An engineered bacterium for producing ectoine, its preparation method and application

Abstract

This invention provides an engineered bacterium for producing ectoine, its preparation method, and its application. The engineered bacterium is prepared using a method comprising the following steps: using *Corynebacterium glutamicum* as the starting strain, feedback inhibition by aspartate kinase LysC is relieved, the activity of the gene lysE encoding lysine efflux permease is reduced, and the ectoine synthesis gene cluster ectABC is expressed. Based on this, the activity of any one or at least two of the following—diaminobutyrate acetyltransferase EctA, pyruvate carboxylase Pyc, or aspartate kinase LysC—is enhanced, and / or the activity of any one or at least two of the following—maloquinone oxidoreductase Mqo or homoserine dehydrogenase Hom—is reduced to further increase ectoine yield.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an engineered bacterium for producing ectoine, its preparation method, and its application. Background Technology

[0002] Ectoine, chemically named 2-methyl-1,4,5,6-tetrahydropyrimidine-4-carboxylic acid, also known as tetrahydromethylpyrimidinecarboxylic acid, is a cell-produced osmotic pressure-compensating solute that helps maintain cellular osmotic pressure balance. It is widely present in many halophilic microorganisms and acts as a stabilizer to protect enzymes, DNA, cell membranes, and the entire cell under adverse conditions such as high temperature, hyperosmotic pressure, freeze-drying, and desiccation. Therefore, ectoine has significant application value and broad prospects in the fields of biopharmaceuticals, enzyme preparations, and pharmaceuticals. Furthermore, due to its significant anti-inflammatory, sun-protective, and moisturizing effects, it is one of the main active ingredients in many high-end cosmetics on the market. In 2020, the annual demand for ectoine was projected to exceed 20 tons, with a global market value of US$19 million, and is expected to grow at a CAGR of 6.4%.

[0003] Currently, ectoine is mainly produced through high-density fermentation using halophilic microorganisms in a process known as "bacterial milking," which involves repeated high-salt induction of synthesis and low-salt promotion of release to obtain high concentrations of ectoine. However, this production method has a long fermentation cycle and is cumbersome and complex. Furthermore, high-salt fermentation not only affects the lifespan of the fermentation vessel but also poses a significant challenge to the subsequent treatment of fermentation wastewater.

[0004] With the development of genetic engineering technology, researchers have attempted to genetically modify conventional fermentation hosts such as *E. coli* and *Corynebacterium glutamicum* to produce ectoine. Currently, a process has successfully achieved ectoine production using recombinant *E. coli* as chassis cells in a low-salt environment, achieving high yields. However, because *E. coli* itself produces endotoxins, and its main application markets are biopharmaceuticals and medical aesthetics, this has severely hindered its industrial development. Compared to *E. coli*, *Corynebacterium glutamicum* is a recognized strain suitable for safe microbial production, possessing advantages such as resistance to bacteriophage infection, fermentation stability, and no endotoxin production. Therefore, developing a high-yield ectoine-producing recombinant *Corynebacterium glutamicum* microorganism is of great practical significance for the industrial production and further market promotion of ectoine. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide an engineered microorganism for producing ectoine, its preparation method, and its applications. The engineered microorganism for producing ectoine described in this invention exhibits stable fermentation and high yield, and has significant application value in the industrial production of ectoine.

[0006] To achieve this objective, the present invention employs the following technical solution:

[0007] In a first aspect, the present invention provides an engineered bacterium for producing ectoine, wherein the engineered bacterium is prepared by a method comprising the following steps:

[0008] (1) Using Corynebacterium glutamicum as the starting strain, the feedback inhibition of aspartate kinase LysC was relieved.

[0009] (2) Reduce the activity of the gene lysE, which encodes lysine efflux permease;

[0010] (3) Expressing the ectoin synthesis gene cluster ectABC;

[0011] (4) Enhance the activity of any one or at least two of the following: diaminobutyric acid acetyltransferase EctA, pyruvate carboxylase Pyc, or aspartate kinase LysC, and / or reduce the activity of any one or at least two of the following: malate quinone oxidoreductase Mqo or homoserine dehydrogenase Hom, to further increase ectoin production.

[0012] Preferably, the Corynebacterium glutamicum is Corynebacterium glutamicum ATCC 13032.

[0013] Preferably, the release of feedback inhibition of aspartate kinase LysC is achieved through any one of the following methods (1) and (2):

[0014] (1) Introduce the LysC-S301Y site mutation;

[0015] (2) Introduce the LysC-T311I site mutation.

[0016] Preferably, the reduction of the activity of the gene lysE encoding lysine efflux permease is achieved by any one of the following methods (1), (2), and (3):

[0017] (1) Insert, delete, or replace one or more bases in the gene encoding the target enzyme to inactivate or reduce the activity of the target enzyme.

[0018] (2) Replace the transcriptional or translational regulatory elements of the gene encoding the target enzyme with regulatory elements with lower activity;

[0019] (3) The target enzyme is inactivated or its activity is reduced by means of techniques such as CRISPRi gene inhibition or antisense RNA.

[0020] Preferably, the expressed ectoin synthesis gene cluster ectABC is derived from Pseudomonas schlegelii.

[0021] Preferably, the nucleotide sequence of the ectoin synthesis gene cluster ectABC is shown in SEQ ID No. 45.

[0022] Preferably, the ectoin synthesis gene cluster ectABC is expressed via plasmid or chromosome integration.

[0023] Preferably, the enhancement of the activity of any one or at least two combinations of diaminobutyrate acetyltransferase EctA, pyruvate carboxylase Pyc, or aspartate kinase LysC is achieved through any one or more of the following methods (1) and (2):

[0024] (1) Increase the copy number of the gene encoding the target enzyme;

[0025] (2) Replace the transcriptional or translational regulatory elements of the gene encoding the target enzyme with more active regulatory elements.

