or orthogonal aminoacyl-tRNA synthetase (O-RS)) that are used less efficiently by a target system (e.g., a translation system, such as a cell) or cannot function effectively with endogenous components of the cell. In the context of tRNA and aminoacyl-tRNA synthetase, orthogonal means that orthogonal tRNA and / or orthogonal RS are ineffective or less efficient in the target translation system, for example, less than 20%, less than 10%, less than 5%, or, for example, less than 1%. Orthogonal molecules lack functional endogenous complementary molecules in the cell. For example, the aminoacylation efficiency of any endogenous RS in the target translation system for orthogonal tRNA in the target translation system is reduced, or even zero, compared to the aminoacylation of endogenous tRNA by endogenous RS.
[0060] In this invention, the term "sfGFP" is an abbreviation for superfolded green fluorescent protein. N150TAG "This refers to the mutation of asparagine at position 150 of the superfolded green fluorescent protein gene into the amber stop codon."
[0061] In this invention, the term "replicon" refers to a basic unit in genetics that contains all the cis-acting elements necessary for the origin of DNA replication. A replicon is a DNA region capable of independently initiating and completing one replication process.
[0062] In this invention, the term "linear replicon" refers to a linear DNA molecule capable of autonomous replication.
[0063] In this invention, the term "error-prone DNA polymerase" refers to a class of polymerases that lack or do not possess proofreading function (3'→5' exonuclease activity), and therefore introduce errors (mutations) at a significantly higher frequency during DNA replication than high-fidelity DNA polymerases. These polymerases can be used to construct mutant libraries to achieve directed evolution of target substances. In this invention, error-prone DNA polymerases are used for the directed evolution of aminoacyl-tRNA synthetases.
[0064] In this invention, the term "overlap extension PCR" refers to a technique that uses primers with complementary ends to form overlapping strands in PCR, thereby splicing together amplification fragments from different sources through the extension of the overlapping strands in subsequent amplification.
[0065] When designing the directed evolution reporter system for aminoacyl-tRNA synthase, the inventors noted that the existing directed evolution methods for aminoacyl-tRNA synthase are mainly divided into two types: in vitro and in vivo evolution.
[0066] Directed evolution primarily involves increasing gene diversity to obtain mutant libraries, followed by multiple rounds of screening to acquire mutants with the target function. In vitro methods for increasing gene diversity are mainly based on polymerase chain reactions, such as saturation mutagenesis, error-prone PCR, and focused mutagenesis, to obtain mutant libraries. Screening methods for these in vitro mutant libraries include life-and-death pressure screening and fluorescence screening. Early screening systems were based on a positive and negative selection system using chloramphenicol acetyltransferase (CAT) and barnase toxicity proteins. Chloramphenicol acetyltransferase is a transferase (EC: 2.3.1.28) whose main function is to acetylate chloramphenicol, inactivating it and thus inducing chloramphenicol resistance in cells. Barnase is a ribonuclease (RNase) produced by Bacillus amyloliquefaciens, which degrades RNA in cells, leading to cell death. The positive and negative selection system first uses a chloramphenicol positive selection system to select aminoacyl-tRNA synthetase variants that can embed non-natural amino acids into proteins via TAG stop codons. Then, a Barnase negative selection system excludes aminoacyl-tRNA synthetase variants that embed natural amino acids but cannot specifically embed non-natural amino acids. Positive selection allows cells capable of embedding non-natural amino acids to survive and grow, while negative selection kills false-positive cells that embed conventional amino acids. Combining positive and negative selection ultimately yields aminoacyl-tRNA synthetase variants that specifically integrate non-natural amino acids into proteins.
[0067] Fluorescent screening utilizes fluorescent proteins as reporter systems. The core logic of a simple fluorescent reporter system is that when the inhibition effect of the amber stop codon (TAG) occurs, the system generates a detectable fluorescent signal, which is simple and intuitive. Among them, the single fluorescent protein reporter system is one of the most widely used technologies, and its fluorescence signal intensity is significantly positively correlated with the in vivo incorporation level of non-natural amino acids. However, this system is susceptible to fluctuations in intracellular plasmid copy number, and non-specific incorporation of natural amino acids may also lead to non-specific activation of the fluorescence signal, resulting in false positive results and increasing the workload of subsequent screening.
[0068] The dual-fluorescein reporter system, which has been developed in recent years, expresses two fluorescent proteins with different photophysical properties in tandem via a linker peptide, and introduces an amber stop codon into the linker peptide sequence. The signal of the N-terminal fluorescent protein reflects the total expression level of the reporter system, while the signal of the C-terminal fluorescent protein represents the effective yield of the full-length reporter protein. Based on this system, Barrick's team proposed two key quantitative indicators: relative read-through efficiency (RRE) and maximum misincorporation frequency (MMF), which are used to accurately assess the incorporation efficiency and incorporation fidelity of non-natural amino acids, respectively. These indicators also enable normalization correction for differences in reporter system expression levels (Reference: Monk, JW et al. Rapid and Inexpensive Evaluation of Nonstandard Amino Acid Incorporation in Escherichia coli. ACSsynthetic biology 6(1): 45-54(2017).).
[0069] It is worth noting that both single-fluorescent protein and dual-fluorescent protein reporter systems can be coupled with ELISA readers or flow cytometers to achieve high-throughput quantitative detection of target samples.
[0070] Dual reporter screening is based on the dual functions of green fluorescent protein (GFP) and chloramphenicol acetyltransferase. Only when non-natural amino acids are embedded in both GFP and chloramphenicol acetyltransferase, and in the presence of chloramphenicol, can cells resist chloramphenicol, survive, and emit green fluorescence. Dual reporter screening significantly reduces the toxicity of positive and negative screening, and the presence of green fluorescence can eliminate false positives caused by mutations in chloramphenicol acetyltransferase due to cell survival mechanisms.
[0071] However, in vitro evolution is both time-consuming and labor-intensive, limiting the depth (number of mutagenesis cycles) and scale (number of parallel experiments) of experiments. To address this challenge, in vivo directed evolution technology has emerged: it is a technical strategy that uses engineered modifications to the genetic replication system within organisms to precisely, continuously, and controllably mutate and screen target genes or genetic elements within living cells, in order to rapidly obtain mutants with the desired function (such as enhanced enzyme activity, specific alterations, etc.).
[0072] David Liu's research group (Reference: Miller, SM et al. Phage-assisted continuous and non-continuous evolution. Nat Protoc 15, 4101–4127 (2020).) designed a phage-assisted continuous evolution (PACE) system and a phage-assisted non-continuous evolution (PANCE) system to enable rapid laboratory evolution of aminoacyl-tRNA synthetase through hundreds of generations of mutation, selection, and replication. Using *E. coli* as the host, the target aminoacyl-tRNA synthetase gene is integrated into a gIII-deficient selector phage (SP). This is combined with a gIII-containing helper plasmid (AP) and a high-frequency mutant plasmid (MP). Through positive selection dependent on non-natural amino acids (activating pIII expression to promote phage proliferation) and negative selection eliminating naturally amino acid-dependent mutants, continuous mutation screening is performed to obtain highly active and specific aminoacyl-tRNA synthetase mutants. The core difference between PACE and PANCE lies in their culture and screening modes: PACE is a continuous flow culture with high evolution efficiency but requires complex equipment, making it suitable for deep evolution of highly active aminoacyl-tRNA synthases; PANCE is a batch subculture, which is simple to operate and can be run in parallel, but has a low evolution rate, making it suitable for preliminary screening of low-activity aminoacyl-tRNA synthases. The two are often used in a complementary manner.
