Genetically engineered bacteria for producing lacto-n-neotetraose and construction method and application thereof

Abstract

The application provides a genetically engineered bacterium for producing lactose-N-neotetraose, a construction method and application thereof. The genetically engineered bacterium satisfies the following conditions: (1) exogenous expression of MFS transporter protein, beta-1, 3-N-acetylglucosamine transferase and beta-1, 4-galactosyltransferase; (2) overexpression of galactoside permease and UDP-galactose-4-epimerase; and (3) no expression or weakened expression of setA transporter protein. The applicant of the application finds through research that exogenous introduction of MFS transporter protein, beta-1, 3-N-acetylglucosamine transferase and beta-1, 4-galactosyltransferase in the genetically engineered bacterium, enhancement of the expression amount of galactoside permease and UDP-galactose-4-epimerase in the genome, and reduction of the expression amount of setA transporter protein can effectively reduce the residual amount of LNT II in the LNnT synthesis pathway and improve the fermentation yield of LNnT.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and in particular to a genetically engineered bacterium that produces lactose-N-neotetrasaccharide, its construction method, and its application. Background Technology

[0002] Lactose-N-neotetraose (LNnT), as one of the core components of human milk oligosaccharides, plays an important role in the growth and development of infants and young children. It has been approved by the food and drug administrations of the United States and the European Union as a new resource food ingredient to be added to food.

[0003] LNnT production mainly includes chemical synthesis, enzymatic synthesis, and microbial fermentation. Enzymatic synthesis often requires the addition of expensive precursors; while biosynthesis can utilize inexpensive and renewable substrates, and is characterized by being clean, green, and efficient, thus having a broader application prospect. Currently, Escherichia coli is commonly used for LNnT biosynthesis, but traditional E. coli still has some shortcomings, resulting in low LNnT yields and high byproduct levels.

[0004] Therefore, the traditional production methods of lactose-N-neotetrasaccharide still need improvement. Summary of the Invention

[0005] Based on this, one or more embodiments of this application provide a genetically engineered bacterium with high LNnT production and low LNTⅡ spillage, its construction method, and its application. The technical solution includes:

[0006] According to a first aspect of the embodiments of this application, a genetically engineered bacterium for producing lactose-N-neotetrasaccharide is provided, wherein the genetically engineered bacterium satisfies the following conditions:

[0007] (1) Exogenous expression of MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyltransferase;

[0008] (2) Overexpression of galactosidase and UDP-galactose-4-epimerase; and

[0009] (3) Do not express or reduce the expression of setA transporter protein.

[0010] In one embodiment, the setA transporter protein is not expressed or is expressed at a reduced level by knocking out the setA gene.

[0011] In one embodiment, the knockout method includes at least one of homologous recombination and CRISPR gene editing.

[0012] In one embodiment, the MFS transporter includes at least one of bad protein, fred protein, nec protein, marc protein, and vag protein.

[0013] In one embodiment, the genetically engineered bacteria satisfies at least one of the following conditions (1) to (5):

[0014] (1) The nucleotide sequence encoding the vag protein is shown in SEQ ID NO:1;

[0015] (2) The nucleotide sequence encoding the β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO:2;

[0016] (3) The nucleotide sequence encoding the β-1,4-galactosyltransferase is shown in SEQ ID NO:3;

[0017] (4) The gene encoding the galactosidase is the lacY gene, and the nucleotide sequence encoding the galactosidase is shown in SEQ ID NO:4; and

[0018] (5) The gene encoding the UDP-galactose-4-epimerase is the galE gene, and the nucleotide sequence encoding the UDP-galactose-4-epimerase is shown in SEQ ID NO:5.

[0019] In one embodiment, the genetically engineered bacteria include bacteria;

[0020] Optionally, the bacteria include at least one of Escherichia coli and Bacillus subtilis;

[0021] Further optionally, the Escherichia coli includes Escherichia coli BL21(DE3).

[0022] In one embodiment, the genetically engineered bacteria contain at least one of the following genes: wcaJ, lacZ, fucIK, nagB, and wecB, which is either not expressed or is expressed at a reduced level.

[0023] Optionally, the genetically engineered bacteria contain inactivated or deleted wcaJ, lacZ, and fucIK genes;

[0024] Optionally, the genetically engineered bacteria contain inactivated or deleted nagB, wecB, and lacZ genes.

[0025] According to a second aspect of the embodiments of this application, a method for constructing a genetically engineered bacterium that produces lactose-N-neotetrasaccharide as described above is provided, comprising the following steps:

[0026] An integrative vector expressing MFS transporter protein, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyltransferase was introduced into the genetically engineered bacteria to be modified.

[0027] To prevent or reduce the expression of the setA transporter protein in the genetically engineered bacteria to be modified; and

[0028] A recombinant vector overexpressing galactosidase and UDP-galactose-4-epimerase was introduced into the genetically engineered bacteria to be modified, thereby constructing the genetically engineered bacteria that produce lactose-N-neotetrasaccharide.

[0029] According to a third aspect of the embodiments of this application, a method for preparing lactose-N-neotetrasaccharide is provided, comprising the following steps:

[0030] The above-mentioned genetically engineered bacteria were fermented to prepare lactose-N-neotetrasaccharide.

[0031] According to a fourth aspect of the embodiments of this application, a method for producing dairy products is provided, comprising the following steps:

[0032] Lactose-N-neotetrasaccharide was prepared using the above preparation method; and

[0033] Dairy products are prepared using the lactose-N-neotetrasaccharide.

[0034] Compared with traditional technologies, this application has the following advantages:

[0035] The applicant of this application discovered through research that the exogenous introduction of MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyltransferase into genetically engineered bacteria enhances the expression levels of galactosidase and UDP-galactose-4-epimerase in the genome, while reducing the expression of setA protein. This effectively reduces the residual amount of LNT II in the LNnT synthesis pathway and increases the fermentation yield of LNnT. Detailed Implementation

[0036] To make the above-mentioned objectives, features, and advantages of this application more apparent and understandable, a detailed description of specific embodiments of this application is provided. Many specific details are set forth in the following description to provide a thorough understanding of this application. However, this application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of this application. Therefore, this application is not limited to the specific embodiments disclosed below.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. Unless otherwise specifically stated, all raw materials, reagents, instruments, and equipment used in this application are commercially available or can be prepared by existing methods.

[0038] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0039] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0040] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0041] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.