[0026] Preferably, increasing the copy number of the coding gene for the target enzyme is achieved by introducing a plasmid carrying the coding gene and / or integrating the coding gene into the genome.

[0027] Preferably, the transcriptional or translational regulatory element is selected from any one or a combination of at least two of the promoter, ribosome binding site, or enhancer.

[0028] Preferably, the reduction of the activity of any one or a combination of two of malate quinone oxidoreductase Mqo or homoserine dehydrogenase Hom is achieved through any one or more of the following methods (1), (2), and (3):

[0029] (1) Insert, delete, or replace one or more bases in the gene encoding the target enzyme to inactivate or reduce the activity of the target enzyme.

[0030] (2) Replace the transcriptional or translational regulatory elements of the gene encoding the target enzyme with regulatory elements with lower activity;

[0031] (3) The target enzyme is inactivated or its activity is reduced by means of techniques such as CRISPRi gene inhibition or antisense RNA.

[0032] Preferably, the nucleotide sequence encoding the diaminobutyric acid acetyltransferase EctA is shown in SEQ ID No. 46.

[0033] Preferably, the nucleotide sequence encoding the aspartate kinase LysC is shown in SEQ ID No. 47.

[0034] Preferably, the nucleotide sequence encoding the malate quinone oxidoreductase Mqo is shown in SEQ ID No. 48.

[0035] Preferably, the nucleotide sequence encoding the homoserine dehydrogenase Hom is shown in SEQ ID No. 49.

[0036] Preferably, the nucleotide sequence encoding the pyruvate carboxylase Pyc is shown in SEQ ID No. 50.

[0037] Specifically, in this invention, feedback inhibition of aspartate kinase LysC is relieved by introducing a LysC-S301Y site mutation or a LysC-T311I site mutation.

[0038] Then, the gene encoding lysE, which encodes lysine efflux permease, is knocked out by SacB reverse screening, thereby reducing the activity of lysine efflux permease LysE.

[0039] Regarding the method of introducing plasmids carrying the coding gene of the target enzyme, these target enzymes can exist on the same plasmid or on different plasmids. The present invention has no particular limitations on the plasmid; any plasmid capable of cloning and expressing the target enzyme in the starting strain can be used. The present invention also has no particular limitations on the copy number of the plasmid; it can be a high-copy, medium-copy, or low-copy plasmid. For obtaining a high-yielding ectoine-producing strain, plasmids with a copy number of 10 to 100 are preferred.

[0040] Specifically, in this invention, the ectoin synthesis gene cluster ectABC is expressed using plasmid pXMJ19 as an expression vector. The ectoin synthesis gene cluster ectABC is derived from Pseudomonas schlegelii.

[0041] The activity of diaminobutyrate acetyltransferase EctA and / or aspartate kinase LysC was further enhanced by using plasmid pJC1 as an expression vector;

[0042] The activity of pyruvate carboxylase Pyc was enhanced by introducing a mutation at the pycP458S site and changing the start codon from gtg to atg. At the same time, the activity of the mutated pyruvate carboxylase PycP458S can be further enhanced by using the pJC1 plasmid vector.

[0043] The purpose of reducing the activity of homoserine dehydrogenase Hom was achieved by introducing a mutation at the homV59A site.

[0044] The activity of malate quinone oxidoreductase Mqo was reduced by introducing a mutation at the mqoW224taa site.

[0045] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0046] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout, thus obtaining an engineered bacterium that produces ectoin.

[0047] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0048] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-T311I mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout, thus obtaining an engineered strain that produces ectoin.

[0049] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0050] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and lysE gene knockout. Furthermore, the lysC gene with a serine mutated to tyrosine at position 301 was introduced through plasmid to achieve the goal of relieving the feedback inhibition of aspartate kinase LysC while increasing the activity of aspartate kinase LysC, thus obtaining an engineered strain that produces ectoin.

[0051] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0052] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout. Furthermore, the pycP458S mutation was introduced through homologous recombination, and the start codon was mutated from gtg to atg to improve the activity of pyruvate carboxylase Pyc, thus obtaining an engineered strain that produces ectoin.

[0053] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0054] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout. At the same time, the pyc gene, which mutates proline at position 458 to serine and simultaneously mutates the start codon from gtg to atg, was introduced through a plasmid to further enhance the activity of pyruvate carboxylase Pyc, thus obtaining an engineered strain that produces ectoin.

[0055] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0056] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout. Furthermore, by introducing a homV59A mutation, the activity of homoserine dehydrogenase Hom was reduced, resulting in an engineered strain that produces ectoin.

[0057] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0058] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout. Furthermore, by introducing the mqoW224taa mutation, the activity of malate quinone oxidoreductase Mqo was reduced, resulting in an engineered strain that produces ectoin.

[0059] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0060] Starting with Corynebacterium glutamicum ATCC 13032, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and lysE gene knockout. Furthermore, the ectA gene was introduced through plasmid to enhance the activity of diaminobutyrate acetyltransferase EctA, thus obtaining an engineered bacterium that produces ectoin.

[0061] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0062] Using Corynebacterium glutamicum ATCC 13032 as the starting strain, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout. Furthermore, by knocking out the ISCg2f gene and introducing another copy of lysCS301Y and another copy of pycP458S at the same site, an engineered strain that produces ectoin was obtained.

[0063] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0064] Starting with Corynebacterium glutamicum ATCC 13032, a LysC-S301Y mutation was introduced, and the gene lysE encoding lysine efflux permease was knocked out. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout. By knocking out the ISCg2f gene and introducing another copy of lysCS301Y and another copy of pycP458S at the same site, the ectA gene was further introduced through plasmid to enhance the activity of diaminobutyrate acetyltransferase EctA, thus obtaining an engineered bacterium that produces ectoin.

