A SNP molecular marker related to the number of lambing of hu sheep in unc5c gene, primer and application thereof

Abstract

This invention belongs to the field of Hu sheep breeding technology, and more specifically, relates to a SNP molecular marker located on the UNC5C gene that is associated with the number of lambs born in Hu sheep, primers, and their applications. The five SNP molecular markers disclosed in this invention, which are significantly associated with the number of lambs born in Hu sheep, are all located on the UNC5C gene. By detecting specific genotypes at these loci, the high fertility of Hu sheep can be effectively predicted. This invention also provides specific primer combinations, detection kits, and identification methods for amplifying these SNP loci. Compared with traditional phenotypic selection, this method allows for early screening in young sheep, offering advantages such as speed, accuracy, and low cost, significantly improving the breeding efficiency of lambing numbers in Hu sheep, and is suitable for large-scale marker-assisted selection.

Description

Technical Field

[0001] This invention belongs to the field of Hu sheep breeding technology, and more specifically, relates to an SNP molecular marker, primers and their applications located in the UNC5C gene that are related to the number of lambs born in Hu sheep. Background Technology

[0002] The Hu sheep is a local sheep breed renowned for its high reproductive performance. Lamb count is a crucial economic trait for evaluating reproductive capacity and plays a significant role in sheep breeding and large-scale production. Increasing lamb count not only significantly improves farming efficiency but is also a key objective of current sheep genetic improvement. However, lamb count is a typical complex quantitative trait, regulated by multiple genes and easily influenced by nutritional levels, feeding management, and environmental factors. This leads to problems such as long selection cycles, low efficiency, and poor stability in traditional phenotypic selection methods, making it difficult to meet the demands of modern high-efficiency breeding.

[0003] With the development of molecular biology techniques, marker-assisted selection (MAS) has been widely applied in livestock genetic improvement. Single nucleotide polymorphisms (SNPs), as the most common type of genetic variation in the genome, have advantages such as wide distribution, high genetic stability, and convenient detection, and have become an important foundation for the development of molecular markers. Currently, several functional genes and their mutation sites related to litter size have been identified in sheep. For example, specific loci in genes such as BMPR1B, GDF9, and BMP15 have been used in molecular breeding practices for reproductive traits. However, these genes cannot fully explain the genetic basis of the high fertility of Hu sheep, indicating that there are still other key genes and functional loci that have not yet been fully explored.

[0004] The UNC5C gene, a member of the Netrin receptor family, plays a crucial role in neural development, primarily involved in biological processes such as axonal guidance, cell migration, and apoptosis. The nervous system, especially the hypothalamic-pituitary-gonadal axis, plays a central role in animal reproductive regulation, and its function depends on the normal development and signal transmission of neurons. However, current research on the UNC5C gene mainly focuses on its neurobiological functions, lacking reports on its association with reproductive traits, particularly the reproductive performance of Hu sheep. In particular, research on using UNC5C gene polymorphisms as molecular markers for lambing number in Hu sheep remains incomplete.

[0005] Therefore, it is necessary to develop a molecular marker based on the UNC5C gene SNP site for early screening and assisted selection of lambing number traits in Hu sheep, so as to improve breeding efficiency and reduce breeding costs. Summary of the Invention

[0006] The purpose of this invention is to provide a SNP molecular marker, primers, and their applications located in the UNC5C gene that are associated with lambing numbers in Hu sheep, in order to solve the above-mentioned technical problems.