[0042] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0043] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0044] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0045] All references to documents mentioned in this application are incorporated herein by reference as if each document were individually incorporated by reference. Unless they conflict with the inventive purpose and / or technical solution of this application, all cited documents are incorporated herein by reference in their entirety and for all purposes. When citing documents in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. When citing documents in this application, examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0046] In this application, the terms "homology," "identity," and "similarity" are used interchangeably. "Homology," "identity," and "similarity" refer to the fact that two or more sequences share the same bases or amino acid residues at specific percentages of corresponding positions when comparisons and pairwise alignments are maximized. The identity of nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. Percentage homology or identity can be determined using any suitable software program known in the art, for example, as described in Current Protocols in Molecular Biology (FMAusubel, et al., (eds) 1987, Supplement 30, section 7.7.18). Optional procedures include the GCGPileup procedure, such as FASTA (Pearson, et al., 1988 Proc. Natl. Acad. Sci. USA 85:2444-2448) and BLAST (B LASTManual, Altschul et al. Natl. Cent Biotechnol. linf.. NatLib Med. (NCIB NLM NIH), Bethesda, Md.. and Altschul et al., 1997 NAR25:3389-3402). Another optional alignment procedure is ALIGN Plus (Scientific and Educational Software, PA), which preferably uses basic parameters. Another optional sequence software procedure that can be used here is the TFASTA data search procedure used in Sequence Software Package version 6.0 (Genetics Computer Group, University of Wisconsin, Madison W). Examples of commonly used sequence alignment algorithms include, but are not limited to, CLUSTAL Omega, EMBOSS Needle, MAFFT, or MUSCLE.

[0047] Some embodiments of this application provide a genetically engineered bacterium that produces lactose-N-neotetrasaccharide, which satisfies the following conditions:

[0048] (1) Exogenous expression of MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyltransferase;

[0049] (2) Overexpression of galactosidase and UDP-galactose-4-epimerase; and

[0050] (3) Do not express or reduce the expression of setA transporter protein.

[0051] In some embodiments, the gene encoding the setA transporter is the setA gene. This transporter can efflux glucose, lactose, certain monosaccharides and disaccharides, as well as inducible molecules such as isopropyl-β-D-thiogalactoside; and it has broad substrate specificity, preferring glycosides or galactosides with alkyl or aryl substituents. Understandably, reducing or completely suppressing the expression of the setA transporter in genetically engineered bacteria can effectively reduce the extracellular escape of the intermediate product LNT II during the production of lactose-N-neotetrasaccharide.

[0052] In this application, MFS protein refers to the major facilitator superfamily, which can promote the transport of substances such as human milk oligosaccharides (HMOs), including lactose-N-neotetrasaccharide, across the cell membrane.

[0053] In this application, "overexpression" refers to a protein expression level that is higher than the natural expression level of the genetically engineered bacteria.

[0054] In some embodiments, the setA gene is knocked out, causing the setA transporter protein to be unexpressed or attenuated. Optionally, the sequence of the knocked-out setA gene is shown in SEQ ID NO:45.

[0055] As an example, knockout methods include at least one of homologous recombination and CRISPR gene editing.

[0056] This application does not impose any particular restrictions on the method of gene knockout, as long as it can achieve the purpose of this application.

[0057] In some embodiments, the genetically engineered bacteria may also contain overexpressed β-1,4-galactosyltransferase.

[0058] In some embodiments, the gene encoding β-1,3-N-acetylglucosamine transferase is the lgtA gene; alternatively, the nucleotide sequence encoding β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO:2.

[0059] In some embodiments, the nucleotide sequence encoding β-1,3-N-acetylglucosamine transferase has at least 80% homology with SEQ ID NO:2. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology.

[0060] In some embodiments, the gene encoding β-1,4-galactosyltransferase is the lgtB gene; alternatively, the nucleotide sequence encoding β-1,4-galactosyltransferase is shown in SEQ ID NO:3.

[0061] In some embodiments, the nucleotide sequence encoding β-1,4-galactosyltransferase has at least 80% homology with SEQ ID NO:3. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology.

[0062] β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyltransferase are two key glycosyltransferases in the lactose-N-neotetrasaccharide synthesis pathway. β-1,3-N-acetylglucosamine transferase catalyzes the transfer of N-acetylglucosamine (GlcNAc) derived from uridine-5'-bisphosphate-GlcNAc (UDP-GlcNAc) to the 3'-OH position at the end of an N-acetyllactosamine derivative, forming an N-acetyllactosamine polysaccharide chain; and synthesizes LNT-II using lactose as the acceptor and GlcNAc as the donor. β-1,4-galactosyltransferase (β-1,4-GalT) catalyzes the transfer of galactosyl groups from lactose to LNT-II, and synthesizes lactose-N-neotetrasaccharide (LNnT) using UDP-galactose and LNT-II as substrates.

[0063] In some embodiments, the amino acid sequence of galactosidase is accessed at NCBI (National Center for Biotechnology Information) under accession number NP_414877.1. Understandably, galactosidase is capable of specifically catalyzing the breakdown of lactose into galactose and glucose, thereby providing sufficient reaction substrates for the synthesis pathway of lactose-N-neotetrasaccharide.

[0064] In some embodiments, the gene encoding galactosidase is the lacY gene; alternatively, the nucleotide sequence encoding galactosidase is shown in SEQ ID NO:4.

[0065] In some embodiments, the nucleotide sequence encoding galactosidase has at least 80% homology with SEQ ID NO:4. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology.

[0066] In some embodiments, the amino acid sequence of UDP-galactose-4-epimerase is accessed in NCBI (National Center for Biotechnology Information) under accession number NP_415280.3. Understandably, UDP-galactose-4-epimerase catalyzes the epimerization of UDP-glucose to UDP-galactose; therefore, overexpression of UDP-galactose-4-epimerase in genetically engineered bacteria can increase the accumulation of UDP-galactose. Under the action of β-1,3-N-acetylglucosamine transferase, UDP-galactose reacts with the intermediate lactose-N-trisaccharide II as a substrate to generate lactose-N-neotetrasaccharide; thereby increasing the consumption of lactose-N-trisaccharide II, reducing its residue, and increasing the yield of lactose-N-neotetrasaccharide.

[0067] In some embodiments, the gene encoding UDP-galactose-4-epimerase is the galE gene; alternatively, the nucleotide sequence encoding UDP-galactose-4-epimerase is shown in SEQ ID NO:5.

[0068] In some embodiments, the nucleotide sequence encoding UDP-galactose-4-epimerase has at least 80% homology with SEQ ID NO:5. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology.

[0069] In some embodiments, the MFS transporter includes one or more of the following proteins: bad protein, fred protein, nec protein, marc protein, and vag protein.

[0070] In some embodiments, the amino acid sequence of the vag protein is registered in NCBI (National Center for Biotechnology Information) under accession number WP_048785139.1.

[0071] In some embodiments, the nucleotide sequence encoding the VAG protein is as shown in SEQ ID NO:1. In other examples, the nucleotide sequence encoding the VAG protein has at least 80% homology with SEQ ID NO:1. For example, it has homology of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0072] Understandably, the types of integration vectors and expression vectors can also be other integration vectors and expression vectors commonly used in the field, and this application does not impose any particular limitation.

[0073] In some embodiments, the integration vector for the MFS transporter, β-1,3-N-acetylglucosamine transferase, and β-1,4-galactosyltransferase may be selected from pSPIN.

[0074] In some embodiments, the expression vectors for galactosidase and UDP-galactose-4-epimerase can be selected from pETDuet-1, pCDFDuet-1, or pRSFDuet-1.

[0075] In the genetically engineered bacteria of this application, the extracellular transport of LNnT is promoted by introducing exogenous MFS transporter protein, the conversion of LNT II to LNnT is promoted by increasing the expression level of UDP-galactose-4-epimerase, and the extracellular escape of LNT II is reduced by decreasing the expression level of setA transporter protein, thereby enhancing the yield of LNnT and reducing the residual amount of LNT II in the product.