[0065] In one embodiment, the engineered bacteria that produce ectoine are prepared using a method comprising the following steps:

[0066] Starting with Corynebacterium glutamicum ATCC 13032, a LysC-S301Y mutation was introduced to knock out the lysE gene encoding lysine efflux permease. The ectoin synthesis gene cluster ectABC from Pseudomonas stutzeri was introduced into the mutant strain with the LysC-S301Y mutation and the lysE gene knockout. Further, by introducing homV59A and mqoW224taa mutations, the activities of homoserine dehydrogenase Hom and malate quinone oxidoreductase Mqo were reduced. Finally, the ectA gene was introduced via plasmid to enhance the activity of diaminobutyrate acetyltransferase EctA, resulting in an engineered strain that produces ectoin.

[0067] In this invention, the nucleotide sequence of the ectoin synthesis gene cluster ectABC is shown in SEQ ID No. 45. The nucleotide sequence encoding the diaminobutyrate acetyltransferase EctA is shown in SEQ ID No. 46. The nucleotide sequence encoding the aspartate kinase LysC is shown in SEQ ID No. 47. The nucleotide sequence encoding the malate quinone oxidoreductase Mqo is shown in SEQ ID No. 48. The nucleotide sequence encoding the homoserine dehydrogenase Hom is shown in SEQ ID No. 49. The nucleotide sequence encoding the pyruvate carboxylase Pyc is shown in SEQ ID No. 50.

[0068] In a second aspect, the present invention provides the application of engineered bacteria for producing ectoine as described in the first aspect in the fermentation of ectoine.

[0069] Compared with the prior art, the present invention has the following beneficial effects:

[0070] Compared to *Escherichia coli*, *Corynebacterium glutamicum* is a recognized strain suitable for safe microbial production, possessing advantages such as resistance to bacteriophage infection, stable fermentation, and no endotoxin production. This invention constructs a high-yielding basic strain of ectoine using gene editing and other methods, and further develops several improved strains with enhanced performance. After 96 hours of fermentation in a 2L fermenter, the highest yield reached 112 g / L, demonstrating short fermentation time and high production intensity. Attached Figure Description

[0071] Figure 1 This is the HPLC chromatogram of the product from Example 1.

[0072] Figure 2 This is the mass spectrometry analysis chromatogram of the product in Example 1. Detailed Implementation

[0073] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.

[0074] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0075] Example 1: Construction and fermentation of the basic strain lysCS301Y-ΔlysE-ectABC

[0076] (1) Construction of mutant strain lysC-S301Y

[0077] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, homologous arms lysC-S301Y-UF / lysC-S301Y-UR and lysC-S301Y-RF / lysC-S301Y-RR were amplified by PCR using primer pairs lysC-S301Y-UF / lysC-S301Y-UR and lysC-S301Y-RF / lysC-S301Y-RR (PCR system used was 2×Phanta Max Master Mix (Dye Plus), Vazyme). The plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB. The three fragments lysC-S301Y-Up, lysC-S301Y-Down, and line-pK18mobsacB were then cloned using a recombinant cloning kit (ClonExpress Multis One Step Cloning). The recombinant plasmid pK18mobsacB-lysC-S301Y was seamlessly assembled using the Vazyme Kit (catalog number: C113-02). The reaction system and conditions were performed according to the kit's instructions. After seamless assembly, the plasmid was transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-lysC-S301Y. The validated plasmid was electroporated into Corynebacterium glutamicum ATCC13032, and subsequent screening using kanamycin and SacB resistance yielded the mutant strain lysC-S301Y, where serine at position 301 was changed to tyrosine.

[0078] Primer pair lysC-S301Y-UF / lysC-S301Y-UR:

[0079] lysC-S301Y-UF: gaaacagctatgacatgattacgaattcgcgatgtcaccacgttgggtcg (SEQID No. 1);

[0080] lysC-S301Y-UR: tggtgccgtcttctacagaaTagacgttctgcagaaccat (SEQ ID No. 2);

[0081] Primer pair lysC-S301Y-RF / lysC-S301Y-RR:

[0082] lysC-S301Y-RF: atggttctgcagaacgtctattctgtagaagacggcacca (SEQ ID No. 3);

[0083] lysC-S301Y-RR: atgcctgcaggtcgactctagaaatcttacggcctgcggaacgt (SEQ ID No. 4).

[0084] (2) Construction of mutant strain lysC-S301Y-ΔlysE

[0085] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, upstream homologous arms lysE-Up and lysC-Down were obtained by PCR amplification using primer pairs lysE-UF / lysE-UR (PCR system used 2×Phanta Max Master Mix (Dye Plus), Vazyme). Plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB. The above three fragments, lysE-Up, lysE-Down, and line-pK18mobsacB, were seamlessly assembled using a recombinant cloning kit (ClonExpress Multis One Step Cloning Kit, Vazyme, catalog number: C113-02). The reaction system and reaction conditions were performed according to the kit instructions. After seamless assembly, Trans1 T1 competent cells were transformed to obtain the recombinant plasmid pK18mobsacB-ΔlysE. The validated plasmid was electroporated into the previously obtained mutant strain lysC-S301Y, and then screened using kanamycin resistance and SacB resistance to further obtain the lysE knockout mutant strain lysC-S301Y-ΔlysE.

[0086] Primer pair lysE-UF / lysE-UR:

[0087] lysE-UF: gaaacagctatgacatgattacgaattcatctgcgttgatggcgatggtt(SEQ IDNo.5);

[0088] lysE-UR:tattgcgcgccgacgccgccgatgatgaacaaaaagacgtca (SEQ ID No. 6);

[0089] Primer pair lysE-RF / lysE-RR:

[0090] lysE-RF: tgacgtctttttgttcatcatcggcggcgtcggcgcgcaata (SEQ ID No. 7);

[0091] lysE-RR: atgcctgcaggtcgactctagatgagggcatgttgaacgtgaac (SEQ ID No. 8).