[0073] In addition to the aforementioned phage-assisted evolution, in vivo evolution also includes the use of orthogonal replication systems to achieve targeted mutations and continuous evolution: orthogonal replication systems can be spatially or functionally separated from the host's own replication mechanism, mutating only the specific vector containing the target gene without affecting the stability of the host genome, and allowing the evolutionary process to continue without in vitro intervention, effectively alleviating the problems caused by in vitro evolution.
[0074] The Chang Liu research group at the University of California (reference: Furuhata, Y. et al. Directedevolution of aminoacyl-tRNA synthetases through in vivo hypermutation. NatCommun 16, 4832 (2025).) developed an orthogonal DNA replication system (OrthoRep) in Saccharomyces cerevisiae. The core components of this system include a cytoplasmic plasmid system based on Kluveromyces lactis, comprising orthogonally aligned linear double-stranded DNA plasmids (p1) and a DNA polymerase (TP-DNAP1). The 5' end of p1 is covalently linked to a terminal protein (TP), which acts as a protein primer to initiate the plasmid's own DNA replication. TP-DNAP1 is a polymerase specifically responsible for p1 replication, relying on the spatial separation between the cytoplasmic plasmid and the host nuclear genome and a unique replication mechanism, without interfering with the host's own genome replication process. High-mutation-rate variants (such as TP-DNAP1) can be obtained through site-directed mutagenesis to engineer TP-DNAP1. Y427A This variant can reduce replication fidelity, mediate high-frequency base substitution mutations in the target gene on p1, and the mutation rate is stable and controllable, ultimately achieving efficient directed evolution of the target gene in vivo.
[0075] Liu's research group (Reference: Furuhata, Y et al. Directed evolution of aminoacyl-tRNA synthetases through in vivo hypermutation. Nat Commun 16, 4832(2025)) developed a continuous evolution strategy for aminoacyl-tRNA synthetases using an orthogonal replication system (OrthoRep), aiming to expand the genetic code of *Saccharomyces cerevisiae*. This strategy started with the *Saccharomyces cerevisiae* strain LYSS4, which had the LEU2 and TRP1 genes knocked out, as the initial evolutionary strain. The target aminoacyl-tRNA synthetase gene was integrated into an orthogonal linear plasmid of the OrthoRep system. Simultaneously, the RXG ratio reporter gene (RFP and GFP linked by a linker peptide containing an amber stop codon) was used as the selection criterion, and a mutation rate of 10 was used. -5Each base substitution (spb) error-prone orthogonal DNA polymerase (epDNAP, such as BB-Tv) continuously amplifies the aminoacyl-tRNA synthetase gene in the orthogonal plasmid to drive its high-frequency mutation. The evolutionary process involves multiple rounds of screening using fluorescently activated cell sorting: when the target non-natural amino acid is present, the 0.05% of cells with the highest GFP / RFP ratio are selected (positive selection); when the non-natural amino acid is absent, the 5% of cells with the lowest GFP / RFP ratio are selected (negative selection, repeated every 2-3 rounds to exclude naturally amino acid-dependent mutants), ultimately enriching non-natural amino acid-specific aminoacyl-tRNA synthetase mutants. The core screening indicator is relative readability efficiency (RRE), which is the ratio of the GFP / RFP ratio of the RXG reporter gene to the ratio of the RYG reporter gene containing synonymous codons, thus precisely quantifying the dependence specificity and embedding efficiency of aminoacyl-tRNA synthetase on non-natural amino acids.
[0076] However, this system cannot be used for engineered bacterial genetic elements, as the doubling time of yeast makes it slower than bacterial systems. Therefore, Tian et al. (Reference: Rongzhen Tian et al. Establishing a synthetic orthogonal replication system enables accelerated evolution in E. coli. Science 383, 421-426 (2024)) established a stable orthogonal replication system (Escherichia coli Orthogonal Replication system, EcORep) in E. coli for continuous directed evolution in vivo. The core components of the orthogonal replication system include orthogonal linear double-stranded DNA and a DNA polymerase derived from PRD1 bacteriophage (a lytic Tectiviridae bacteriophage that infects E. coli). Its genome is linear double-stranded DNA with inverted terminal repeat sequences at both ends (specific binding sites for phage terminal proteins (TP), which also serve as replication origins), as well as the DNA polymerase responsible for linear DNA replication. Building upon this foundation, researchers constructed a controllable linear double-stranded DNA for evolution and inserted an orthogonal DNA polymerase (O-DNAP) into the host genome, thereby ensuring the cloning of the linear double-stranded DNA. Simultaneously, researchers evolved a high-mutation-rate orthogonal DNA polymerase based on the original orthogonal DNA polymerase for the mutation of linear DNA.
[0077] The orthogonal replicons of this system are not replicated by the host DNA polymerase, but are selectively replicated by an orthogonal DNA polymerase (O-DNAP) that does not replicate the genome. The high mutation rate of the orthogonal DNA polymerase can increase the mutation rate of the orthogonal replicons by 2-4 orders of magnitude. Using this system, a variant with a 1000-fold increase in intracellular GFP fluorescence was successfully evolved within 5 days. The *E. coli* orthogonal replication system provides a simple, stable, and scalable platform for the continuous directed evolution of *E. coli*, which will greatly accelerate the development of various research tools for the production of industrial chemicals, biopharmaceuticals, compounds, and strains. Therefore, this invention, based on the *E. coli* orthogonal replication system (EcORep), develops a directed evolution technology for aminoacyl-tRNA synthetase in *E. coli*, accelerating the development of genetic codon expansion technology.
[0078] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.
[0079] Unless otherwise specified, the experimental methods described in the following examples are standard experimental methods. All reagents, kits, and instruments used in the experiments can be purchased from biological instrument and reagent companies unless otherwise specified.
[0080] The main material sources in the following embodiments:
[0081] The evolutionary strains involved in the EcORep orthogonal replication system of E. coli, the linear replicon, and the error-prone DNA polymerase gene sequences were kindly provided by Professor Jason W. Chin of the Medical Research Council Laboratory for Molecular Biology, Cambridge, UK.