[0076] The genetically engineered bacteria described in this application can be any host cell commonly used in the art, and there are no particular limitations. Host cells include prokaryotic and / or eukaryotic cells. In some optional examples, they can be bacterial or yeast cells, such as *Escherichia coli*, *Bacillus subtilis*, etc.; in other optional examples, they can be eukaryotic cells, such as yeast cells, plant cells, insect cells, and animal cells, such as mammalian cells (e.g., mouse cells, human cells, etc.). For bacterial host cells, there are no limitations in principle; they can be eubacteria (Gram-positive or Gram-negative bacteria) or archaea, as long as they allow for the insertion of the gene of interest for genetic modification and can be cultured on a production scale.

[0077] For example, bacteria could be *Escherichia coli*, *Klebsiella oxytoca*, *Anaerobiospirillum succiniciproducens*, *Actinobacillus succinogenes*, *Mannheimia succiniciproducens*, *Rhizobium etli*, *Bacillus subtilis*, *Bacillus methanolicus*, *Corynebacterium glutamicum*, *Gluconobacter oxydans*, *Zymomonas mobilis*, *Lactococcus lactis*, *Lactobacillus plantarum*, and *Streptomyces*. *Clostridium acetobutylicum*, *Pseudomonas fluorescens*, or *Pseudomonas putida* can be used. Yeasts or fungi can include *Saccharomyces cerevisiae*, *Schizosaccharomyces pombe*, *Kluyveromyces lactis*, *Kluyveromyces marxianus*, *Aspergillus terreus*, *Aspergillus niger*, *Pichiapastoris*, *Rhizopus arrhizus*, or *Yarrowialipolytica*, etc.

[0078] In some embodiments, the genetically engineered bacterium is *Escherichia coli*; the *Escherichia coli* may be *Escherichia coli* BL21(DE3). More optionally, it may be *Escherichia coli* BL21 star(DE3).

[0079] The genetically engineered bacteria of this application can adapt to a variety of chassis cells, and the modification of chassis cells is simplified, which enables the genetically engineered bacteria to have good stability in subsequent passage and application.

[0080] In some embodiments, the genetically engineered bacteria include one or more of the following genes: wcaJ, lacZ, fucIK, nagB, and wecB, which are inactivated or deleted. For example, the genome of the genetically engineered bacteria may include one, two, three, four, or five of the following genes: wcaJ, lacZ, fucIK, nagB, and wecB, which are inactivated or deleted.

[0081] Optionally, the genome of the genetically engineered bacteria includes the inactivation or deletion of the wcaJ gene, lacZ gene, and fucIK gene.

[0082] Optionally, the genome of the genetically engineered bacteria includes the inactivation or deletion of the nagB, wecB, and lacZ genes.

[0083] In some embodiments, the genetically engineered bacteria may also contain other genes that are inactivated or deleted, or other genes that are overexpressed, as long as the above-mentioned objectives of this application can be achieved.

[0084] Understandably, in this application, "inactivation" means that the relevant gene is not expressed or its expression activity is reduced; "deletion" means that all or part of the coding segment of the relevant gene is missing; this application does not particularly limit the manner of gene inactivation and gene deletion, and any method commonly used in the art can be used.

[0085] Further modifications to the chassis cells can effectively increase the synthesis rate and fermentation yield of lactose-N-neotetrasaccharide.

[0086] Understandably, the genetically engineered bacteria in this application can be either modified chassis cells or unmodified chassis cells, as long as they can achieve the technical effects of this application. For example, the genetically engineered bacteria in this application can also be selected from various types of chassis cells that have already been modified in conventional techniques.

[0087] In some embodiments, the genome of the genetically engineered bacteria may further include expression regulatory elements such as promoters, enhancers, and terminators to improve gene expression levels, expression efficiency, product activity, and other performance aspects. Any promoter, enhancer, and terminator known in the art can be applied to the genetically engineered bacteria of this application, as long as they can achieve the technical effects of this application. As an example, the promoter may be the T7 promoter.

[0088] In some embodiments, the genome of the genetically engineered bacteria also includes endogenous nucleic acid fragments, including nucleic acid molecules that have been modified but not removed from the strain; the modification methods include, but are not limited to, gene substitution, site-specific mutations, etc.

[0089] In some embodiments, the insertion sites for the MFS transporter, β-1,3-N-acetylglucosamine transferase, and β-1,4-galactosyltransferase are yjiP, hlyE, wecB, nagB, lacZ, setA, gloA, ugd, or IS186.

[0090] A second aspect of this application provides a method for constructing a genetically engineered bacterium that produces lactose-N-neotetrasaccharide, as described in the first aspect above, comprising steps S10, S20, and S30.

[0091] Step S10: Introduce the integration vector expressing MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyltransferase into the genetically engineered bacteria to be modified.

[0092] Step S20: De-express or reduce the expression of the setA transporter protein in the genetically engineered bacteria to be modified.

[0093] Step S30: The recombinant vector overexpressing galactosidase and UDP-galactose-4-epimerase is introduced into the genetically engineered bacteria to be modified to construct a genetically engineered bacteria that produces lactose-N-neotetrasaccharide.

[0094] This application does not impose any particular restrictions on the execution order of steps S10, S20 and S30, as long as the purpose of this application can be achieved.

[0095] Understandably, the definitions of MFS transporter, β-1,3-N-acetylglucosamine transferase, β-1,4-galactosyltransferase, galactosylpermease, and UDP-galactose-4-epimerase are as defined in the first aspect of this application.

[0096] In some implementations, the setA gene is knocked out to prevent or reduce the expression of the setA transporter protein in the genetically engineered bacteria to be modified.

[0097] In some implementations, the knockout method includes, but is not limited to, at least one of homologous recombination and CRISPR gene editing.

[0098] This application does not impose any particular limitation on the method for constructing the expression vector; it can be any method commonly used in the art, such as double enzyme digestion or homologous recombination. In this application, the method for introducing the expression vector into the chassis cells is not particularly limited, as long as it can introduce the recombinant expression vector into the chassis cells. The methods for introduction include, but are not limited to, heat shock, electroporation, calcium ion exchange, and protoplast methods.

[0099] A third aspect of this application provides a method for preparing lactose-N-neotetrasaccharide, comprising the following steps:

[0100] The genetically engineered bacteria mentioned in the first aspect were fermented to prepare lactose-N-neotetrasaccharide.

[0101] Understandably, this application does not impose any particular limitation on the fermentation culture method or the type of culture medium used for fermentation culture; any method and culture medium commonly used in the art can be used.

[0102] In some embodiments, the fermentation medium comprises peptone, yeast extract, (NH4)2SO4, K2HPO4, KH2PO4, glycerol, citric acid, antifoaming agent, glucose, MgSO4·7H2O, anhydrous CaCl2, 1000× vitamin B1, and hyponitrotriacetic acid.