[0092] (3) Construction of recombinant strain lysC-S301Y-ΔlysE-ectABC

[0093] The ectABC gene cluster, derived from *Pseudomonas stutzeri*, was codon-optimized, and XbaI and EcoRI restriction sites were reserved at the 5' and 3' ends of the gene cluster, respectively, before artificial synthesis (Suzhou Genewiz Biotechnology Co., Ltd.). The commercially available high-expression plasmid pXMJ19 from *Corynebacterium glutamicum* was double-digested with the restriction endonucleases XbaI / EcoRI. Seamless assembly was performed using a recombinant cloning kit (ClonExpress Multis One Step Cloning Kit, Vazyme, catalog number: C113-02), and the ectABC gene fragment was ligated into pXMJ19. The resulting recombinant plasmid was named pXMJ19-ectABC. The plasmid pXMJ19-ectABC was transformed into the aforementioned mutant strain lysC-S301Y-ΔlysE via electroporation using an electroporator (Bio-Rad). The electroporation conditions were 2.5 kV, 200 Ω, 25 μF, and 2 mm wide electroporation cup. Recombinant bacteria were then screened on LBHIS plates containing 5 mg / L chloramphenicol and named lysC-S301Y-ΔlysE-ectABC.

[0094] The mutant strain lysC-S301Y-ΔlysE-ectABC, stored at -80℃, was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed culture. Then, OD0.05 was used as the soluble concentrate. 600 An inoculum of 0.3 μL was introduced into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The supernatant was collected after centrifugation and analyzed by HPLC.

[0095] The analytical conditions were as follows: Ultra-high performance liquid chromatography (UHPLC) (Agilent UHPLC 1290), equipped with a DAD detector. Column: Agilent SB-Aq; 4.6*250mm; 5μm. Mobile phase: 5% acetonitrile, 95% sodium dihydrogen phosphate aqueous solution (20mmol), pH adjusted to 2.0 with phosphoric acid. Column temperature: 30℃. UV: 210nm. Flow rate: 0.6mL / min, isogradient elution. Injection volume: 2μL. Run time: 8 minutes. The ectoine yield was determined by HPLC to be 2.8 g / L. The UHPLC results are as follows. Figure 1 As shown. Further mass spectrometry was used to detect the product, and the results are as follows. Figure 2 As shown.

[0096] The seed culture medium contains the following components: brain and heart extract powder (brand: Oxoid, item number: CM1135) 15g / L, tryptone (brand: Oxoid, item number: LP0042) 5g / L, NaCl 5g / L, and yeast powder (brand: Oxoid, item number: LP0021) 2.5g / L.

[0097] The fermentation medium consists of the following components: glucose 20 g / L, MgSO4·7H2O 0.45 g / L, yeast extract 5 g / L, tryptone 3 g / L, K2HPO4 0.5 g / L, (NH4)2SO4 5 g / L, NaCl 1 g / L, biotin 0.0004 g / L, and vitamin B1 0.0001 g / L.

[0098] Example 2: Construction and fermentation of the basic strain lysCT311I-ΔlysE-ectABC

[0099] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, homologous arms lysC-T311I-UF / lysC-T311I-UR and lysC-T311I-RF / lysC-T311I-RR were amplified by PCR using primer pairs lysC-T311I-UF / lysC-T311I-UR and lysC-T311I-RF / lysC-T311I-RR (PCR system used was 2×Phanta Max Master Mix (Dye Plus), Vazyme). The plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB. The three fragments lysC-T311I-Up, lysC-T311I-Down, and line-pK18mobsacB were then cloned using a recombinant cloning kit (ClonExpress Multis One Step Cloning). The recombinant plasmid pK18mobsacB-lysC-T311I was seamlessly assembled using the Vazyme Kit (catalog number: C113-02). The reaction system and conditions were performed according to the kit's instructions. After seamless assembly, the plasmid was transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-lysC-T311I. The validated plasmid was electroporated into Corynebacterium glutamicum ATCC13032, and subsequent screening using kanamycin and SacB resistance yielded the mutant strain lysC-T311I, with a threonine mutation at position 311 in LysC replaced by isoleucine.

[0100] Primer pair lysC-T311I-UF / lysC-T311I-UR:

[0101] lysC-T311I-UF: aacagctatgacatgattacgaattcagtcccttggcgcagaa (SEQ ID No. 9);

[0102] lysC-T311I-UR:cgtcggaacgagggcaggtgaagAtgatgtcggtggtgccgtcttcta(SEQID No.10);

[0103] Primer pair lysC-RF / lysC-RR:

[0104] lysC-T311I-RF: tagaagacggcaccaccgacatcaTcttcacctgccctcgttccgacg (SEQID No. 11);

[0105] lysC-T311I-RR: gtaaaacgacggccagtgccaagctttcgtccttgcgccaag (SEQ ID No. 12).

[0106] The recombinant plasmid pK18mobsacB-ΔlysE obtained in Example 1 was electroporated into the obtained mutant strain lysC-T311I. The mutant strain lysE knockout lysC-T311I-ΔlysE was further obtained by reverse screening using kanamycin resistance and SacB resistance.

[0107] The overexpression plasmid pXMJ19-ectABC obtained in Example 1 was transformed into the aforementioned mutant strain lysC-T311I-ΔlysE by electroporation using a Bio-Rad electroporator (voltage 2.5KV, resistance 200Ω, capacitance 25μF, electroporation cup width 2mm). Recombinant bacteria were then screened on LBHIS plates containing 5mg / L chloramphenicol and named lysC-T311I-ΔlysE-ectABC.