[0082] Example 1: Construction and Validation of Aminoacyl-tRNA Synthesizer Based on Single Fluorescence + FACS Evolutionary System
[0083] To establish an evolutionary system for aminoacyl-tRNA synthetase based on the E. coli orthogonal replication system (EcORep), the inventors first developed a single-fluorescence + flow cytometry sorting and screening system. The aminoacyl-tRNA synthetase to be evolved was constructed onto an orthogonal linear replicon, and the corresponding orthogonal error-prone DNA polymerase mutation rate was 10. -5 and using sfGFP N150TAG The plasmid was used as a reporter. After multiple passages, a mutant library of aminoacyl-tRNA synthetase was obtained. In the presence of non-natural amino acids, the positive aminoacyl-tRNA synthetase in the library could recognize the non-natural amino acids and insert them into sfGFP. N150TAGThis process enables the complete expression of sfGFP and its emission of green fluorescence, which can then be selected by flow cytometry. Conversely, cells containing aminoacyl-tRNA synthases that cannot recognize non-natural amino acids or contain embedded natural amino acids do not emit green fluorescence or have low fluorescence intensity and are discarded. This process represents the continuous in vivo evolution of aminoacyl-tRNA synthases that specifically recognize certain non-natural amino acids.
[0084] The principle of the reporting system is as follows Figure 1 As shown.
[0085] Reporting system components
[0086] The reporting system uses an evolved strain from the EcORep orthogonal replication system of *E. coli*. The strain used in this application is *Escherichia coli*, which is completely identical to the strain disclosed by Tian et al. (Rongzhen Tian et al. Establishing a synthetic orthogonal replication system enables accelerated evolution in *E. coli*. Science 383, 421-426 (2024)). This strain contains a genome-integrated synthetic replication operon composed of TP derived from bacteriophage PRD1, orthogonal DNA polymerase (O-DNAP), and SSB; it carries an orthogonal linear replicon with ITR sequences at both ends; and it can express the N71D / Y127A mutagenic O-DNAP to achieve directed evolution. This strain can be completely replicated by those skilled in the art based on the aforementioned literature, thus satisfying sufficient disclosure. International patent publication number for this strain: WO 2024 / 240906A1.
[0087] This system contains linear orthogonal replicons of the gene to be evolved, namely MbPylRS(Y349W-V366G)-Kan (SEQ ID No. 5); the fluorescent reporter plasmid includes the rhamnose operon (P rah Error-prone DNAP polymerase (i.e., O-DNAP) induced and regulated by SEQ ID No. 10 N71D SEQ ID No. 1), sfGFP regulated by the arabinose operon N150TAG (SEQ ID No. 2), constitutively expressed tRNA Pyl (SEQ ID No. 3) and the tetracycline resistance gene Tet R (SEQ ID No.4).
[0088] How to use the reporting system
[0089] The MbPylRS(Y349W-V366G)-Kan linear replicon (SEQ ID No. 5) and fluorescent reporter plasmid were co-transformed into the evolutionary strain and plated on LB solid medium (10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, and 20 g / L agar) containing kanamycin (50 μg / mL) and tetracycline (10 μg / mL). The next day, single colonies from the plates were picked and inoculated into 2YT medium (5 g / L sodium chloride, 17 g / L peptone, and 10 g / L yeast extract) and cultured overnight. Subsequently, a 1:1000 (v / v) inoculation was carried out into 2 mL of fresh 2YT liquid medium, and 1 mM rhamnose was added to induce O-DNAP. N71D Express.
[0090] A 12-hour evolutionary cycle (corresponding to 10 generations) yields a preliminary aminoacyl-tRNA synthetase mutant library after 30 generations. Non-natural amino acids and 0.2% (w / v) L-arabinose are added to this library to induce sfGFP expression, and the induction period is 16 hours. Cells in the top 0.1% of fluorescence are sorted by flow cytometry, with a cell count of 8000. The sorted positive cells are divided into two aliquots: one aliquot is plated on LB solid medium containing non-natural amino acids and L-arabinose for screening and validation of single colonies; the other aliquot is re-added with rhamnose to continue the iterative mutation and evolutionary cycle of aminoacyl-tRNA synthetase.
[0091] After single colonies with green fluorescence grow on LB solid medium, target colonies are picked for non-natural amino acid-dependent fluorescence characterization. For positive clones confirmed to be substrate-dependent, linear plasmid replicons are obtained by colony PCR amplification, and their amino acid sequence composition is analyzed by Sanger sequencing.
[0092] The specific technical approach is as follows:
[0093] 1.1 Construction of Linear Replicators
[0094] MbPylRS (Methanosarcina barkeri pyrrolysyl-tRNA synthetase) is known to have high recognition activity against BocK, while the MbPylRS (Y349W-V366G) variant shows high recognition activity against BocK (N... ε -Boc-L-lysine ((S)-6-amino-2-((tert-butoxycarbonyl)amino)hexanoic acid, purchased from Bid Pharmaceuticals, catalog number BD13518) has low recognition activity. Overlap extension PCR was used to identify the product containing the promoter P... glns P of (SEQ ID No. 6) glns-MbPylRS (SEQ ID No. 6 and SEQ ID No. 7) and P glns -MbPylRS(Y349W-V366G) The genes (SEQ ID No. 6 and SEQ ID No. 8) were cloned into linear replicons to replace the original P gene in the literature (Rongzhen Tian et al. Establishing a synthetic orthogonal replication system enables accelerated evolution in E. coli. Science 383, 421-426 (2024).). mut The position of -2-sfGFP is obtained from this, thus revealing PylRS-Kan (SEQ ID No.9) Gene fragments of two replicons, PylRS(Y349W-V366G)-Kan, were used. These gene fragments were electroporated into evolutionary strains (Reference: Rongzhen Tian et al. Establishing a synthetic orthogonal replication system enables accelerated evolution in E. coli. Science 383,421-426(2024)) to obtain competent states of the evolutionary strains containing linear replicons. These were then converted into electrocompetent states (containing PylRS-Kan orthogonal replicons and PylRS(Y349W-V366G)-Kan linear replicons, respectively) for subsequent steps.
[0095] 1.2 Construction and Validation of Plasmids for Single Fluorescent Reporter Systems
[0096] The P-value in the literature (Rongzhen Tian et al. Establishing a synthetic orthogonal replication system enables accelerated evolution in E. coli. Science 383, 421-426(2024).) was detected by PCR. rha -O-DNAP N71D Gene cloned into plasmid backbone p15a-P BAD -sfGFP N150TAG -tRNA Pyl plasmid p15a-P was obtained from (SEQ ID No. 11).BAD -sfGFP N150TAG - P rha -O-DNAP N71D -tRNA Pyl (Plasmid name: MJ58 p15a-P) BAD -sfGFP N150TAG -P rha -O-DNAP N71D -tRNA Pyl ).
[0097] Plasmid MJ58 and the circular plasmid containing MbPylRS (MJ57 pBR322-P) were used. glns MbPylRS (SEQ ID No. 12) was co-transformed into Escherichia coli DH10B and plated onto LB agar. Multiple clones from the LB agar were picked and cultured overnight in 2YT liquid medium (containing 10 μg / mL tetracycline and 75 μg / mL spectinomycin), with three replicates.