[0103] A fourth aspect of this application provides a method for producing dairy products, comprising the following steps:

[0104] Lactose-N-neotetrasaccharide was prepared using the preparation method described in the third aspect above; and

[0105] Dairy products are prepared using lactose-N-neotetrasaccharide.

[0106] Understandably, the method of preparing dairy products using lactose-N-neotetrasaccharide can be any method commonly used in the art, and this application does not impose any particular limitation on it.

[0107] The present application will be further described below with reference to specific embodiments and comparative examples, but these should not be construed as limiting the scope of protection of the present application. Unless otherwise specified, the raw materials involved in the following specific embodiments are all commercially available, the instruments used are all commercially available, and the processes involved are conventionally selected by those skilled in the art unless otherwise specified.

[0108] Example 1:

[0109] (1) Modification of chassis strains

[0110] Escherichia coli BL21 star(DE3) was selected as the recipient strain. The lacZ, fucIK and wcaJ genes in Escherichia coli BL21 star(DE3) were knocked out to obtain the chassis strain BL21 star(DE3)ΔlacZΔfucIKΔwcaJ.

[0111] The detailed steps for knocking out the lacZ gene are as follows:

[0112] (a) A 20bp sequence with NGG (N is any nucleotide) at the 3' end was selected from the lacZ gene of Escherichia coli as the target site N20 for CRISPR-Cas9 knockout.

[0113] (b) Insert the N20 fragment into the pGRB vector to obtain the plasmid pGRB-lacZ.

[0114] (c) The recombinant plasmid pGRB-lacZ was transformed into Escherichia coli DH5α by the calcium chloride chemical transformation method. Then, it was plated on LB plates containing ampicillin for screening culture. After being incubated at 37°C overnight, single colonies were picked for colony PCR. Positive clones were verified by LB liquid amplification culture, plasmid extraction and sequencing. The recombinant expression vector with correct sequencing results was named recombinant plasmid pGRB-lacZ.

[0115] (d) Take about 300bp to 500bp sequences from upstream and downstream of the lacZ gene as knockout homologous arms. After PCR amplification and clean recovery, the upstream homologous arm lacZ-UP (amplified using primers with nucleotide sequences as shown in SEQ ID NO: 6 to 7) and the downstream homologous arm lacZ-DOWN (amplified using primers with nucleotide sequences as shown in SEQ ID NO: 8 to 9) are obtained.

[0116] SEQ ID NO: 6 (lacZ-UP-F): gcccgagtttgtcagaaagc.

[0117] SEQ ID NO: 7 (lacZ-UP-R): atactgtcgttcaacatcagccgctacagt.

[0118] SEQ ID NO: 8 (lacZ-DOWN-F): ctgatgttgaacgacagtatcggcctcagg.

[0119] SEQ ID NO: 9 (lacZ-DOWN-R): cccaatacgcaaaccgcctc.

[0120] (e) Homo-lacZ was obtained by fusing the upstream homologous arm lacZ-UP and the downstream homologous arm lacZ-DOWN using overlap extension PCR.

[0121] (f) Preparation of knockout chassis electrocompetent cells: pREDCas9 plasmid was introduced into chassis cells BL21 star(DE3) to obtain BL21 star(DE3)-Cas9 cells. BL21 star(DE3)-Cas9 cells were seeded into 5 mL of LB liquid medium containing streptomycin resistance and cultured at 30 °C and 200 rpm for 16 h. BL21 star(DE3)-Cas9 cells were then seeded at a ratio of 1% (v / v) into 200 mL of LB liquid medium containing streptomycin resistance and cultured until OD... 600To a concentration of 0.1, add 1 mM IPTG and continue culturing until OD. 600 =0.4. Immediately place the cultured bacterial solution in an ice bath for 15 min. Collect the cells by centrifuging at 5000 rpm for 10 min in a pre-chilled centrifuge at 4°C. Wash the cells with sterile water and resuspend them in 2 mL of pre-chilled 10% glycerol to obtain BL21star(DE3)-Cas9 competent cells.

[0122] (g) Knockout of the lacZ gene in the chassis strain: The homology repair template Homo-lacZ and the recombinant plasmid pGRB-lacZ were introduced into BL21 star(DE3)-Cas9 competent cells, and single clones were screened using plates containing streptomycin and ampicillin. Positive clones were screened by colony PCR and verified using primer pairs with nucleotide sequences as shown in SEQ ID NO:10-11.

[0123] SEQ ID NO: 10 (lacZ-yz-F): aacggcgcaaacatcactaac.

[0124] SEQ ID NO: 11 (lacZ-yz-R): gctgttgcccgtctcactgg.

[0125] The fucIK and wcaJ genes were knocked out using the same method as the lacZ gene knockout, resulting in chassis strains with lacZ, fucIK, and wcaJ gene knockouts. The specific primer pairs and DNA sequence information used are as follows.

[0126] SEQ ID NO: 12 (fucIK-UP-F): tgtttcggacattgcagctttc.

[0127] SEQ ID NO: 13 (fucIK-UP-R): gtcagttcactcatcaggattcctcatctc.

[0128] SEQ ID NO: 14 (fucIK-DOWN-F): atcctgatgagtgaactgactgaatgccac.

[0129] SEQ ID NO: 15 (fucIK-DOWN-R): gcgctgttctgtagcgtacc.

[0130] SEQ ID NO: 16 (fucIK-yz-F): cacgtcattaagcgccaacactcc.

[0131] SEQ ID NO: 17 (fucIK-yz-R): cggtatgccaacgggtaagc.

[0132] SEQ ID NO: 18 (wcaJ-UP-F): acctgttggtggcgctgattac.

[0133] SEQ ID NO: 19 (wcaJ-UP-R): gaactcgacgctcgaccagttgttgcagattg.

[0134] SEQ ID NO: 20 (wcaJ-DOWN-F): actggtcgagcgtcgagttcgaccttgagt.

[0135] SEQ ID NO: 21 (wcaJ-DOWN-R): ggatcaccacaaacgccagc.

[0136] SEQ ID NO: 22 (wcaJ-yz-F): ccggactatggctggtttgc.

[0137] SEQ ID NO: 23 (wcaJ-yz-R): ccgcgctggtttcgatcatg.

[0138] (2) Transposition integration of lgtA2-lgtB2-vag

[0139] (a) A 32bp (N32) sequence with a CC at the 5' end was selected from the yjiP target site in the Escherichia coli genome as sgRNA. The sgRNA was cloned into the BsaI restriction site of the pSPIN vector to obtain pSPIN-N32.

[0140] (b) The artificially synthesized lgtA2-lgtB2-vag fragment (i.e., the fragment obtained by sequentially linking the nucleotide sequences shown in SEQ ID NO:2, 3, 1) was cloned into the XhoI / PstI site of pSPIN-N32 by enzyme digestion and ligation to obtain the transposable integration plasmid pSPIN-N32-lgtA2-lgtB2-vag.