[0007] The objective of this invention is achieved through the following technical solution: This invention provides a SNP molecular marker located in the UNC5C gene that is associated with lambing number in Hu sheep, the molecular marker comprising: Molecular marker 1, polymorphic site SNP1, located at position 76 of the sequence shown in SEQ ID NO.21, has C / T polymorphism, and the dominant genotype is TT. The number of lambs born in Hu sheep with the TT genotype of SNP1 is higher than that of Hu sheep with the CC genotype and CT genotype. Molecular marker 2, polymorphic site SNP2, located at position 67 of the sequence shown in SEQ ID NO.22, has C / T polymorphism, with the dominant genotype being TT. The number of lambs born in Hu sheep with the TT genotype of SNP2 is higher than that of Hu sheep with the CC and CT genotypes. Molecular marker 3, polymorphic site SNP3, located at position 75 of the sequence shown in SEQ ID NO.23, has G / T polymorphism, with the dominant genotype being TT. The number of lambs born to Hu sheep with the TT genotype of SNP3 is higher than that of Hu sheep with the GG and GT genotypes. Molecular marker 4, polymorphic site SNP4, located at position 79 of the sequence shown in SEQ ID NO.24, has G / A polymorphism, with the dominant genotype being AA. The number of lambs born to Hu sheep with the AA genotype of SNP4 is higher than that of Hu sheep with the GA genotype and GG genotype. Molecular marker 5, polymorphic site SNP5, located at position 83 of the sequence shown in SEQ ID NO.25, has G / A polymorphism, with the dominant genotype being AA. The number of lambs born to Hu sheep with the AA genotype of SNP5 is higher than that of Hu sheep with the GA genotype and the GG genotype.

[0008] This invention breaks through the traditional view that the UNC5C gene is only involved in neural development, and for the first time establishes its association with the complex reproductive trait of lambing number in Hu sheep. Five polymorphic SNP sites were screened in the UNC5C gene: SNP1, located at 29,632,489 bp on chromosome 6 of Hu sheep, contains a C>T mutation, with the genome version number ARS-UI_Ramb_v2.0; SNP2, located at 29,719,056 bp on chromosome 6 of Hu sheep, contains a C>T mutation, with the genome version number ARS-UI_Ramb_v2.0; SNP3, located at 29,949,265 bp on chromosome 6 of Hu sheep, contains a G>T mutation, with the genome version number ARS-UI_Ramb_v2.0; and SNP4, located at 29,956,276 bp on chromosome 6 of Hu sheep, contains a G>A mutation, with the genome version number ARS-UI_Ramb_v2.0. SNP5 is located at 29,964,933 bp on chromosome 6 of the Hu sheep breed, exhibiting a G>A mutation, with the genome version number ARS-UI_Ramb_v2.0. This invention, through association analysis of a large-scale Hu sheep sample (768 sheep), confirmed that specific homozygous genotypes (such as TT or AA) at these loci are significantly associated with high lambing numbers. Based on this, this invention designed highly specific and efficient PCR primers, constructing a complete technical chain from DNA extraction and genotype identification to the selection of superior individuals. This concept applies neurodevelopmental genes to reproductive breeding, providing new insights into the molecular mechanisms of high fertility in Hu sheep and offering a reusable technical paradigm for improving quantitative traits regulated by multiple genes.

[0009] The present invention also provides primers for amplifying the SNP molecular marker, wherein the primer sequences for amplifying molecular marker 1 are shown in SEQ ID NO.11~12; The primer sequences used to amplify molecular marker 2 are shown in SEQ ID NO.13~14; The primer sequences used to amplify molecular marker 3 are shown in SEQ ID NO.15~16; The primer sequences used to amplify molecular marker 4 are shown in SEQ ID NO.17~18; The primer sequences used to amplify molecular marker 5 are shown in SEQ ID NO.19~20.

[0010] The present invention also provides a kit for detecting the number of lambs born in Hu sheep, the kit comprising the primers described above.

[0011] Furthermore, the kit also includes 2×Taq Plus Master MixⅡ.

[0012] The present invention also provides the application of the above-mentioned SNP molecular markers, primers for the above-mentioned SNP molecular markers, or the above-mentioned kits in identifying the lambing number trait of Hu sheep.

[0013] The present invention also provides the application of the above-mentioned SNP molecular markers, primers or kits in the breeding or assisted breeding of Hu sheep, wherein the assisted breeding of Hu sheep is to breed Hu sheep with a high number of lambs.