[0098] The following day, the three parallel groups were inoculated at a dilution of 1:100 (v / v) into fresh 2YT liquid medium and cultured with shaking until OD was reached. 600 When the concentration of the bacterial culture reached approximately 0.3, each parallel bacterial culture was divided into two groups: one group was treated with 2 mM BocK (experimental group), and the other group was treated without any non-natural amino acids (negative control). The cultures were then continued until the OD value reached 0.3. 600 After reaching a concentration of 0.6, both the experimental and negative control groups were treated with 0.2% (w / v) L-arabinose to induce sfGFP expression. After 16 h of culture, the fluorescence and OD values of the negative control and experimental groups were detected using a microplate reader. 600 (ELISA reader parameters: excitation light 485 (±20) nm, emission light 535 (±25) nm, gain value: 30), such as Figure 2 As shown in a, via OD 600 After homogenization, the experimental group showed significant BocK-dependent fluorescence enhancement compared to the negative control, indicating that MbPylRS can recognize and aminoacylate tRNA. Pyl By inserting BocK into the sfGFP site at position 150, full-length sfGFP expression and green fluorescence were achieved, demonstrating that the MJ58 reporter plasmid can function normally as a fluorescent reporter and can be used for subsequent evolution.
[0099] 1.3 Activity detection of linear replicons
[0100] Plasmid MJ58 was electroporated into competent cells of two different evolutionary strains (containing the MbPylRS-Kan orthogonal replicon) and one containing the MbPylRS(Y349W-V366G)-Kan orthogonal replicon, respectively. The cells were then plated on LB agar (containing 50 μg / mL kanamycin and 10 μg / mL tetracycline) to obtain two strains: one containing the MbPylRS-Kan orthogonal replicon and plasmid MJ58 (positive control) and the other containing the MbPylRS(Y349W-V366G)-Kan orthogonal replicon and plasmid MJ58 (experimental group). Using the MbPylRS-Kan replicon as an example, the aminoacyl-tRNA synthetase on the orthogonal replicon was tested using the same procedure as in section 1.2 to verify whether it could specifically recognize BocK and achieve sfGFP. N150BocK Protein expression. For example... Figure 2 As shown in b, via OD 600 After homogenization, the experimental group showed a significant BocK-dependent fluorescence enhancement compared to the negative control, indicating that MbPylRS on the linear replicon can be normally expressed and play an active role.
[0101] 1.4 Continuous Evolution of MbPylRS (Y349W-V366G) Based on a Single Fluorescent Reporter System
[0102] Six single clones of the strain (containing the MbPylRS(Y349W-V366G)-Kan orthogonal replicon and plasmid MJ58) from LB solid medium in step 1.3 were inoculated into 2YT liquid medium and cultured overnight, i.e., 6 replicates. The next day, the overnight bacterial culture was inoculated 1:1000 (v / v) into 2 mL of fresh 2YT medium, and antibiotics (50 μg / mL kanamycin and 10 μg / mL tetracycline) and 5 mM rhamnose were added to induce O-DNAP. N71D Expression. Incubate at 37℃ and 220 rpm for 12 h, i.e., 10 generations.
[0103] This process is repeated 30 times. All the bacterial culture from the 30th generation is then diluted into 20 mL of fresh 2YT liquid medium, without the addition of rhamnose, and cultured at 37°C and 220 rpm for approximately 6 hours. After culturing, the bacterial culture is inoculated 1:50 (v / v) into 4 mL of 2YT liquid medium, supplemented with 50 μg / mL kanamycin and 10 μg / mL tetracycline, and cultured at 37°C and 220 rpm until OD (outcome limit) is reached. 600 When the concentration of the bacterial culture reaches approximately 0.3, divide 4 mL of the culture into two groups. One group was treated with 2 mM BocK (experimental group), and the other group received no non-natural amino acids (negative control). The cultures were then returned to the shaker for further incubation. Cultured until the OD value reached... 600When the concentration of sfGFP was around 0.6, 0.2% (w / v) L-arabinose was added to induce sfGFP expression, and then the cells were returned to the shaker and cultured for 16 h.
[0104] After incubation, collect the bacterial cells at 4000 × g, 4℃, for 3 min. Discard the supernatant as much as possible, add 1 mL of 1×PBS to resuspend the cells, transfer to a 1.5 mL centrifuge tube, centrifuge at 4000 × g for 1 min, and discard the supernatant. Add another 1 mL of fresh 1×PBS to resuspend the cells for subsequent flow cytometry sorting.
[0105] 1.5 Continuous Evolution and Selection of Aminoacyl-tRNA Synthesizers Based on Flow Cytometry-Based Reporter Systems
[0106] Cells in the experimental groups were sorted using a Beckman Coulter CytoFLEX SRT flow cytometer. Fluorescence signals were measured using a 488 nm laser, and GFP detection was performed using a 525 / 40 filter. 10,000,000 events were measured during sorting, and the top 0.1% of fluorescence intensity in sfGFP-positive cells (8,000-10,000 cells) were recovered. Half of the sorted cells in each parallel group were inoculated with 5 mM rhamnose and antibiotics (50 μg / mL kanamycin and 10 μg / mL tetracycline) and cultured until saturation.
[0107] Each cycle consists of 30 passages, and this process is repeated until the fluorescence intensity of the cells on the flow cytometer shows a clear clustering (the cell population with significantly increased fluorescence intensity is the dominant peak). Cells selected from the clearly positive clusters are cultured to saturation without the addition of rhamnose before being sorted again. Figure 3 As shown, via OD 600 After homogenization, by generation 70, the 2 mM BocK-added group showed a slight rightward shift in fluorescence on the flow cytometry histogram compared to the generation 0 group; upon further evolution to generation 100, the fluorescence intensity was between 10... 5 -10 7 The cell populations of the positive control group (generation 100) were absolutely dominant; while the negative control group (generation 100) without added non-natural amino acids showed no significant cell population enrichment in the same fluorescence region. These results indicate that the PylRS mutant, which has high recognition activity for BocK, has successfully evolved and significantly enriched.
[0108] like Figure 3 As shown, the other half of the cells sorted each time were used to coat LB solid medium containing 2 mM BocK and 0.2% (w / v) L-arabinose (containing 50 μg / mL kanamycin and 10 μg / mL tetracycline) and cultured upside down at 30°C for 24 h for subsequent positive cell detection.
[0109] 1.6 Enzyme activity characterization and identification of evolved aminoacyl-tRNA synthetase mutants
[0110] Single clones emitting bright green fluorescence under 475 nm excitation were selected from the plates for BocK-dependent fluorescence detection: LB solid medium with or without BocK was simultaneously plated, both LB solid mediums being supplemented with L-arabinose (…). Figure 4 a) Incubated upside down at 37℃ for 20 h. Single clones carrying only the MbPylRS mutant that specifically recognizes BocK produced green fluorescence in the presence of 2 mMBocK, but showed no fluorescence signal in the absence of non-natural amino acids, exhibiting strictly BocK-dependent fluorescence enhancement. Figure 4 a).