[0108] The mutant strain lysCT311I-ΔlysE-ectABC-lysC was inoculated into seed culture medium and cultured at 30°C for 24 hours to obtain seed liquid. Then, OD0.05 was used as the OD0.05. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 2.6 g / L as determined by HPLC.

[0109] Example 3: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-lysCS301Y(pJC1)

[0110] Using the genome of *Corynebacterium glutamicum* ATCC13032 as a template, PCR amplification was performed using primers Pcg2195-1 / Pcg2195-2 to obtain the promoter fragment Pcg2195-lysCS301Y. Using the genome of *Corynebacterium glutamicum* strain lysCS301Y-ΔlysE-ectABC obtained in Example 1 as a template, PCR amplification was performed using primers lysCS301Y-1 / lysCS301Y-2 to obtain the insert fragment lysCS301Y. Plasmid pJC1 was digested with enzymes BamHI and SalI to obtain the linearized fragment line-pJC1. The above three fragments, Pcg2195-lysCS301Y, lysCS301Y, and line-pJC1, were seamlessly assembled using the same recombinant cloning kit described above, and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pJC1-lysCS301Y. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC, and recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-lysCS301Y(pJC1).

[0111] Primer pair Pcg2195-1 / Pcg2195-2:

[0112] Pcg2195-1: gcgatcagcgacgccgcagggggatccgagtatcgaaaaatttccacgtcaag (SEQID No. 13);

[0113] Pcg2195-2: atatttctgtacgaccagggccaTgagaatagtccttcggaaatagtcg (SEQ ID No. 14);

[0114] Primer pair lysCS301Y-1 / lysCS301Y-2:

[0115] lysCS301Y-1: cccgactatttccgaaggactattctcAtggccctggtcgtacagaaata (SEQ ID No. 15);

[0116] lysCS301Y-2: AGGCCTTAttgttcgtcgtcgacttagcgtccggtgcctgcataa (SEQ ID No. 16).

[0117] The mutant strain lysCS301Y-ΔlysE-ectABC-lysCS301Y(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the OD0.05. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 3.5 g / L as determined by HPLC.

[0118] Example 4: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-pycP458S

[0119] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, homologous arms pyc-P458S-Up and pyc-P458S-UR and pyc-P458S-RF / pyc-P458S-RR were amplified by PCR using primer pairs pyc-P458S-UF / pyc-P458S-UR and pyc-P458S-RF / pyc-P458S-RR (PCR system used: 2×Phanta Max Master Mix (Dye Plus), Vazyme). The plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB. The three fragments pyc-P458S-Up, pyc-P458S-Down, and line-pK18mobsacB were then cloned using a recombinant cloning kit (ClonExpress Multis One Step Cloning). The recombinant plasmid pK18mobsacB-pyc-P458S was seamlessly assembled using the Vazyme Kit (Catalog No.: C113-02). The reaction system and conditions were performed according to the kit's instructions. After seamless assembly, the plasmid was transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-pyc-P458S. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC obtained in Example 1. Chloramphenicol, kanamycin resistance, and SacB reverse screening were then used to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-pycP458S, in which proline at position 458 of Pyc was mutated to serine and the initial codon was mutated from gtg to atg.

[0120] Primer pair pyc-P458S-UF / pyc-P458S-UR:

[0121] pyc-P458S-UF: gaaacagctatgacatgattacgaattcttgaaaggaataattactctaAtgtcgact (SEQ ID No. 17);

[0122] pyc-P458S-UR: caggtggagcctgaaggaggtgcgAgtgatcggcaatgaatccggtgg (SEQ ID No. 18);

[0123] Primer pair pyc-P458S-RF / pyc-P458S-RR:

[0124] pyc-P458S-RF:ccaccggattcattgccgatcacTcgcacctccttcaggctccacctg(SEQ IDNo.19);

[0125] pyc-P458S-RR: gcatgcctgcaggtcgactcttagacagcaaagtctgctggatccacac (SEQ ID No. 20).

[0126] The mutant strain lysCS301Y-ΔlysE-ectABC-pycP458S was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the OD0.05. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The seed culture medium and fermentation medium used during the fermentation process were the same as in Example 1. The yield of ectoine was determined to be 3.0 g / L by HPLC.

[0127] Example 5: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-pycP458S(pJC1)

[0128] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers Pcg2195-3 / Pcg2195-4 to obtain the promoter fragment Pcg2195-pycP458S; using the genome of the mutant strain lysCS301Y-ΔlysE-ectABC-pycP458S from Example 4 as a template, PCR amplification was performed using primers pyc-P458S-1 / pyc-P458S-2 to obtain the insert fragment pyc-P458S; plasmid pJC1 was digested with enzymes BamHI and SalI to obtain the linearized fragment line-pJC1; the above three fragments, Pcg2195-pycP458S, pyc-P458S, and line-pJC1, were seamlessly assembled using the same recombinant cloning kit described above, and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pJC1-pycP458S. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC, and recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-pycP458S(pJC1).

[0129] Primer pair Pcg2195-3 / Pcg2195-4:

[0130] Pcg2195-3: gcgatcagcgacgccgcagggggatccgagtatcgaaaaatttccacgtcaag (SEQID No. 21);

[0131] Pcg2195-4: gagaatagtccttcggaaatagtcg (SEQ ID No. 22);

[0132] Primer pair pyc-P458S-1 / pyc-P458S-2:

[0133] pyc-P458S-1: cccgactatttccgaaggactattctcAtgtcgactcacacatcttcaac (SEQ ID No. 23);

[0134] pyc-P458S-2: GATTTGGGAGGCCTTAttgttcgtcgtcgacttaggaaacgacgacgatcaagtc (SEQ ID No. 24).

[0135] The mutant strain lysCS301Y-ΔlysE-ectABC-pycP458S(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the OD0.05. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 3.7 g / L as determined by HPLC.

[0136] Example 6: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-homV59A.