[0014] This invention also provides a method for identifying the number of lambs born in Hu sheep, comprising the following steps: (1) Extract DNA from the sheep to be tested; (2) Using the extracted DNA as a template, amplification was performed using the primers described above to obtain the amplification product; (3) Identify the genotype of the SNP locus of the amplified product, and determine the lambing number trait of the Hu sheep based on the genotype. When the genotype locus at position 76 of the amplified product of SNP1 is the TT genotype, it is determined that the Hu sheep to be tested has the trait of having a large number of lambs. When the genotype at position 67 of the SNP2 amplification product is the TT genotype, the tested Hu sheep is determined to have the trait of high lambing number. When the genotype at position 75 of the SNP3 amplification product is the TT genotype, the tested Hu sheep is determined to have the trait of high lambing number. When the genotype at position 79 of the SNP4 amplification product is AA, the tested Hu sheep is determined to have the trait of high lambing number. When the genotype at position 83 of the SNP5 amplification product is AA, the tested Hu sheep is determined to have the trait of high lambing number.

[0015] The present invention also provides a method for genetic improvement of Hu sheep, the method comprising the steps of successive breeding of individuals with the dominant genotype of the SNP molecular marker, and elimination of individuals with other genotypes.

[0016] The present invention has the following beneficial effects: Strong correlation: This invention is the first to discover that five SNP sites of the UNC5C gene are significantly correlated with the number of lambs born in Hu sheep, providing a novel candidate marker for the genetic improvement of Hu sheep reproductive performance.

[0017] High accuracy: The method of PCR amplification combined with direct sequencing results in objective and accurate genotyping results with good reproducibility.

[0018] High application value: This detection method is simple, fast, and inexpensive, and can be used for large-scale screening of Hu sheep in their early stages, effectively shortening the generation interval of breeding and reducing feeding and management costs. It is of great significance for improving the economic benefits of large-scale Hu sheep farming. Attached Figure Description

[0019] Figure 1 This is a scatter plot of the mass spectrometry sequencing data for the SNP1 locus.

[0020] Figure 2 This is a scatter plot of mass spectrometry sequencing data for the SNP2 locus.

[0021] Figure 3 This is a scatter plot of mass spectrometry sequencing data for the SNP3 locus.

[0022] Figure 4 This is a scatter plot of mass spectrometry sequencing data for the SNP4 locus.

[0023] Figure 5 Scatter plot of mass spectrometry sequencing data for SNP5 loci Figure 6 This is a sequencing peak diagram of the PCR product from the SNP1 site.

[0024] Figure 7 This is an agarose gel electrophoresis image of the PCR product for the SNP1 site.

[0025] Figure 8 This is a sequencing peak diagram of the PCR product for the SNP2 site.

[0026] Figure 9 This is an agarose gel electrophoresis image of the PCR product of the SNP2 site.

[0027] Figure 10 This is a sequencing peak diagram of the PCR product for the SNP3 site.

[0028] Figure 11 This is an agarose gel electrophoresis image of the PCR product for the SNP3 site.

[0029] Figure 12 This is a sequencing peak diagram of the PCR product for the SNP4 site.

[0030] Figure 13 This is an agarose gel electrophoresis image of the PCR product for the SNP4 site.

[0031] Figure 14 This is a sequencing peak diagram of the PCR product from the SNP5 site.

[0032] Figure 15 This is an agarose gel electrophoresis image of the PCR product at the SNP5 site. Detailed Implementation

[0033] The present invention will now be described in detail with reference to specific embodiments, but these should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained commercially unless otherwise specified.

[0034] Example 1 1. Experimental Animals and Sample Collection: The Hu sheep used in this invention were obtained from Jiangsu Qianbao Animal Husbandry Co., Ltd. A total of 768 healthy adult Hu sheep with complete breeding records were selected, and the number of lambs born in six consecutive litters was recorded. 5 mL of blood was collected from the jugular vein using a vacuum blood collection tube containing an anticoagulant (EDTA) and stored at -20℃ for later use.