[0111] BocK-dependent monoclonal antibodies were used to obtain the gene fragment of the aminoacyl-tRNA synthetase mutant via colony PCR and sent for Sanger sequencing. Figure 4 b). Subsequently, the positive mutant sequence was cloned into the plasmid backbone pBR322-P by PCR. glns -tRNA Py l (SEQ ID No. 13) was used to obtain a circular plasmid containing an aminoacyl-tRNA synthetase mutant for subsequent enzyme activity detection.
[0112] Enzyme activity assay: First, it is necessary to prepare E. coli DH10B chemically competent cells containing plasmids (p15a-P). BAD -sfGFP N150TAG Then, the circular plasmids of each aminoacyl-tRNA synthetase mutant were transformed into the above-mentioned chemocompetent cells and plated on LB solid medium (10 μg / mL tetracycline and 75 μg / mL spectinomycin). Subsequent enzyme activity assays, i.e., fluorescence characterization experiments, were performed similarly to those described in 1.2. The initial evolutionary mutant MbPylRS (Y349W-V366G) was used as a negative control, and wild-type MbPylRS as a positive control. The recognition activity of the evolutionary mutants was characterized using homogenized fluorescence values, such as... Figure 4 As shown in c, the fluorescence intensity of mutants 4, 6, 7 and 22 obtained through evolution was significantly higher than that of the initial mutant (approximately 6-8 times higher according to fluorescence value) and also higher than that of the positive control, indicating that the MbPylRS mutant with high specific recognition activity for BocK was successfully screened.
[0113] Identification of novel aminoacyl-tRNA synthetase mutants containing non-natural amino acids requires additional mass spectrometry characterization: In the presence of a specific aminoacyl-tRNA synthetase mutant, the corresponding non-natural amino acid is added, and an inducer is added to induce sfGFP. N150X The protein was expressed, purified, and then its molecular weight was determined by LC-MS. Figure 5 As shown, mutants 6 and 7 catalyze the insertion of BocK into sfGFP at site 150, and the molecular weight measured is similar to that of sfGFP. N150BocK The theoretical values differ by only 1-2 Da, confirming that mutants 6 and 7 can specifically recognize BocK. That is, based on a single fluorescent reporter system, a highly specific and highly active MbPylRS mutant was successfully obtained through continuous evolution from a low-activity initiator mutant.
[0114] Table 1 is used for Figure 1 PCR primers constructed from linear replicons and reporter plasmids
[0115]
[0116] The PCR reaction system consisted of 1 ng template DNA, 0.2 μM each of forward and reverse primers, and 10 μL of PrimeSTAR Max DNAPolymerase (2×), which was then supplemented to 20 μL using ddH2O.
[0117] The PCR reaction procedure is as follows:
[0118] Step 1: 98 ℃, 3 min;
[0119] Step 2: 98 ℃, 10 s;
[0120] Step 3: Tm -3 ℃, 20 s;
[0121] Step 4: 72 ℃, 10 s / kb;
[0122] GO TO Step 2 30×;
[0123] Step 6: 72 ℃, 5 min.
[0124] Example 2: Construction and Validation of an Evolutionary System for Aminoacyl-tRNA Synthesizer Based on Fluorescent-CAT Dual Reporter
[0125] To shorten the evolutionary cycle and impose clear directional selection pressure on the evolutionary system, this study introduced a chloramphenicol resistance screening module, the core element of which is a chloramphenicol acetyltransferase mutant containing an amber stop codon (CAT). 112TAG(SEQ No. 14). This mutant can only correctly fold and express a functional protein with complete catalytic activity after the non-natural amino acid is specifically inserted into the stop codon site. Therefore, when chloramphenicol and non-natural amino acids are present in the culture medium, the host cell will be forced to evolve aminoacyl-tRNA synthetase in a directed manner to efficiently recognize and activate non-natural amino acids in order to survive. Based on this, we constructed a dual-reporter "evolution + screening" system integrating a single fluorescent reporter system and chloramphenicol resistance screening to achieve rapid directed evolution of aminoacyl-tRNA synthetase.
[0126] The principle of the reporting system is as follows Figure 6 As shown.
[0127] Reporting system components
[0128] The reporter system uses an evolved strain from the E. coli orthogonal replication system (EcORep) containing a linear replicon of the gene to be evolved, namely MbPylRS(Y349W-V366G)-Kan; the fluorescent reporter plasmid includes an O-DNAP induced and regulated by the rhamnose operon. N71D sfGFP regulated by the arabinose operon (orthogonal to linear replicons) 150TAG Constitutive CAT 112TAG and constitutively expressed tRNA Pyl And tetracycline resistance genes.
[0129] How to use the reporting system
[0130] The operation process of this evolutionary system is basically the same as that of the single fluorescent reporter system. The core differences are twofold: First, chloramphenicol pressure needs to be applied every 20 generations to force evolution for 10 generations (the bacterial culture time is 10 h after adding chloramphenicol) in order to enhance the "directed" selection effect in the evolution; Second, Cm needs to be added in advance for stress screening before flow cytometry to further enrich positive cells with non-natural amino acid recognition activity.
[0131] The specific technical approach is as follows:
[0132] 2.1 Construction of a single fluorescent-CAT reporter plasmid
[0133] P was generated by PCR. cat -CAT D112TAG (SEQ No. 14) gene cloned into plasmid p15a-P BAD -sfGFP N150TAG -P rha -O-DNAP N71D -tRNA Pyl On the above, plasmid p15a-P was obtained. BAD -sfGFP 150TAG-P cat -CAT D112TAG -P rha -O-DNAP N71D -tRNA Pyl (Plasmid name: MJ87 p15a-P) BAD -sfGFP 150TAG -P cat -CAT D112TAG -P rha -O-DNAP N71D -tRNA Pyl )
[0134] 2.2 Determination of the optimal concentration of chloramphenicol required for evolution
[0135] Plasmid MJ87 was electroporated into competent cells of the evolved strain (containing the MbPylRS-Kan orthogonal replicon, as a positive control) and competent cells of the evolved strain (containing the MbPylRS(Y349W-V366G)-Kan orthogonal replicon), respectively, and plated on LB solid medium (containing 50 μg / mL kanamycin and 10 μg / mL tetracycline) to obtain strain (containing the MbPylRS-Kan orthogonal replicon and plasmid MJ87) and strain (containing the MbPylRS(Y349W-V366G)-Kan orthogonal replicon and plasmid MJ87).