[0137] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using hom-up-1 / hom-up-2 primers to obtain the upstream homologous arm fragment hom-up; using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using hom-down-1 / hom-down-2 primers to obtain the downstream homologous arm fragment hom-down; plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB; the above three fragments, hom-up, hom-down, and line-pK18mobsacB, were seamlessly assembled using a recombinant cloning kit (ClonExpress Multis One Step Cloning Kit, Vazyme, catalog number: C113-02). The reaction system and reaction conditions were performed according to the kit instructions. After seamless assembly, the cells were transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pK18mobsacB-homV59A. The validated plasmid was electroporated into the previously obtained mutant strain lysCS301Y-ΔlysE-ectABC. Kanamycin resistance, chloramphenicol resistance and SacB resistance were used for reverse screening to further obtain the mutant strain lysCS301Y-ΔlysE-ectABC-homV59A with valine mutated to alanine at position 59 in Hom.

[0138] Primer pair hom-up-1 / hom-up-2:

[0139] hom-up-1:gaaacagctatgacatgattacgaattcgttcatgtgaaaaatacact(SEQ IDNo.25);

[0140] hom-up-2: acgtggctttgagatatcagaaGcagcaatgccacgaacctcc (SEQ ID No. 26);

[0141] Primer pair hom-down-1 / hom-down-2:

[0142] hom-down-1: ggaggttcgtggcattgctgCttctgatatctcaaagccacgt (SEQ ID No. 27);

[0143] hom-down-2: gcttgcatgcctgcaggtcgactctagaacacatcatccgcggtaacacgg (SEQ ID No. 28).

[0144] The mutant strain lysCS301Y-ΔlysE-ectABC-homV59A was inoculated into seed culture medium and cultured at 30°C for 24 hours to obtain seed liquid. Then, OD0.05 was used as the OD0.05. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 3.1 g / L as determined by HPLC.

[0145] Example 7: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-mqoW224taa.

[0146] Using the genome of *Corynebacterium glutamicum* ATCC13032 as a template, PCR amplification was performed using primers mqo-up-1 / mqo-up-2 to obtain the upstream homologous arm fragment mqo-up; using the same genome as a template, PCR amplification was performed using primers mqo-down-1 / mqo-down-2 to obtain the downstream homologous arm fragment mqo-down; plasmid pK18mobsacB was digested with restriction endonucleases EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB; the three fragments mqo-up, mqo-down, and line-pK18mobsacB were seamlessly assembled using a recombinant cloning kit (ClonExpress Multis One Step Cloning Kit, Vazyme, catalog number: C113-02). The reaction system and conditions were performed according to the kit instructions. After seamless assembly, the fragments were transformed into Trans1. T1 competent cells were used to obtain the recombinant plasmid pK18mobsacB-mqoW224taa. The validated plasmid was electroporated into the previously obtained mutant strain lysCS301Y-ΔlysE-ectABC. Kanamycin resistance, chloramphenicol resistance, and SacB reverse screening were then used to further obtain the mutant strain lysCS301Y-ΔlysE-ectABC-mqoW224taa, in which tryptophan at position 224 of Mqo is mutated to a stop codon.

[0147] Primer pair mqo-up-1 / mqo-up-2:

[0148] mqo-up-1:gaaacagctatgacatgattacgaattccgtggaacaatgcaggaacc(SEQ IDNo.29);

[0149] mqo-up-2:gtacgttcttgacggtcacgatTTactttgcgccatcagccttg(SEQ ID No.30);

[0150] Primer pair mqo-down-1 / mqo-down-2:

[0151] mqo-down-1:caaggctgatggcgcaaagtAAatcgtgaccgtcaagaacgtac(SEQ IDNo.31);

[0152] mqo-down-2: gcttgcatgcctgcaggtcgactctagaccgttttgtgcctctggcatgta (SEQ ID No. 32).

[0153] The mutant strain lysCS301Y-ΔlysE-ectABC-mqoW224taa was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid, which was then used as OD. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The seed culture medium and fermentation medium used during the fermentation process were the same as in Example 1. The yield of ectoine was determined to be 3.0 g / L by HPLC.

[0154] Example 8: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-ectA(pJC1)

[0155] Using the genome of Corynebacterium glutamicum ATCC13032 as a template, the promoter fragment Pcg2195-ectA was obtained by PCR amplification using primers Pcg2195-5 / Pcg2195-6; the insert fragment ectA was obtained by PCR amplification using the ectoin synthesis gene cluster ectABC as a template and primers ectA-1 / ectA-2; plasmid pJC1 was digested with enzymes BamHI and SalI to obtain the linearized fragment line-pJC1; the above three fragments, Pcg2195-ectA, ectA, and line-pJC1, were seamlessly assembled using the same recombinant cloning kit described above, and transformed into Trans1 T1 competent cells to obtain the recombinant plasmid pJC1-ectA. The validated plasmid was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC, and recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-ectA(pJC1).

[0156] Primer pair Pcg2195-5 / Pcg2195-6:

[0157] Pcg2195-5: gcgatcagcgacgccgcagggggatccgagtatcgaaaaatttccacgtcaag (SEQID No. 33);

[0158] Pcg2195-6: GTTGCGCTTCAGGGTTGGCATgagaatagtccttcggaaatagtcg (SEQ ID No. 34);

[0159] Primer pair ectA-1 / ectA-2:

[0160] ectA-1: cccgactatttccgaaggactattctcATGCCAACCCTGAAGCGCAA (SEQ ID No. 35);

[0161] ectA-2: TTGGGAGGCCTTAttgttcgtcgtcgacTTATGCGTGTTCTTTCAGTTTCTTCTTCCAGG (SEQ ID No. 36).