[0141] SEQ ID NO:1(vag):

[0142] atgaagagcctgctgacccgtaaacgtcgcattaatccggtgtttctggcctttatggcagcaagctttatgattggcgttgcaggcgcactgcag

[0143] gcaccgaccctgagcctgtttctgacccgtgaagtgcaggcccgtccgctgtgggttggcctgttttttaccgtgaatgccattgcaggtattgtgg

[0144] tgagcatgctggttgccaaacgcagcgatagccgcggcgatcgtcgtaccctgattctgttttgctgcgcaatggcattttgcaatgcactgctgtt

[0145] tgcatttacccgccattatctgaccctgattaccctgggcgtgctgctgagcgcactggcaagcgttagcatgccgcagatttttgccctggcacg

[0146] cgaatatgcagatcagagcgcccgcgaagcagttatgtttagcagtgtgatgcgcgcacagctgagcctggcctgggtgattggtccgccgct

[0147] gagctttgcactggcactgaattttggttttgttaccctgtttctggtggcagcagcactgtttctggtttgcattctgctgattaaatttaccctgccga

[0148] gcgtgccgcgcgccgaacctttaatgcgtagcggcggcatgccgctgagcggctggagagatcgtgatgttcgtctgctgtttattgccagtgtt

[0149] accatgtggacctgcaataccatgtatattattgatatgccgctgtatatcagtgtgaccctgggcctgccggaaaaactggcaggcctgctgatg

[0150] ggcaccgcagccggtctggaaattccggtgatgctgctggcaggtcattatgcaaaacgtgtgggcaaacgtaatctgatgctgattgccgtgg

[0151] cagccggtgttctgttttatgccggcctggccatgtttgccagccagaccgccctgatggccctgcagctgtttaatgcagtgtttattggcattattg

[0152] ccggtattggcatgctgtggtttcaggatctgatgccgggtcgcccgggtgcagccacaaccatgtttaccaatagcattagtaccggtatgattct

[0153] ggcaggcgttattcagggtaccctgagcgaacgctttggtcatattgccgtgtattggctggccctgggtctggcagttgccgcatttgccatgagcgcacgtgttaaaaatgtttaa。

[0154] SEQ ID NO:2(lgtA2):

[0155] atgggcagcagccatcaccatcatcaccacagccaggatccgatgccgagcgaagcctttcgtcgtcatcgtgcatatcgcgaaaataaactgc

[0156] agccgctggtgagcgtgctgatttgtgcatataatgtggaaaaatacttcgcccagagtctggccgccgttgtgaatcagacctggcgtaatctgg

[0157] atattctgattgttgatgatggtagtaccgatggcaccctggccattgcccagcgttttcaggaacaggatggccgtattcgcattctggcacagcc

[0158] gcgtaatagcggtctgattccgagtctgaatattggtctggatgaactggccaaaagcggtggcggcggtgaatatattgcacgcaccgatgcc

[0159] gatgatattgccgccccggattggattgaaaaaattgttggtgaaatggaaaaggatcgtagcattattgccatggggcgcctggctggaagttctg

[0160] agcgaagaaaaagatggtaatcgtctggcccgccatcatgaacatggcaaaatttggaaaaaaccgacccgtcatgaagatattgccgattttttt

[0161] ccgtttggtaatccgattcataataataccatgattatgcgtcgcagcgtgattgatggcggtctgcgctataataccgaacgtgattgggccgaag

[0162] attatcagttttggtatgatgttagcaaactgggtcgcctggcatattatccggaagcactggtgaaatatcgcctgcatgcaaatcaggttagtagt

[0163] aaatatagcattcgtcagcatgaaattgcacagggcattcagaaaaccgcccgcaatgattttctgcagagtatgggctttaaaaacccgctttgata

[0164] gcctggaatatcgccagattaaagccgtggcctatgaactgctggaaaaacatctgccggaaagattttgaacgtgcacgccgttttctgtatc

[0165] agtgctttaaacgtaccgataccctgccggccggcgcctggttagattttgcagcagatggccgtatgcgtcgtctgttttaccctgcgccagtattttggcattctgcatcgcctgctgaaaaaatcgctaa。

[0166] SEQ ID NO:3(lgtB2):

[0167] atgcgtgtttttatcatcagcctgaatcagaaagtttgcgatacctttggcctggtgtttcgcgataccaccaccctgctgaataatattaatgccacc

[0168] catcatcaggcacagatttttgatgcaatttatagtaagaccttcgaaggtggtctgcatccgctggtgaaaaaacatctgcatccgtattttattacc

[0169] cagaatattaaggatatgggcattaccaccaatctgattagtgaagttagcaaattttactacgcactgaaatatcatgcaaaatttatgagtctggg

[0170] cgaactgggttgttatgccagccattatagcctgtgggaaaaatgtattgaactgaatgaagccatttgtattctggaagatgatattaccctgaaag

[0171] aagattttaaggaaggcctggattttctggaaaaacatattcaggaactgggctatgtgcgtctgatgcatctgctgtatgatccgaatgttaaaagt

[0172] gaaccgctgaatcataaaaatcatgaaattcaggagcgcgttggcattattaaagcatatagccatggtgttggcacccagggttatgttattaccc

[0173] cgaaaattgcaaaagtttttaagaaacacagccgcaaatgggtggtgccggttgataccattatggatgccacctttattcatggcgttaaaaatct

[0174] ggtgctgcagccgtttgtgattgcagatgatgaacagattagcaccattgcacgtaaagaagaaccgtatagcccgaaaattgccctgatgcgtgaactgcattttaaatatctgaaatactggcagttcgtgtaa.

[0175] (c) Transposon integration: The transposon integration plasmid pSPIN-N32-lgtA2-lgtB2-vag was transformed into the chassis cells obtained in step (1) by electroporation, plated on LB plates containing kanamycin, and cultured overnight at 37°C; transformants were randomly selected for colony PCR verification, and homozygous strains with only integration bands were screened for sequencing verification, and the loss of transposon plasmid was verified using resistant medium.

[0176] (3) Knockout of the setA gene: The setA gene in the chassis cells of step (2) was knocked out using the same method as the knockout of the lacZ gene in step (1). The specific primer pairs and DNA sequence information used are as follows. The sequence of the knocked-out setA gene is shown in SEQ ID NO:41.

[0177] SEQ ID NO: 24 (setA-UP-F): gtctttaaccgaggcttacgccgatcccag.

[0178] SEQ ID NO: 25 (setA-UP-R): ttaccgcgacagcgaagttg.

[0179] SEQ ID NO: 26 (setA-DOWN-F): aacttcggctgtggctcttc.

[0180] SEQ ID NO: 27 (setA-DOWN-R): cgtaagcctcggttaaagacgtttgatgacgtgg.

[0181] SEQ ID NO: 28 (setA-yz-F): tgttgcagacgagcagatgg.

[0182] SEQ ID NO: 29 (setA-yz-R): cgcagtatcagggcgcttcc.