[0136] Polyclonal clones from LB solid medium were inoculated into 2 mL of 2YT liquid medium (containing 50 μg / mL kanamycin and 10 μg / mL tetracycline) and cultured at 37°C with shaking at 220 rpm for 16 h. Taking a strain (containing the MbPylRS(Y349W-V366G)-Kan orthogonal replicon and plasmid MJ87) as an example, its overnight stock was inoculated 1:100 (v / v) into fresh 2YT liquid medium (containing 50 μg / mL kanamycin and 10 μg / mL tetracycline) and cultured under the same conditions for approximately 2 h until OD was achieved. 600 =0.2-0.3, the bacterial culture was divided into two parts. One part was added with 2 mM BocK, which is the experimental group, and the other part was not added with non-natural amino acids, which is the negative control. Both parts were then returned to the shaker for further cultivation until OD. 600 =Approximately 0.6, remove the bacterial culture, and at this point, a Cm concentration tolerance test is required: set Cm concentrations (μg / mL) of 0, 10, 20, 25, 30, 40, and 50, and prepare corresponding LB solid culture media (containing 50 μg / mL kanamycin and 10 μg / mL tetracycline), both containing 2 mM BocK and 0.2% (w / v) L-arabinose.
[0137] Then, 3 μL of the above bacterial suspension was sequentially spotted onto LB solid medium, and incubated upside down at 37°C for 16 h. The colony survival and fluorescence were then observed. Figure 7 As shown in Figure a, without the addition of BocK, neither wild-type MbPylRS nor MbPylRS (Y349W / V366G) could grow on 40 μg / mL chloramphenicol plates, indicating that CAT background expression at this concentration was insufficient to maintain strain survival. In the groups with the addition of 2 mM BocK, colonies in both the positive control and experimental groups grew normally within the 0-30 μg / mL chloramphenicol range, and the fluorescence intensity of the positive control was significantly higher than that of the experimental group, consistent with the difference in BocK recognition activity between the two. When the chloramphenicol concentration was increased to 40 μg / mL, the number of colonies in the experimental group decreased significantly, suggesting that CAT expression mediated by low-activity MbPylRS (Y349W / V366G) could not fully tolerate chloramphenicol stress; however, the fluorescence intensity of surviving colonies was similar to that of the positive control and higher than that of the low-concentration chloramphenicol group; when the concentration was further increased to 50 μg / mL, the colonies became sparser, but the fluorescence remained at a high level.
[0138] The above results suggest that some cells may escape and survive through non-specific mutations at 40 μg / mL chloramphenicol concentration, easily leading to false positives. In conclusion, 30 μg / mL is the optimal chloramphenicol screening concentration that combines effective selection pressure with a low false positive rate.
[0139] 2.3 Determination of the time gradient of chloramphenicol-mediated survival pressure
[0140] Multiple clones of strains containing MbPylRS-Kan orthogonal replicons and plasmid MJ87 were picked from LB solid medium and inoculated into 2 mL of 2YT liquid medium (containing 50 μg / mL kanamycin and 10 μg / mL tetracycline). Three biological replicates were set up for each group and cultured at 37℃ with shaking at 220 rpm for 16 h.
[0141] Taking a strain (containing the MbPylRS(Y349W-V366G)-Kan orthogonal replicon and plasmid MJ87) as an example, its overnight strain was inoculated 1:100 (v / v) into fresh 2YT liquid medium (containing 50 μg / mL kanamycin and 10 μg / mL tetracycline) and cultured under the same conditions for about 2 h until its OD value was reached. 600 =0.2-0.3, the bacterial culture was divided into two parts. One part was added with 2 mMBocK, which was the experimental group, and the other part was not added with non-natural amino acids, which was the negative control. Both parts were then returned to the shaker for further cultivation until OD. 600 =Approximately 0.6, take 200 μL and measure its OD using an enzyme-linked immunosorbent assay (ELISA) reader.600 The fluorescence value (microplate reader parameters as above) was measured at 0 h. Then, the optimal concentration of Cm and 0.2% (w / v) L-arabinose (as determined in section 2.2) were added, and the mixture was returned to the shaker for further incubation. Samples were then taken at five time points: 2 h, 4 h, 7 h, 10 h, and 20 h, and the above OD values were repeated. 600 Fluorescence measurement was performed. Data at all time points were collected, and GraphPad software was used to plot cell growth curves and fluorescence intensity change curves under Cm stress conditions.
[0142] The results show that ( Figure 7 (b, c) After treatment for 10 h, the wild-type MbPylRS group under the condition of no non-natural amino acids OD 600 The levels gradually approached and surpassed those of the group with non-natural amino acids at around 15 h, indicating the expansion of the drug-resistant escape cell population; the OD of the MbPylRS (Y349W / V366G) group without non-natural amino acids was... 600 Also higher than adding the BocK group. (via OD) 600 After normalization, both groups showed significant BocK-dependent fluorescence enhancement at 10 h, indicating that 10 h is sufficient for aminoacyl-tRNA synthetase to mediate BocK embedding into sfGFP and achieve its full-length expression, which is suitable for subsequent flow cytometry sorting.
[0143] 2.4 Continuous Evolution of MbPylRS (Y349W-V366G) Based on Single-Fluorescence-CAT Dual-Reporter System
[0144] Six single clones of the bacterial strain (containing linear plasmid PylRS(Y349W-V366G)-Kan and plasmid MJ58) were picked from LB solid medium and inoculated into 2YT liquid medium for overnight culture, i.e., 6 replicates. The next day, the overnight bacterial culture was inoculated 1:1000 (v / v) into 2 mL of fresh 2YT medium, and antibiotics (50 μg / mL kanamycin and 10 μg / mL tetracycline) and 5 mM rhamnose were added to induce O-DNAP. N71D Expression. Incubate at 37℃ and 220 rpm for 12 h, i.e., 10 generations.
[0145] After 20 generations, the 20th generation bacterial culture was inoculated 1:1000 (v / v) into 2 mL of fresh 2YT medium, and supplemented with antibiotics (50 μg / mL kanamycin and 10 μg / mL tetracycline) and 5 mM rhamnose to induce O-DNAP. N71D Expression. Incubate at 37℃ and 220 rpm for 5-6 h, until OD is achieved. 600 When the OD value is around 0.2-0.3, add 2 mM BocK and return to the shaker for further incubation. Wait until the OD value... 600When the concentration reaches approximately 0.6, add 30 ng / μL Cm and return to the shaker for 10 h of incubation. This is the 30th generation.
[0146] The 30th generation bacterial culture was then diluted in 20 mL of fresh 2YT liquid medium without the addition of rhamnose and cultured at 37°C and 220 rpm for approximately 6 hours. After culturing, the bacterial culture was inoculated 1:50 (v / v) into 4 mL of 2YT liquid medium, and the appropriate antibiotics were added. The culture was then incubated at 37°C and 220 rpm until OD500 was reached. 600 When the concentration of the bacterial culture reaches approximately 0.3, divide 4 mL of the culture into two groups. One group was treated with 2 mM BocK (experimental group), and the other group was treated without any non-natural amino acids (negative control). The cultures were then returned to the shaker for further incubation. The cultures were continued until the OD value reached... 600 When the pH was around 0.6, 0.2% (w / v) L-arabinose was added to all samples. The experimental group was also given an additional 30 ng / μL of Cm, and then the samples were placed back in the shaker and incubated for 10 h.