[0035] 2. Extraction of genomic DNA from Hu sheep: Genomic DNA was extracted using a standard blood genomic DNA extraction kit (Tiangen Biochemical). The concentration and purity of the DNA were determined using a UV spectrophotometer. 260 / A 280 (The ratio is between 1.8 and 2.0), then diluted to 50 ng / μL and stored at -20℃ until use.

[0036] 3. Main instruments: pipettes (Eppendorf), electronic balance (HENGJI), microwave oven (Galanz), refrigerator (Haier), handheld centrifuge (SCILOGEX, S1010E), vortex apparatus (Dalong), digital display constant temperature water bath (Changzhou Putian, HH-G2), high-speed refrigerated centrifuge (Eppendorf, 5424R), micro spectrophotometer (NANODROP2000), PCR instrument (Applied Biosystems), electrophoresis apparatus (Beijing Liuyi, DYY-6C), fully automated digital gel imaging system (Tanon, Tanon-4100).

[0037] 4. SNP Genotyping: Specific primers and probes were designed using AssayDesignSuite 2.0 software, and genotyping of 768 Hu sheep samples was performed using the MassARRAY time-of-flight mass spectrometry platform. The primer and probe sequence information is shown in Table 1. The genotyping results are as follows: Figures 1-5 As shown, at SNP1, there are 505 individuals with the TT genotype, 236 with the CT genotype, and 23 with the CC genotype; at SNP2, there are 459 individuals with the TT genotype, 277 with the CT genotype, and 31 with the CC genotype; at SNP3, there are 568 individuals with the TT genotype, 158 with the GT genotype, and 37 with the GG genotype; at SNP4, there are 561 individuals with the AA genotype, 163 with the GA genotype, and 34 with the GG genotype; and at SNP5, there are 535 individuals with the AA genotype, 221 with the GA genotype, and 12 with the GG genotype.

[0038] Table 1: Primer and probe sequences for UNC5C gene SNP genotyping 5. PCR verification: Based on the reference sequence of the UNC5C gene of the Hu sheep (reference genome: ARS-UI_Ramb_v2.0), PCR amplification primers were designed using Primer 6.0 software for the five test sites (SNP1, SNP2, SNP3, SNP4 and SNP5). The PCR primer information is shown in Table 2.

[0039] Table 2: Primer sequences for PCR verification of UNC5C gene SNP genotyping The nucleotide sequence of the amplified product of the SNP1 site is shown in SEQ ID NO.21. The 76th position of this sequence is the SNP polymorphism site, with a polymorphism of C or T.

[0040] SEQ ID NO. 21: CCCTCTTCCATTACTTCGTGGGGCCTGTGAACCTCCATGCTGGGAACTTCAGTCCTCTTTTCATAGTGCTCTCCACTGTGGGTGTGCCATAACTTGGCACTCACTCTAGGTCCTCTAGGGCATATAGCAAGTGTCATTTCAAGAAGA.

[0041] The nucleotide sequence of the amplified product of the SNP2 site is shown in SEQ ID NO.22. The 67th position of this sequence is the SNP polymorphism site, and the polymorphism is C or T.

[0042] SEQ ID NO. 22: TTTGCTGATGACACTTTTTGAATTTCATTTCCCTAAATTCCTTTCAAAAGTTCAGTGAGGCATGCACTGCCAGGCTATTCAAGCACTCCAGGAATCTTTCTCTCTCTCTCTCTCTCTCTTTTTTTTTTTTTCTTTTCTTTAGTGT.

[0043] The nucleotide sequence of the amplified product of the SNP3 site is shown in SEQ ID NO.23. The 75th position of this sequence is the SNP polymorphism site, and the polymorphism is G or T.

[0044] SEQ ID NO. 23: TTAACATGCAAAAGAGTGTGAAACACACGCAAGAACATAATCCCTCTTTATTACTCAACTGTTGGAGCCAAGTTGTGCAGAATCTTATAATGCAAGGCATTTAAATAGCATTGAAAGCCATACATTTAGGATAACAACCATTGATAG.