[0183] SEQ ID NO:30

[0184] tggttggcaaaacgttctgacagtcagggcgatcggcgaaaactgattatattttgctgtttgatggctatcggcaatgcgctattgtttgcatttaatcgtcattatctgacgcttatcacctgtggtgtgcttctggcatctctggccaatacggcaatgccacagttatttgctctggcgcgggaatatgcggataactcggcgcgagaagtggtgatgtttagctcggtgatgcgtgcgcagctttctctggcatgggttatcggtccaccgttggcctttatgctggcgttgaattacggctttacggtgatgttttcgattgccgccgggatattcacactcagtctggtattgattgcatttatgcttccgtctgtggcgcgggtagaactgccgtcggaaaatgctttatcaatgcaaggtggctggcaggatagtaacgtacggatgttatttgtcgcctcgacgttaatgtggacctgcaacaccatgtacattattgatatgccgttgtggatcagtagcgagttaggattgccagacaaactggcgggtttcctgatggggacggcagctggtctggaaataccagcaatgattctggctggctactatgtcaaacgttatggtaagcggcgaatgatggtcatagcagtggcggcaggagtactgttttacaccggattgattttatttcatagccgtctggcgttgatgacgctgcaactttttaacgctgtatttatcggcattgttgcgggtattgggatgctatggtttcaggatttaatgcctggaagagcgggggcagctaccaccttatttactaacagtatttctaccggggtaattctggctggcgttattcagggagcaattgcacaaagttgggggcactttgctgtctactgggtaattgcggttatttctgttatcgcattatttttaaccgcaaa。

[0185] (4) Construct overexpression plasmids for lacY and galE.

[0186] (a) Using the genome of Escherichia coli BL21(DE3) as a template, the lacY gene was amplified by PCR (the amplification primers are shown in SEQ ID NO:31-32). The nucleotide sequence of the amplified lacY gene fragment is shown in SEQ ID NO:4. The lacY gene fragment was cloned into the NcoI and HindⅢ sites of the vector pETDuet-1 to obtain the recombinant expression vector pET-lacY.

[0187] SEQ ID NO:4 (lacY gene fragment)

[0188] ctttaagaaggagatataccatggatgtattacctaaaaaacacaaatttttggatgttcggcttgttcttctttttctacttctttatcatgggcgcgtact

[0189] tcccgtttttcccgatttggctgcatgatattaaccacatttccaaatcggacacacggtattatttttgcggcaattagcctcttcagcttgctgttccaa

[0190] ccgctgtttggcctgctgagtgataaactgggcttgcgcaaatatctcctttggattatcaccggtatgctggtgatgttcgctccgttctttatcttcat

[0191] ctttggtccgctgctgcaatataacattctggtaggcagcattgttggtggtatttatttaggttttgcttcaacgctggtgctccggcggtggaagc

[0192] ctttatcgaaaaagttagccgtagaagcaatttcgagttcggccgtgcgcgtatgttcggctgcgtgggctgggcactgtgtgcatccatcgtggg

[0193] tatcatgttcaccataaacaaccagtttgtcttctggctgggttccgggtgcgcacttatcttggcggtgctgctgtttttcgctaaaaccgacgcacc

[0194] gagcagcgcgacggttgcgaatgctgtgggtgcgaatcatagcgcgttttcccttaagttggcgttggagctcttccgccaaccgaagttatggtt

[0195] tctctctctgtacgtgatcggtgtttcttgtacctacgacgtttttgatcagcaatttgcgaacttttttacttccttcttcgccaccggcgagcagggtac

[0196] gcgtgtttttggctatgttaccaccatgggcgaactgttgaatgcgagcatcatgtttttcgcgcctctgatcatcaaccgtattggcggtaaaaacg

[0197] ccttgctgttggcgggtacgatcatgtccgtgcgcatcatcggctcgagctttgcgacttctgcgcttgaggtagttatcctcaagaccctgcacat

[0198] gttcgaggttccgttcctgttggttggttgctttaagtacattacctcgcaatttgaggtgcgttttagtgccacgatttacttggtctgtttctgcttcttc

[0199] aagcagctggctatgattttcatgagcgttctggctggtaacatgtatgaatctattggctttcagggcgcgtacctggtgctgggcttagtggcact

[0200] gggtttcaccctgatcagcgtctttaccctgagcggtccgggtccactgagcctgctgcgtcgccaggttaatgaagtggcctaaaagcttgcggccgcataatg。

[0201] SEQ ID NO:31(lacY-cz-F):ctttaagaaggagatataccatggatgtattacctaaaaaacac。

[0202] SEQ ID NO: 32 (lacY-cz-R): cattatgcggccgcaagcttttaggccacttcattaacctgg.

[0203] (b) Using the artificially synthesized galE gene fragment (nucleotide sequence as shown in SEQ ID NO:5) as a template, amplification was performed using the primer pairs shown in SEQ ID NO:33-34 to obtain the galE fragment; the galE fragment was cloned into the NdeI and AvrⅡ sites of the pET-lacY vector to obtain the recombinant expression vector pET-lacY-galE. The recombinant expression vector pET-lacY-galE was introduced into the chassis cells constructed in step (3).

[0204] SEQ ID NO:5 (Artificially synthesized galE gene fragment)

[0205] gaaggagatatacatatgaacatcctggtgaccggtggcaccggttttattggcagccataccgtggtgagtctgctgaaaagtggccatcaggt

[0206] tgttatctggataatctgtgcaatagcagcattaatattctgccgcgtctgaaaaccattaccggtcaggaaattccgttttatcagggtgatattcgt

[0207] gatcgcgaaattctgcgtcgtatttttgcagaaaatcgcattgatagcgttattcattttgcaggtctgaaagccgtgggcgaaagtgttgccgaacc

[0208] gattaaatattatgataataacgtgagcggcagcctggtgctggcagaagaaatggcccgcgcaggtgtgtttagcattgtgtttagtagtagtgc

[0209] aaccgtgtatggcgatccgggtaaagttccgtataccgaagatatgccgccgggcgataccaccagcccgtatggtgccagcaaaagcatggt

[0210] tgaacgcattctgaccgatattcagaaagcagatccgcgctggagcatgattctgctgcgttattttaatccgattggcgcccatgaaagcggtctg

[0211] attggtgaacagccgaatggcattccgaataatctgctgccgtatatttgccaggttgcagcaggcaaactgccgcagctggcagtttttggtgat

[0212] gattatccgaccccggatggcaccggtatgcgtgattatattcatgtgatggatctggccgaaggccatgttgccgcaatgcaggccaaaagtaa

[0213] tgttgcaggtacccatctgctgaatctgggtagtggtcgcgccagcagtgttctggaaattattcgtgcatttgaagcagccagcggcctgaccatt

[0214] ccgtttgaaattaaaccgcgccgcgccggcgatctggcctgtttttatgccgatccgagttataccaaagcacagattggttggcagacccagcgtgatctgacccagatgatggaagatagttggcgctgggttagcaatcatccgaatggttatgatgattaacctaggctgctgccaccg.

[0215] SEQ ID NO: 33 (galE-cz-F): gaaggagatatacatatgaacatcctggtgaccggtg.

[0216] SEQ ID NO: 34 (galE-cz-R): cggtggcagcagcctaggttaatcatcataaccattcgg.

[0217] The genetically engineered bacteria finally constructed in this embodiment contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector, and the setA gene, lacZ gene, fucIK gene and wcaJ gene are knocked out in the chassis strain.

[0218] (5) Fermentation yield verification

[0219] (a) The constructed genetically engineered bacteria were inoculated into LB medium for activation culture to obtain seed culture.