[0162] The mutant strain lysCS301Y-ΔlysE-ectABC-ectA(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the seed culture medium. 600 An inoculum of 0.3 g was inoculated into a 96-well plate (1.6 mL, Aijin Biotechnology) containing 200 μL of fermentation medium. The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 3.8 g / L as determined by HPLC.

[0163] Example 9: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-ΔISCg2f-lysCS301Y-pycP458S

[0164] Using the *Corynebacterium glutamicum* ATCC13032 genome as a template, PCR amplification was performed using primers ISCg2f-UF / ISCg2f-UR to obtain the upstream homologous arm ISCg2f-up; using the plasmid pJC1-lysCS301Y obtained in Example 3 as a template, PCR amplification was performed using primers lysCS301Y-F / lysCS301Y-R to obtain lysCS301Y (insert); using the plasmid pJC1-pycP458S obtained in Example 5 as a template, PCR amplification was performed using primers pycP458S-F / pycP458S-R to obtain pycP458S (insert); using the *Corynebacterium glutamicum* ATCC13032 genome as a template, using primers ISCg2f-UF / ISCg2f-UR to obtain the upstream homologous arm ISCg2f-up; using the *Corynebacterium glutamicum* ATCC13032 genome as a template, PCR amplification was performed using primers ISCg2f-UF / ISCg2f-UR to obtain the upstream homologous arm ISCg2f-up; using the plasmid pJC1-lysCS301Y obtained in Example 3 as a template, PCR amplification was performed using primers lysCS301Y-F / lysCS301Y-R to obtain lysCS301Y (insert); using the plasmid pJC1-pycP458S obtained in Example 5 as a template, PCR amplification was performed using primers pycP458S-F / pycP458S-R to obtain the upstream homologous arm ISCg2f-up; using the *Corynebacterium glutamicum* ATCC13032 genome as a template, PCR PCR amplification was performed using Cg2f-DF / ISCg2f-DR as primers to obtain the downstream homologous arm ISCg2f-down; plasmid pK18mobsacB was digested with enzymes EcoRI and XbaI to obtain the linearized fragment line-pK18mobsacB; the above five fragments: ISCg2f-up, lysCS301Y (insert), pycP458S (insert), ISCg2f-down, and line-pK18mobsacB were seamlessly assembled under the action of recombinase, and transformed into Trans1T1 competent cells to obtain the recombinant plasmid pK18mobsacB-ΔISCg2f-lysCS301Y-pycP458S. The validated plasmid was electroporated into the mutant strain lysC-S301Y-ΔlysE-ectABC. Chloramphenicol, kanamycin resistance and SacB reverse screening were then used to further obtain the mutant strain lysC-S301Y-ΔlysE-ectABC-ΔISCg2f-lysCS301Y-pycP458S, which was ISCg2f knocked out and introduced at the same site as another copy of lysCS301Y and another copy of pycP458S.

[0165] Primer pair ISCg2f-UF / ISCg2f-UR:

[0166] ISCg2f-UF: gaaacagctatgacatgattacgaattcctagccatcttgtctcctaa (SEQ ID No. 37);

[0167] ISCg2f-UR: gacgtggaaatttttcgatactcggatatattggcccgagtcatgccg (SEQ IDNo. ​​38);

[0168] Primer pair lysCS301Y-F / lysCS301Y-R:

[0169] lysCS301Y-F: cggcatgactcgggccaatatatccgagtatcgaaaaatttccacgtc (SEQ ID No. 39);

[0170] lysCS301Y-R: gacgtggaaatttttcgatactcttaggaaacgacgacgatcaagtcg (SEQ ID No. 40);

[0171] Primer pair pycP458S-F / pycP458S-R:

[0172] pycP458S-F: cgacttgatcgtcgtcgtttcctaagagtatcgaaaaatttccacgtc (SEQ IDNo. ​​41);

[0173] pycP458S-R: atccgtcacagtcgacgcctcatgattaacttagcgtccggtgcctgcataaac (SEQID No. 42);

[0174] Primer pair ISCg2f-DF / ISCg2f-DR:

[0175] ISCg2f-DF: tttatgcaggcaccggacgctaagttaatcatgaggcgtcgactgtgacggat (SEQID No. 43);

[0176] ISCg2f-DR: gcatgcctgcaggtcgactctagaacacatcacaggatatggtagaag (SEQ ID No. 44).

[0177] The mutant strain lysC-S301Y-ΔlysE-ectABC-ΔISCg2f-lysCS301Y-pycP458S was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the inoculum. 600 An inoculum of 0.3 g was inoculated into a 96-well plate containing 200 μL of fermentation medium (1.6 mL, Aijin Biotechnology). The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was 4.4 g / L as determined by HPLC.

[0178] Example 10: Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-ΔISCg2f-lysCS301Y-pycP458S-ectA(pJC1)

[0179] The recombinant plasmid pJC1-ectA obtained in Example 8 was electroporated into the mutant strain lysC-S301Y-ΔlysE-ectABC-ΔISCg2f-lysCS301Y-pycP458S obtained in Example 9, and the recombinant bacteria were screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysC-S301Y-ΔlysE-ectABC-ΔISCg2f-lysCS301Y-pycP458S-ectA(pJC1).

[0180] The mutant strain lysC-S301Y-ΔlysE-ectABC-ΔISCg2f-lysCS301Y-pycP458S-ectA(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used as the inoculum. 600 An inoculum of 0.3 g / L was inoculated into a 96-well plate containing 200 μL of fermentation medium (1.6 mL, Aijin Biotechnology). The plate was sealed with sealing film and placed in a plate shaker. The plate was fermented at 80% humidity for 72 hours at 950 rpm to obtain the fermentation broth. The seed culture medium and fermentation medium used during the fermentation process were the same as in Example 1. The yield of ectoine was determined to be 5.2 g / L by HPLC.