[0045] The nucleotide sequence of the amplified product of the SNP4 site is shown in SEQ ID NO.24. The 79th position of this sequence is the SNP polymorphism site, with a polymorphism of G or A.

[0046] SEQ ID NO. 24: GAATATAAGCACAAGTGAAAGAATAGAATATTGTAAAAACGACAGGGATTTAGAGGAAAATCAAATGGAATGTGATTCGATTGAGAGGTTAAAACTCAATGGAAGACTAAAAATCAGATCGGGTCAGAGACAGCTTTTGATAAAATTAAAG.

[0047] The nucleotide sequence of the amplified product of the SNP5 site is shown in SEQ ID NO.25. The 83rd position of this sequence is the SNP polymorphism site, with a polymorphism of G or A.

[0048] SEQ ID NO. 25: TAACAGTTGGACATCAGCTGAAAAATATGGGTAAATCCCATCTATAGTCTGAAGGATGACTTAGTGAAAATTAGAAAAAGTCGATTCCTCCTCAAGTCATTTAGCCACCATCCACCAGAACATTGTTATATGAGCAGTCCAGATCCTCAG.

[0049] 6. The PCR amplification system includes: 10 μL of 2×Taq Plus Master Mix II; 0.6 μL each of forward and reverse primers; 1 μL of template DNA; and 7.8 μL of deionized water. The PCR amplification program includes: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, annealing at the corresponding primer temperatures (50℃ for SNP1, 45℃ for SNP2, 50℃ for SNP3, 50℃ for SNP4, and 50℃ for SNP5) for 20 s, extension at 72℃ for 45 s, for a total of 35 cycles; 72℃ extension for 10 min; and storage at 4℃ after PCR.

[0050] 7. Sequencing and Result Interpretation of Sample PCR Products: The above PCR products and primers were sent to Qingke Biotechnology for sequencing. The sequencing results were compared and analyzed using SnapGene software. Genotype was determined based on the sequencing peak diagram: (e.g., ...) Figure 6 As shown, when the peak diagram of the SNP1 locus shows a single peak of C / T, the genotype is CC / TT; when the peak diagram shows a double peak of C and T, the genotype is CT. Figure 8As shown, when the peak diagram of the SNP2 locus shows a single peak of C / T, the genotype is CC / TT; when the peak diagram shows a double peak of C and T, the genotype is CT. Figure 10 As shown, when the peak plot of the SNP3 locus shows a single peak of G / T, the genotype is GG / TT; when the peak plot shows a double peak of G and T, the genotype is GT. Figure 12 As shown, when the peak diagram of SNP4 loci shows a single peak of G / A, the genotype is GG / AA; when the peak diagram shows a double peak of G and A, the genotype is GA. Figure 14 As shown, when the peak diagram of the SNP5 locus shows a single peak of G / A, the genotype is GG / AA; when the peak diagram shows a double peak of G and A, the genotype is GA.

[0051] The above results indicate that PCR amplification of Hu sheep genomic DNA using primers, followed by genotyping via direct sequencing, enables rapid and accurate identification of the SNP locus of the Hu sheep UNC5C gene.

[0052] 8. Population genetic parameters of SNP loci: Genotyping was performed on 768 Hu sheep using primers listed in Table 1, and population genetic parameters for each locus were calculated, including genotype frequency, allele frequency, homozygosity, heterozygosity, effective allele count, polymorphism information content, and Hardy-Weinberg equilibrium. P The values ​​and experimental results are shown in Tables 3 to 7.

[0053] Table 3: Population genetic parameters of SNP1 locus Table 4: Population genetic parameters of SNP2 loci Table 5: Population genetic parameters of SNP3 loci Table 6: Population genetic parameters of SNP4 loci Table 7: Population genetic parameters of SNP5 loci Note: / indicates no data.