[0147] After incubation, collect the bacterial cells at 4000 × g, 4℃, for 3 min. Discard the supernatant as much as possible, add 1 mL of 1×PBS to resuspend the cells, transfer to a 1.5 mL centrifuge tube, centrifuge at 4000 × g for 1 min, and discard the supernatant. Resuspend the cells in fresh 1×PBS for subsequent flow cytometry sorting.
[0148] 2.5 Continuous Evolution and Selection of Aminoacyl-tRNA Synthesizers Based on Flow Cytometry Sorting
[0149] The operation is similar to 1.5. For example... Figure 8 As shown in the flow cytometry histogram, Figure 8 As shown in the flow cytometry histogram, 30 generations can achieve the same positive enrichment effect as 100 generations in a single fluorescent reporter system, significantly shortening the evolutionary cycle. These results indicate that applying an appropriate concentration of chloramphenicol during the evolution of aminoacyl-tRNA synthetase can significantly enhance the directionality of evolution and effectively accelerate the enrichment of highly active mutants under continuous selection pressure.
[0150] 2.6 Enzyme activity characterization and identification of evolved aminoacyl-tRNA synthetase mutants
[0151] The specific operation is as described in 1.6. Positive clones obtained after 30 generations of evolution and sorting ( Figure 8 BocK-dependent validation was performed, and all 12 randomly selected monoclonal antibodies showed significant BocK-dependent fluorescence enhancement. Figure 9 a). Four clones (2c, 4c, 8c, and 10c) were randomly selected for Sanger sequencing. The results showed that all clones had a mutation at the G366 site, which was either C or V (Figure 9b), consistent with the in vivo evolution results of the single fluorescent reporter system. Figure 4 b). Three mutants with different amino acid sequences were selected for enzyme activity characterization, and the enzyme activity was characterized by OD. 600 Detection of homogenized fluorescence values ( Figure 9 c), where mutant 8c exhibits approximately four times the recognition activity of the starting template for BocK and is slightly higher than that of wild-type MbPylRS.
[0152] Mutants 2c and 8c were characterized by mass spectrometry. The results confirmed that, in the presence of 2 mM BocK, both mutants could specifically catalyze the insertion of BocK into the 150th amber stop codon of sfGFP, thus realizing the reporter protein sfGFP. N150BocK Full-length expression ( Figure 10 The above results indicate that both the dual-reporter system and the single-fluorescence evolution system can achieve the evolution from low-activity to high-activity MbPylRS mutants, and both obtain the G366V / C key site mutation.
[0153] Table 2 is used for Figure 6 PCR primers for constructing plasmids in the report
[0154]
[0155] The PCR reaction system consisted of 1 ng template DNA, 0.2 μM each of forward and reverse primers, and 10 μL of PrimeSTAR Max DNAPolymerase (2×), which was then supplemented to 20 μL using ddH2O.
[0156] The PCR reaction procedure is as follows:
[0157] Step 1: 98 ℃, 3 min;
[0158] Step 2: 98 ℃, 10 s;
[0159] Step 3: Tm -3 ℃, 20 s;
[0160] Step 4: 72 ℃, 10 s / kb;
[0161] GO TO Step 2 30×;
[0162] Step 6: 72 ℃, 5 min.
[0163] sequence
[0164] SEQ ID No.1 O-DNAP N71D DNA sequence (5'-3') 1662 bp
[0165] The gene was kindly provided by Professor Jason W. Chin of the Medical Research Council Laboratory for Molecular Biology, Cambridge, UK.
[0166]
[0167] SEQ ID No.2 sfGFP N150TAG DNA sequence (5'-3') 744 bp
[0168] ATGGTTAGCAAAGGTGAAGAACTGTTTACCGGCGTTGTGCCGATTCTGGTGGAACTGGATGGTGATGTGAATGGCCATAAATTTAGCGTTCGTGGCGAAGGCGAAGGTGATGCGACCAACGGTAAACTGACCCTGAAATTTATTTGCACCACCGGTAAACTGCCGGTTCCGTGGCCGACCCTGGTGACCACCCTGACCTATGGCGTTCAGTGCTTTAGCCGCTATCCGGATCATATGAAACGCCATGATTTCTTTAAAAGCGCGATGCCGGAAGGCTATGTGCAGGAACGTACCATTAGCTTCAAAGATGATGGCACCTATAAAACCCGTGCGGAAGTTAAATTTGAAGGCGATACCCTGGTGAACCGCATTGAACTGAAAGGTATTGATTTTAAAGAAGATGGCAACATTCTGGGTCATAAACTGGAATATAATTTCAACAGCCATTAGGTGTATATTACCGCCGATAAACAGAAAAATGGCATCAAAGCGAACTTTAAAATCCGTCACAACGTGGAAGATGGTAGCGTGCAGCTGGCGGATCATTATCAGCAGAATACCCCGATTGGTGATGGCCCGGTGCTGCTGCCGGATAATCATTATCTGAGCACCCAGAGCGTTCTGAGCAAAGATCCGAATGAAAAACGTGATCATATGGTGCTGCTGGAATTTGTTACCGCCGCGGGCATTACCCACGGTATGGATGAACTGTATAAAGGCAGCCACCATCATCATCACCATTAA
[0169] SEQ ID No.3 tRNA pyl DNA sequence (5'-3') 72 bp
[0170] GGAAACCTGATCATGTAGATCGAATGGACTCTAAATCCGTTCAGCCGGGTTAGATTCCCGGGGTTTCCGCCA
[0171] SEQ ID No.4 Tet R DNA sequence (5’-3’) 1191bp
[0172]
[0173] SEQ ID No. 5 MbPylRS(Y349W-V366G)-Kan DNA sequence (5'-3') 2762 bp
[0174]
[0175] SEQ ID No.6 P glns DNA sequence (5'-3') 38 bp
[0176] TATAAGATCATACGCCGTTATACGTTGTTTACGCTTTG
[0177] SEQ ID No. 7 MbPylRS DNA sequence (5'-3') 1260 bp
[0178]
[0179] SEQ ID No. 8 MbPylRS (Y349W-V366G) DNA sequence (5'-3') 1260 bp
[0180]
[0181] SEQ ID No. 9 Replicon MbPylRS-Kan DNA sequence (5'-3') 2762 bp
[0182]
[0183] SEQ ID No.10 P rha DNA sequence (5'-3') 119 bp
[0184] CACCACAATTCAGCAAATTGTGAACATCATCACGTTCATCTTTCCCTGGTTGCCAATGGCACAATTTTCCTGTCAGTAACGAGAAGGTCGCGAATTCAGGCGCTTTTTAGACTGGTCGTA
[0185] SEQ ID No. 11 Plasmid backbone p15a-P BAD -sfGFP N150TAG -tRNA Pyl DNA sequence (5'-3') 5582bp
[0186]
[0187] SEQ ID No.12 MJ57 pBR322-P glns -MbPylRS DNA sequence (5'-3') 4258 bp
[0188]
[0189] SEQ ID No.13 pBR322-P glns -tRNA Pyl DNA sequence (5'-3') 3155 bp
[0190]
[0191] SEQ ID No.14 CAT D112TAG DNA sequence (5’-3’) 660 bp
[0192] ATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTCCGTATGGCAATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACTGAAACGTTTTCATCGCTCTGGAGTGAATACCACGATTAGTTCCGGCAGTTTCTACACATATATTCGCAAGATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTCAGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCCGTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATCATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAA
[0193] SEQ ID No.15 Kan R DNA sequence (5’-3’) 817 bp
[0194] TTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGTTGAATATGGCTCAT
[0195] SEQ ID No.16 Spectinomycin Spec R DNA sequence (5’-3’) 792 bp