[0181] Example 11 Construction and fermentation of Corynebacterium glutamicum strain lysCS301Y-ΔlysE-ectABC-homV59A-mqoW224taa-ectA(pJC1).

[0182] The recombinant plasmid pK18mobsacB-mqoW224taa obtained in Example 7 was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC-homV59A obtained in Example 6. The mutant strain lysCS301Y-ΔlysE-ectABC-homV59A-mqoW224taa was further obtained by reverse screening using kanamycin resistance, chloramphenicol resistance and SacB resistance.

[0183] The recombinant plasmid pJC1-ectA obtained in Example 8 was electroporated into the mutant strain lysCS301Y-ΔlysE-ectABC-homV59A-mqoW224taa, and the recombinant strain was screened on LBHIS plates containing 5 mg / L chloramphenicol and 20 mg / L kanamycin to obtain the mutant strain lysCS301Y-ΔlysE-ectABC-homV59A-mqoW224taa-ectA (pJC1).

[0184] The mutant strain lysCS301Y-ΔlysE-ectABC-homV59A-mqoW224taa-ectA(pJC1) was inoculated into seed culture medium and cultured at 30℃ for 24 hours to obtain seed liquid. Then, OD0.05 was used to obtain the seed culture. 600 An inoculum of 0.3 g was inoculated into a 96-well plate containing 200 μL of fermentation medium (1.6 mL, Aijin Biotechnology). The plate was sealed with sealing film and placed in a plate shaker. The plate was kept at 80% humidity and fermented at 950 rpm for 72 hours to obtain the fermentation broth. The seed culture medium and fermentation medium used in the fermentation process were the same as in Example 1. The yield of ectoine was determined to be 5.6 g / L by HPLC.

[0185] Example 12 Fermentation of mutant strain lysCS301Y-ΔlysE-ectABC-homV59A-mqoW224taa-ectA(pJC1) in a 2L bioreactor

[0186] The bacterial strain used in the bioreactor was derived from a 1 mL cryopreservation tube of the mutant strain lysCS301Y-ΔlysE-ectABC-homV59A-mqoW224taa-ectA (pJC1). This tube was inoculated into a 1 L shake flask containing 100 mL of culture medium and incubated for 20 hours at 28°C and 160 rpm in a constant-temperature shaking incubator. The inoculum was then transferred to a 2 L bioreactor with an initial volume of 0.8 L and an inoculum size of 5%. The temperature was set at 28°C, the aeration ratio at 1.0 vvm, and the pH was maintained at 6.8 using 0.5 M H₂SO₄ and 25% NH₄OH. The stirring speed was linked to dissolved oxygen levels (DO was controlled to be no less than 20%). When the initial sugar was depleted, feeding was initiated at a rate of 10 g / h until fermentation was complete. During fermentation, 50% polysiloxane defoamer solution was added to control foam formation. After 96 hours of fermentation in a 2 L fermenter, the highest yield reached 112 g / L.

[0187] In summary, this invention uses *Corynebacterium glutamicum* as the starting strain, and through point mutation, removes the feedback inhibition of aspartate kinase LysC and reduces the activity of lysine efflux permease LysE, then introduces the ectoine synthesis gene cluster ectABC. Based on this, the activities of any one or at least two combinations of diaminobutyrate acetyltransferase EctA, pyruvate carboxylase Pyc, and aspartate kinase LysC are enhanced, and / or the activities of malate quinone oxidoreductase Mqo and / or homoserine dehydrogenase Hom are reduced to further increase ectoine yield. The enhanced strain, after 96 hours of fermentation in a 2L fermenter, achieved a maximum yield of 112 g / L.

[0188] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. An engineered bacterium for producing an ectoine, characterized by, The engineered bacteria were prepared using a method comprising the following steps: (1) Using Corynebacterium glutamicum ATCC 13032 as the starting strain, the feedback inhibition of aspartate kinase LysC was relieved; the feedback inhibition of aspartate kinase LysC was relieved by any of the following methods: introducing a LysC-S301Y site mutation or introducing a LysC-T311I site mutation. (2) Knock out the gene lysE encoding lysine efflux permease; (3) Expressing the ectoin synthesis gene cluster ectABC; The expressed ectoin synthesis gene cluster ectABC is derived from Pseudomonas schlegelii, and the nucleotide sequence of the ectoin synthesis gene cluster ectABC is shown in SEQ ID No.

45. (4) By overexpressing the ectA gene, the activity of diaminobutyric acid acetyltransferase EctA was enhanced, so as to further increase the yield of ectoin; The nucleotide sequence encoding the diaminobutyric acid acetyltransferase EctA is shown in SEQ ID No. 46; the nucleotide sequence encoding the aspartate kinase LysC is shown in SEQ ID No.

47.

2. The engineered bacteria for producing ectoine according to claim 1, characterized in that, Step (4) also includes: reducing the activity of homoserine dehydrogenase Hom by introducing a mutation at the homV59A site; and reducing the activity of malate quinone oxidoreductase Mqo by introducing a mutation at the mqoW224taa site. The nucleotide sequence encoding the malate quinone oxidoreductase Mqo is shown in SEQ ID No. 48, and the nucleotide sequence encoding the homoserine dehydrogenase Hom is shown in SEQ ID No.

49.

3. The engineered bacteria for producing ectoine according to claim 1, characterized in that, In step (3), the ectoin synthesis gene cluster ectABC is expressed by plasmid or chromosome integration.

4. The engineered bacteria for producing ectoine according to claim 1, characterized in that, In step (4), the ectA gene is overexpressed by plasmid or chromosome integration.

5. The engineered bacteria for producing ectoine according to claim 2, characterized in that, In step (4), the homV59A site mutation is introduced by plasmid; the mqoW224taa site mutation is introduced by plasmid.

6. The use of an engineered microorganism for producing ectoine as described in any one of claims 1-5 in the fermentation of ectoine.

Images