[0054] Population genetic parameter analysis was performed on five SNP loci in 768 Hu sheep samples. The results showed both commonalities and differences in genetic characteristics at each locus. Regarding genotype distribution, each SNP locus exhibited dominant allele distribution: the T allele frequencies at SNP1 and SNP2 were 0.81 and 0.78, respectively, while the T, A, and A allele frequencies at SNP3, SNP4, and SNP5 all exceeded 0.74, indicating a significant allele distribution bias at these loci in the Hu sheep population. In terms of genetic diversity, the heterozygosity (He) of all loci ranged from 0.26 to 0.34, the polymorphism information content (PIC) from 0.22 to 0.29, and the effective allele count (Ne) from 1.35 to 1.53, showing an overall low degree of polymorphism, suggesting relatively limited genetic variation at these SNP loci.

[0055] Hardy-Weinberg equilibrium test reveals differences in population genetic structure: SNP1 ( P =0.93) and SNP2 ( P The SNP 0.18 locus is in genetic equilibrium, suggesting that it may follow random mating principles and is not subject to significant selection pressure in the Hu sheep population; while SNP 3 ( P =0.00), SNP4 ( P =0.00) and SNP5 ( P The loci (=0.04) all deviated significantly from equilibrium, suggesting that these loci may be affected by evolutionary forces such as artificial breeding, natural selection, or genetic drift.

[0056] 9. Validation Analysis of UNC5C Gene SNP Markers in Hu Sheep: Using SAS (8.0) software and the GLM program, least squares statistical analysis was performed to analyze the association between different genotypes of the five SNP loci of the UNC5C gene and different parities and average number of lambs. Genotype and season were used as fixed effects, and the model was: Y ijk =μ+G i +S j +e ijk In the formula, Y ijk G represents the phenotypic value of the number of lambs born to an individual; μ represents the population mean; G represents the population mean. i Genotype effect; S j Year * seasonal effect; e ijk This represents random error. All results are expressed as "least squared mean ± standard deviation".

[0057] The association analysis results between the UNC5C gene SNP1 locus and reproductive traits in Hu sheep are shown in Table 8. Table 8 data indicate that this locus exhibits genetic bimorphism, with three genotypes. One-way ANOVA comparing the differences in lambing traits among different genotypes revealed that in first parity, individuals with the TT genotype had a significantly higher number of lambs born than those with the CC genotype.P <0.01). In the third parity, the number of lambs born to individuals with the TT genotype was significantly higher than that of individuals with the CT and CC genotypes ( P <0.01). In the fourth parity, the number of lambs born to individuals with the TT genotype was significantly higher than that of individuals with the CT genotype ( P <0.01). In the 2nd, 5th, and 6th parities, although the differences in the number of lambs born among individuals with different genotypes were not statistically significant, the number of lambs born to individuals with the TT genotype was greater than that of individuals with the CT or CC genotypes. Looking at the mean number of lambs born in each parity, the number of lambs born to individuals with the TT genotype was significantly higher than that of individuals with the CT and CC genotypes (…). P <0.01), with no significant difference between the latter two. These results suggest that the TT genotype at the SNP1 locus is the dominant genotype affecting lambing number in Hu sheep.

[0058] Table 8: Association analysis results between SNP1 genotypes and lambing number in Hu sheep Note: When comparing means, different capital letters in the same row indicate extremely significant differences. P <0.01).

[0059] According to the results in Table 9, the association analysis between different SNP2 genotypes and the number of lambs in each parity of Hu sheep showed that in the 1st, 4th, and 5th parities, the number of lambs born to individuals with the TT and CT genotypes was significantly higher than that of individuals with the CC genotype. P <0.01), the number of lambs born to individuals with the TT genotype was higher than that of individuals with the CT genotype, but the difference was not statistically significant; in the third parity, the number of lambs born to individuals with the TT genotype was significantly higher than that of individuals with the CT and CC genotypes ( P <0.01), but the difference between CT and CC was not significant; in the 2nd and 6th parities, the difference in the number of lambs born among different genotypes did not reach a significant level ( P >0.05), but the TT genotype had the highest number of lambs born. Looking at the mean number of lambs born in each parity, the TT genotype had a significantly higher number of lambs born than the CT genotype, and the CT genotype had a significantly higher number of lambs born than the CC genotype ( P <0.01). The above results suggest that the T allele at the SNP2 locus has a positive effect on lambing number in Hu sheep, with the TT genotype being the optimal genotype and the CC genotype being the unfavorable genotype.