[0220] (b) The seed culture obtained in step (a) is transferred into a fermenter containing fermentation medium. The initial culture temperature is 37°C, the rotation speed is 250 rpm, the aeration rate is 35 NL / min, the tank pressure is 0.06 MPa, and the dissolved oxygen content is controlled to be greater than 2 mg / L.

[0221] The fermentation medium formula includes: 150g peptone, 50g yeast extract, 100g (NH4)2SO4, 230g K2HPO4, 205g KH2PO4, 250g glycerol, 7.5g citric acid, 5mL defoamer, 250g glucose, 50g MgSO4·7H2O, 0.5g anhydrous CaCl2, 25mL 1000× vitamin B1, 250mL hyponitrotriacetic acid, and ddH2O to a final volume of 20L; pH value is 6.8.

[0222] (c) When the initial glycerol is completely depleted during fermentation, glycerol is added to the fermenter at a rate of 3.4 g / L / h, and the culture temperature is 30°C.

[0223] (d) When the carbon source in the substrate is depleted and dissolved oxygen recovers, start replenishing the carbon source. Four hours after replenishing the carbon source, add the inducing agent IPTG and feed lactose. Monitor the lactose content and consumption, and control the lactose content in the fermentation broth to be between 10g / L and 20g / L.

[0224] (e) The yield of LNnT and the residual amount of LNT II in the fermenter after 112 h of culture were detected by HPLC. The results are shown in Table 1. The specific detection parameters and methods are as follows.

[0225] Reagents: sulfuric acid (chromatographic grade), pure water.

[0226] Instrument: High performance liquid chromatograph with differential detector (HPLC-RID).

[0227] Liquid chromatography conditions: Bio-Rad column ( HPX-87H column, 4.6×250mm, 5-Micron), column temperature 60℃, 5mmol sulfuric acid aqueous solution as mobile phase isocratic elution, run for 20min, flow rate 0.5mL / min, detector temperature 40℃, injection volume 20μL.

[0228] Preparation of standard solution: Accurately weigh 50 mg (accurate to 0.1 mg) of LNnT / LNTⅡ standard into a 50 mL volumetric flask, dilute to volume with pure water, and shake well. Pipette 4 μL, 20 μL, 100 μL, 500 μL, and 1000 μL of the standard into 1.5 mL vials, respectively. Then add 996 μL, 980 μL, 900 μL, 500 μL, and 0 μL of pure water to the corresponding vials, respectively. Mix well and load onto the instrument. The corresponding standard curve range is 4 μg / mL to 1000 μg / mL.

[0229] Sample preparation: Centrifuge 10 mL of fermentation broth at 12000 r / min for 15 min and collect the supernatant. Dilute the supernatant with pure water to the range of the standard curve, and filter the mixed sample through a 0.22 μm aqueous filter membrane before testing.

[0230] Example 2:

[0231] Compared with the genetically engineered bacteria constructed in Example 1, the genetically engineered bacteria constructed in this example also contain an IgTB overexpression vector. The construction method and introduction method of the IgTB overexpression vector are as follows:

[0232] Using the artificially synthesized lgtB gene fragment (shown in SEQ ID NO:3) as a template, the lgtB fragment was amplified using the primer pairs shown in SEQ ID NO:35-36; the lgtB fragment was cloned into the NcoI and AvrⅡ sites of the vector pCDFDuet-1 to obtain the recombinant expression vector pCDFDuet-lgtB.

[0233] SEQ ID NO: 35 (lgtB-cz-F): ctttaataaggagatataccatgcgtgtttttatcatcagcc.

[0234] SEQ ID NO: 36 (lgtB-cz-R): cggtggcagcagcctaggttacacgaactgccagtatttc.

[0235] The genetically engineered bacteria finally constructed in this embodiment contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector, the pET-lacY-galE expression vector, and the pCDFDuet-lgtB overexpression vector, and the setA gene, lacZ gene, fucIK gene, and wcaJ gene are knocked out in the chassis strain.

[0236] Example 3:

[0237] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is the chassis cell. Specifically, the chassis cell used in this example is BL21 star(DE3)ΔnagBΔwecBΔlacZ. The modification method of BL21 star(DE3)ΔnagBΔwecBΔlacZ is as described in step (1) of Example 1, wherein the knockout steps of the nagB gene and the wecB gene are as described in the lacZ gene knockout step. The specific primer pairs and DNA sequence information used are as follows.

[0238] SEQ ID NO: 37 (nagB-UP-F): accatgatcgcttttggatgctgaacgcattgatacgattg.

[0239] SEQ ID NO: 38 (nagB-UP-R): cctgggcaataaacgcaac.

[0240] SEQ ID NO: 39 (nagB-DOWN-F): gcctgattcggatgttttgc.

[0241] SEQ ID NO: 40 (nagB-DOWN-R): caatcgtatcaatgcgttcagcatccaaaagcgatcatggt.

[0242] SEQ ID NO: 41 (nagB-yz-F): cggaccaacggttataggct.

[0243] SEQ ID NO: 42 (nagB-yz-R): gccagggtcactttggtaatg.

[0244] SEQ ID NO: 43 (wecB-UP-F): cctgaccatcaccatacgggcccttccagaatccgacag.

[0245] SEQ ID NO: 44 (wecB-UP-R): gtccaatgctccaggctcg.

[0246] SEQ ID NO: 45 (wecB-DOWN-F): cggcgtcataccaccaatc.

[0247] SEQ ID NO: 46 (wecB-DOWN-R): ctgtcggattctggaagggcccgtatggtgatggtcagg.

[0248] SEQ ID NO: 47 (wecB-yz-F): ccgccggatgaacagtattg.

[0249] SEQ ID NO: 48 (wecB-yz-R): aggcgaatcagttcccagac.

[0250] The genetically engineered bacteria finally constructed in this embodiment contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector, and the setA gene, lacZ gene, nagB gene and wecB gene are knocked out in the chassis strain.

[0251] Example 4:

[0252] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is the chassis cell. Specifically, the chassis cell used in this example is the unmodified BL21 star (DE3).

[0253] The genetically engineered bacteria finally constructed in this embodiment contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector, and the setA gene is knocked out in the chassis strain.

[0254] Comparative Example 1:

[0255] Compared with the genetically engineered bacteria constructed in Example 2, the only difference is that the setA gene was not knocked out in the chassis strain.

[0256] The genetically engineered bacteria finally constructed in this comparative example contained the pSPIN-N32-lgtA2-lgtB2-vag integration vector, the pET-lacY-galE expression vector, and the pCDFDuet-lgtB overexpression vector, and the lacZ, fucIK, and wcaJ genes were knocked out in the chassis strain.

[0257] Comparative Example 2:

[0258] Compared with the genetically engineered bacteria constructed in Example 2, the only difference is that the pET-lacY-galE expression vector is replaced with the pET-lacY expression vector; the specific construction method is the same as in Example 1.