[0196] TTATTTGCCGACTACCTTGGTGATCTCGCCTTTCACGTAGTGGACAAATTCTTCCAACTGATCTGCGCGCGAGGCCAAGCGATCTTCTTCTTGTCCAAGATAAGCCTGTCTAGCTTCAAGTATGACGGGCTGATACTGGGCCGGCAGGCGCTCCATTGCCCAGTCGGCAGCGACATCCTTCGGCGCGATTTTGCCGGTTACTGCGCTGTACCAAATGCGGGACAACGTAAGCACTACATTTCGCTCATCGCCAGCCCAGTCGGGCGGCGAGTTCCATAGCGTTAAGGTTTCATTTAGCGCCTCAAATAGATCCTGTTCAGGAACCGGATCAAAGAGTTCCTCCGCCGCTGGACCTACCAAGGCAACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATCGTGGCTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGTTCGCGCTTAGCTGGATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTGACTTCTACAGCGCGGAGAATCTCGCTCTCTCCAGGGGAAGCCGAAGTTTCCAAAAGGTCGTTGATCAAAGCTCGCCGCGTTGTTTCATCAAGCCTTACGGTCACCGTAACCAGCAAATCAATATCACTGTGTGGCTTCAGGCCGCCATCCACTGCGGAGCCGTACAAATGTACGGCCAGCAACGTCGGTTCGAGATGGCGCTCGATGACGCCAACTACCTCTGATAGTTGAGTCGATACTTCGGCGATCACCGCTTCCCTCAT
[0197] SEQ ID No.17 Mutant 4 DNA sequence (5'-3') 1260 bp
[0198]
[0199] SEQ ID No. 18 mutant 8c DNA sequence (5'-3') 1260 bp
[0200]
[0201] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. An in vivo continuous evolution reporter system for aminoacyl-tRNA synthetase based on the orthogonal replication system of *E. coli*, characterized in that, The reporting system includes: sfGFP, a green fluorescent protein mutant containing the amber stop codon TAG N150TAG The green fluorescent protein mutant sfGFP N150TAG It is also connected to an arabinose operon, optionally, the green fluorescent protein mutant sfGFP N150TAG The nucleotide sequence is shown in SEQ ID No. 2; A linear replicon containing aminoacyl-tRNA synthetase, the linear replicon further comprising a first resistance gene, optionally having the nucleotide sequence shown in SEQ ID No. 8, and optionally having the linear replicon further comprising a promoter shown in SEQ ID No. 6; A reporter plasmid containing an orthogonal error-prone DNA polymerase is used to continuously mutate the linear replicon to generate an in vivo aminoacyl-tRNA synthetase mutant library. The orthogonal error-prone DNA polymerase is also linked to a rhamnose operon. Optionally, the nucleotide sequence of the orthogonal error-prone DNA polymerase is shown in SEQ ID No. 1, and optionally, the nucleotide sequence of the rhamnose operon is shown in SEQ ID No.
10. tRNA, wherein the tRNA is orthogonal to aminoacyl-tRNA synthetase to achieve the insertion of non-natural amino acids and complete protein expression; optionally, the nucleotide sequence of the tRNA is shown in SEQ ID No. 3; optionally, the tRNA is constitutively expressed. A second resistance gene, which is different from the first resistance gene, is used to enhance resistance pressure screening.
2. The reporting system according to claim 1, characterized in that, The first resistance gene and the second resistance gene are independently selected from ampicillin resistance gene, chloramphenicol resistance gene, kanamycin resistance gene, neomycin resistance gene, rifampin resistance gene, hygromycin resistance gene, streptomycin resistance gene, and tetracycline resistance gene. Optionally, the first resistance gene is a kanamycin resistance gene. Optionally, the nucleotide sequence of the kanamycin resistance gene is shown in SEQ ID No.
15. Optionally, the second resistance gene is a tetracycline resistance gene. Optionally, the nucleotide sequence of the tetracycline resistance gene is shown in SEQ ID No.
4.
3. The reporting system according to claim 1 or the above, characterized in that, The reporting system also includes the chloramphenicol acetyltransferase mutant CAT containing the amber stop codon TAG. D112TAG Optionally, the chloramphenicol acetyltransferase mutant CAT D112TAG For constitutive expression, optionally, the chloramphenicol acetyltransferase mutant CAT D112TAG The nucleotide sequence is shown in SEQ ID No.
14.
4. The use of the report system according to any one of claims 1 to 3 in screening aminoacyl-tRNA synthetase mutants that specifically recognize non-natural amino acids.
5. The application of the reporting system according to any one of claims 1 to 3 in genetic code expansion technology.
6. The use of the reporter system according to any one of claims 1 to 3 in the preparation of a kit for directed evolution of aminoacyl-tRNA synthetase.
7. A method for directed evolution of aminoacyl-tRNA synthetase, characterized in that... The method is performed using the reporting system according to any one of claims 1 to 3.
8. The application according to any one of claims 4 to 5 or the method according to claim 7, characterized in that, The construction of the aminoacyl-tRNA synthetase mutant library requires multiple passages under rhamnose induction, during which arabinose is not added. Optionally, the number of passages is 0-100, 0-70, or 0-40, preferably 30. Optionally, the reporter system is used in conjunction with flow cytometry sorting. Optionally, the cells used for flow cytometry sorting are obtained after arabinose induction, during which rhamnose is not added. Optionally, chloramphenicol is added before flow cytometry sorting for stress screening. Optionally, chloramphenicol... The dosage of chloramphenicol is 0-50µg / ml, 0-45µg / ml, 0-40µg / ml or 0-30µg / ml, preferably 30µg / ml. Optionally, the treatment time of chloramphenicol is 0-20 hours, 0-19 hours, 0-18 hours, 0-17 hours, 0-16 hours, 0-15 hours, 0-14 hours, 0-13 hours, 0-12 hours, 0-11 hours or 0-10 hours, preferably 10 hours. Optionally, the chloramphenicol is applied once every 0-20 generations.
9. An aminoacyl-tRNA synthetase mutant, characterized in that, The aminoacyl-tRNA synthetase mutant was obtained by screening using a reporter system according to any one of claims 1 to 3.
10. An aminoacyl-tRNA synthetase mutant, characterized in that, The nucleotide sequences of the aminoacyl-tRNA synthetase mutant are shown in SEQ ID No. 17 and SEQ ID No. 18.
Citation Information
Patent Citations
Methods and products for evolving genes
WO2024240906A1