[0060] Table 9: Association analysis results between SNP2 genotypes and lambing number in Hu sheep Note: When comparing means, different capital letters in the same row indicate extremely significant differences. P <0.01).

[0061] The association analysis results between the UNC5C gene SNP3 locus and reproductive traits in Hu sheep are shown in Table 10. According to the results in Table 10, the association analysis between different SNP3 genotypes and the number of lambs in each parity of Hu sheep showed that in the 1st, 3rd, and 4th parities, the number of lambs born to individuals with the TT genotype was significantly higher than that of individuals with the GT and GG genotypes. P <0.01), while there was no significant difference between the GT and GG genotypes; in the 2nd, 5th, and 6th parities, the differences in the number of lambs born among the different genotypes did not reach a significant level ( P >0.05). Looking at the mean number of lambs per parity, the TT genotype had a significantly higher number of lambs per parity than the GT and GG genotypes ( P <0.01), with no significant difference between the latter two. These results suggest that the TT genotype at SNP11 is the dominant genotype, which helps increase the number of lambs born in Hu sheep.

[0062] Table 10: Association analysis results between SNP3 loci genotypes and lambing number in Hu sheep Note: When comparing means, different capital letters in the same row indicate extremely significant differences. P <0.01).

[0063] According to the results in Table 11, the association analysis between different SNP4 genotypes and the number of lambs born in each parity of Hu sheep showed that in the 1st, 3rd, and 4th parities, the number of lambs born to individuals with the AA genotype was significantly higher than that of individuals with the GA and GG genotypes. P <0.01), while there was no significant difference between the GA and GG genotypes; in the 2nd, 5th, and 6th parities, the difference in the number of lambs born among the different genotypes did not reach a significant level ( P >0.05), but the AA genotype had the highest number of lambs born. Looking at the mean number of lambs born in each parity, the AA genotype had a significantly higher number of lambs born than the GA and GG genotypes ( P <0.01), with no significant difference between the latter two. These results suggest that the AA genotype at SNP4 is the dominant genotype, which is beneficial for increasing lambing numbers in Hu sheep.

[0064] Table 11: Association analysis results of SNP4 loci genotypes and lambing number in Hu sheep Note: When comparing means, different capital letters in the same row indicate extremely significant differences. P <0.01).

[0065] According to the results in Table 12, the association analysis between different SNP5 genotypes and the number of lambs born in each parity of Hu sheep showed that in the 1st, 3rd, and 4th parities, the number of lambs born to individuals with the AA genotype was significantly higher than that of individuals with the GG genotype. P<0.01), while there was no significant difference between the GA genotype and AA and GG. P >0.05); in the 2nd, 5th, and 6th parities, the difference in the number of lambs born among different genotypes did not reach a significant level ( P >0.05), but the AA genotype had the highest number of lambs per litter. Looking at the mean number of lambs per litter, the AA genotype had a significantly higher number of lambs per litter than the GA and GG genotypes ( P <0.01), with no significant difference between the latter two. These results suggest that the AA genotype at SNP5 is the dominant genotype, which is beneficial for increasing lambing numbers in Hu sheep.

[0066] Table 12: Association analysis results of SNP5 loci genotypes and lambing number in Hu sheep Note: When comparing means, different capital letters in the same row indicate extremely significant differences. P <0.01).