[0259] The genetically engineered bacteria finally constructed in this comparative example contained the pSPIN-N32-lgtA2-lgtB2-vag integration vector, the pET-lacY expression vector, and the pCDFDuet-lgtB overexpression vector. Furthermore, the setA, lacZ, fucIK, and wcaJ genes were knocked out in the chassis strain.

[0260] Comparative Example 3:

[0261] In the genetically engineered bacteria constructed in this comparative example, the chassis cells were unmodified Escherichia coli BL21 star (DE3); and the genetically engineered bacteria that transposonized and integrated lgtA2-lgtB2 were constructed according to the method described in step (3) of Example 1.

[0262] The genetically engineered bacteria finally constructed in this comparative example contained only the pSPIN-N32-lgtA2-lgtB2 integration vector.

[0263] Comparative Example 4:

[0264] In the genetically engineered bacteria constructed in this comparative example, the chassis cells were unmodified Escherichia coli BL21 star (DE3); the genetically engineered bacteria that transposonized and integrated lgtA2-lgtB2-vag were constructed according to the method described in step (3) of Example 1.

[0265] The genetically engineered bacteria finally constructed in this comparative example contain only the pSPIN-N32-lgtA2-lgtB2-vag integration vector.

[0266] Comparative Example 5:

[0267] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the pSPIN-N32-lgtA2-lgtB2-vag integration vector is replaced with the pSPIN-N32-lgtA2-lgtB2 integration vector; the specific construction method is the same as in Example 1.

[0268] The genetically engineered bacteria finally constructed in this comparative example contained the pSPIN-N32-lgtA2-lgtB2 integration vector and the pET-lacY-galE expression vector, and the setA gene, lacZ gene, fucIK gene and wcaJ gene were knocked out in the chassis strain.

[0269] Comparative Example 6:

[0270] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the pET-lacY-galE expression vector is replaced with the pET-lacY expression vector; the specific construction method is the same as in Example 1.

[0271] The genetically engineered bacteria finally constructed in this comparative example contained the pSPIN-N32-lgtA2-lgtB2 integration vector and the pET-lacY expression vector, and the setA gene, lacZ gene, fucIK gene and wcaJ gene were knocked out in the chassis strain.

[0272] The final product yield and intermediate product residue of the genetically engineered bacteria constructed in Examples 1-4 and Comparative Examples 1-6 were tested according to the method described in step (5) of Example 1. The results are shown in Table 1.

[0273] Table 1

[0274]

[0275]

[0276] The only difference between the genetically engineered bacteria constructed in Comparative Example 1 and the genetically engineered bacteria constructed in Example 2 is that the setA gene was not knocked out. When these genetically engineered bacteria were used to ferment and produce LNnT, the LNnT fermentation yield in Comparative Example 1 was reduced and the residual amount of LNT II was significantly increased. Comparative Examples 2 and 6 did not contain overexpressed galE, resulting in a decrease in LNnT fermentation yield and a significant increase in the residual amount of LNT II. Comparative Example 3 did not contain overexpressed galE and lacY, did not contain vag, and the chassis strain was not modified, resulting in a significant decrease in LNnT fermentation yield. Comparative Example 4 did not contain overexpressed galE and lacY, and the chassis strain was not modified, resulting in a significant decrease in LNnT fermentation yield and a significant increase in the residual amount of LNT II. Comparative Example 5 did not contain vag protein, resulting in a significant decrease in LNnT fermentation yield and a significant increase in the residual amount of LNT II.

[0277] As shown in Table 1 above, the genetically engineered bacteria constructed in Examples 1 to 4 of this application, by overexpressing the galE gene and knocking out the setA gene, significantly improved the fermentation yield and fermentation rate of LNnT and reduced the residual amount of LNT II in the final product.

[0278] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0279] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this application should be determined by the appended claims.

Claims

1. A genetically engineered bacterium that produces lactose-N-neotetrasaccharide, characterized in that, The genetically engineered bacteria were modified as follows: (1) Exogenous expression of MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyltransferase; (2) Overexpression of galactosidase and UDP-galactose-4-epimerase; and (3) Do not express or reduce the expression of setA transporter protein; (4) The wcaJ gene, lacZ gene and fucIK gene of the genetically engineered bacteria are inactivated or deleted.

2. The genetically engineered bacterium for producing lactose-N-neotetrasaccharide according to claim 1, characterized in that, The setA transporter protein is either not expressed or its expression is reduced by knocking out the setA gene.

3. The genetically engineered bacterium for producing lactose-N-neotetrasaccharide according to claim 1, characterized in that, Knockout methods include at least one of homologous recombination and CRISPR gene editing.

4. The genetically engineered bacterium for producing lactose-N-neotetrasaccharide according to claim 1, characterized in that, The MFS transporter protein includes at least one of the following: bad protein, fred protein, nec protein, marc protein, and vag protein.

5. The genetically engineered bacterium for producing lactose-N-neotetrasaccharide according to claim 4, characterized in that, The genetically engineered bacteria satisfy at least one of the following conditions (1) to (5): (1) The nucleotide sequence encoding the vag protein is shown in SEQ ID NO:1; (2) The nucleotide sequence encoding the β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO:2; (3) The nucleotide sequence encoding the β-1,4-galactosyltransferase is shown in SEQ ID NO:3; (4) The gene encoding the galactosidase is the lacY gene, and the nucleotide sequence encoding the galactosidase is shown in SEQ ID NO:4; and (5) The gene encoding the UDP-galactose-4-epimerase is the galE gene, and the nucleotide sequence encoding the UDP-galactose-4-epimerase is shown in SEQ ID NO:

5.

6. The genetically engineered bacterium for producing lactose-N-neotetrasaccharide according to any one of claims 1 to 5, characterized in that, The genetically engineered bacteria include bacteria.

7. The genetically engineered bacterium for producing lactose-N-neotetrasaccharide according to claim 6, characterized in that, The bacteria include at least one of Escherichia coli and Bacillus subtilis.

8. The genetically engineered bacterium for producing lactose-N-neotetrasaccharide according to claim 7, characterized in that, The Escherichia coli includes Escherichia coli BL21(DE3).

9. The method for constructing a genetically engineered bacterium for producing lactose-N-neotetrasaccharide as described in any one of claims 1 to 8, characterized in that, Includes the following steps: An integrative vector expressing MFS transporter protein, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyltransferase was introduced into the genetically engineered bacteria to be modified. To prevent or reduce the expression of the setA transporter protein in the genetically engineered bacteria to be modified; Inactivate or delete the wcaJ, lacZ, and fucIK genes in the genetically engineered bacteria to be modified; and A recombinant vector overexpressing galactosidase and UDP-galactose-4-epimerase was introduced into the genetically engineered bacteria to be modified, thereby constructing the genetically engineered bacteria that produce lactose-N-neotetrasaccharide.

10. A method for preparing lactose-N-neotetrasaccharide, characterized in that, Includes the following steps: The genetically engineered bacteria according to any one of claims 1 to 8 are fermented to prepare lactose-N-neotetrasaccharide.

11. A method for producing dairy products, characterized in that, Includes the following steps: Lactose-N-neotetrasaccharide was prepared using the preparation method described in claim 10; and Dairy products are prepared using the lactose-N-neotetrasaccharide.

Images