[0067] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0068] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0069] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A SNP molecular marker located in the UNC5C gene associated with lambing number in Hu sheep, characterized in that, The molecular markers include: Molecular marker 1, polymorphic site SNP1, located at position 76 of the sequence shown in SEQ ID NO.21, has C / T polymorphism, and the dominant genotype is TT. The number of lambs born in Hu sheep with the TT genotype of SNP1 is higher than that of Hu sheep with the CC genotype and CT genotype. Molecular marker 2, polymorphic site SNP2, located at position 67 of the sequence shown in SEQ ID NO.22, has C / T polymorphism, with the dominant genotype being TT. The number of lambs born in Hu sheep with the TT genotype of SNP2 is higher than that of Hu sheep with the CC and CT genotypes. Molecular marker 3, polymorphic site SNP3, located at position 75 of the sequence shown in SEQ ID NO.23, has G / T polymorphism, with the dominant genotype being TT. The number of lambs born to Hu sheep with the TT genotype of SNP3 is higher than that of Hu sheep with the GG and GT genotypes. Molecular marker 4, polymorphic site SNP4, located at position 79 of the sequence shown in SEQ ID NO.24, has G / A polymorphism, with the dominant genotype being AA. The number of lambs born to Hu sheep with the AA genotype of SNP4 is higher than that of Hu sheep with the GA genotype and GG genotype. Molecular marker 5, polymorphic site SNP5, located at position 83 of the sequence shown in SEQ ID NO.25, has G / A polymorphism, with the dominant genotype being AA. The number of lambs born to Hu sheep with the AA genotype of SNP5 is higher than that of Hu sheep with the GA genotype and the GG genotype.

2. A primer for amplifying the SNP molecular marker of claim 1, characterized in that, The primer sequences used to amplify molecular marker 1 are shown in SEQ ID NO.11~12; The primer sequences used to amplify molecular marker 2 are shown in SEQ ID NO.13~14; The primer sequences used to amplify molecular marker 3 are shown in SEQ ID NO.15~16; The primer sequences used to amplify molecular marker 4 are shown in SEQ ID NO.17~18; The primer sequences used to amplify molecular marker 5 are shown in SEQ ID NO.19~20.

3. A reagent kit for detecting the number of lambs born in Hu sheep, characterized in that, The kit includes the primers as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes 2×Taq Plus MasterMixⅡ.

5. The application of the SNP molecular marker of claim 1, the primer of claim 2, or the kit of claim 3 in identifying the lambing number trait in Hu sheep.

6. The application of the SNP molecular marker of claim 1, the primer of claim 2, or the kit of claim 3 in the breeding or assisted breeding of Hu sheep, characterized in that, The aforementioned auxiliary breeding of Hu sheep aims to cultivate Hu sheep with a high lambing rate.

7. A method for identifying the lambing count trait in Hu sheep, characterized in that, Includes the following steps: (1) Extract DNA from the sheep to be tested; (2) Using the extracted DNA as a template, amplification is performed using the primers described in claim 2 to obtain the amplification product; (3) Identify the genotype of the SNP locus of the amplified product, and determine the lambing number trait of the Hu sheep based on the genotype. When the genotype locus at position 76 of the amplified product of SNP1 is the TT genotype, it is determined that the Hu sheep to be tested has the trait of having a large number of lambs. When the genotype at position 67 of the SNP2 amplification product is the TT genotype, the tested Hu sheep is determined to have the trait of high lambing number. When the genotype at position 75 of the SNP3 amplification product is the TT genotype, the tested Hu sheep is determined to have the trait of high lambing number. When the genotype at position 79 of the SNP4 amplification product is AA, the tested Hu sheep is determined to have the trait of high lambing number. When the genotype at position 83 of the SNP5 amplification product is AA, the tested Hu sheep is determined to have the trait of high lambing number.

8. A method for genetic improvement of Hu sheep, characterized in that, The method includes the steps of successive breeding of individuals with the dominant SNP molecular marker genotype as described in claim 1, and elimination of individuals with other genotypes.

Images