A primer probe combination for detecting hepatitis b virus, a detection product and application thereof

Abstract

The application discloses a primer probe combination for detecting hepatitis B virus, a detection product and application thereof, and relates to the technical field of hepatitis B virus detection. The primer probe combination comprises a forward primer HBV-FP, a reverse primer HBV-RP and a detection probe HBV-Probe. The nucleotide sequence of the forward primer HBV-FP is shown as SEQ ID NO. 1, the nucleotide sequence of the reverse primer HBV-RP is shown as SEQ ID NO. 2, and the nucleotide sequence of the detection probe HBV-Probe is shown as SEQ ID NO. 3. The 5' end of the detection probe HBV-Probe is coupled with a first fluorescent group, and the 3' end is connected with a quenching group. The detection system, the detection product and the detection method provided by the primer probe combination have good specificity, strong specificity, good linearity, good repeatability, high sensitivity and wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of hepatitis B virus detection technology, and in particular to a primer-probe combination for detecting hepatitis B virus, a detection product, and its application. Background Technology

[0002] Hepatitis B virus (HBV) belongs to the genus *Orthotropic hepatoviridae* of the family Hepatoviridae. It is a non-covalently closed circular DNA virus. Based on differences in the complete HBV genome sequence or the S gene sequence, HBV is classified into 10 genotypes (A and J). Furthermore, subtypes A, B, C, D, F, and I have been identified, resulting in a total of 61 subtypes. HBV can infect humans, chimpanzees, tree shrews, and animals such as pigs, mice, rats, marmots, and ducks. HBV infection can lead to serious diseases in animals, including chronic hepatitis, liver failure, cirrhosis, and hepatocellular carcinoma.

[0003] If biological products are contaminated with viruses due to the introduction of these viruses into their raw materials or production process, their clinical use will pose a threat to human health. The 2020 edition of the Chinese Pharmacopoeia, the United States Pharmacopeia, and the FDA all mandate HBV safety control for biological products used in gene therapy, cell therapy, and other similar treatments. Therefore, broad-spectrum detection of HBV subtypes in biological products has become a crucial factor influencing their production and sales. Summary of the Invention

[0004] This invention provides a primer-probe combination, detection product, and its application for detecting hepatitis B virus (HBV). Targeting 10 genotypes and 61 subtypes of HBV type AJ, primers and probes with good sensitivity and specificity are designed. An exogenous internal control is introduced to establish a dual-channel quantitative real-time PCR detection method to examine HBV contamination in test samples (biological products). Specifically, this is achieved through the following techniques.

[0005] In a first aspect, the present invention provides a primer-probe combination for detecting hepatitis B virus, comprising a forward primer HBV-FP, a reverse primer HBV-RP, and a detection probe HBV-Probe; the nucleotide sequence of the forward primer HBV-FP is shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer HBV-RP is shown in SEQ ID NO.2, and the nucleotide sequence of the detection probe HBV-Probe is shown in SEQ ID NO.3; the detection probe HBV-Probe has a first fluorescent group coupled to its 5' end and a quenching group attached to its 3' end.

[0006] Further, the first fluorescent group is FAM, TET, NED, ROX, CY3, CY5, VIC, JOE, HEX, TexasRED or LC RED460 fluorescent group, and the quenching group is MGB, TAMRA, NFQ, ECLIPSE, DABCYL, BHQ1 or BHQ2 quenching group.

[0007] Optionally, the nucleotide sequence of the forward primer HBV-FP is 5'-atggagaacacaacatcagg-3';

[0008] The nucleotide sequence of the reverse primer HBV-RP is 5'-agcaggatgaagaggaatatg-3';

[0009] The detection probe HBV-Probe is: 5'-FAM-acgccgcagacacatccagc-BHQ1-3'.

[0010] In a second aspect, the present invention provides a system for detecting hepatitis B virus, comprising the above-described primer-probe combination.

[0011] Furthermore, the aforementioned system for detecting hepatitis B virus also includes internal control plasmids and internal control probes.

[0012] Furthermore, the nucleotide sequence of the target fragment of the internal control plasmid is as follows:

[0013] TACTTGTAAGCGGACTAATGGTTCGCTATGCTGACCTGAGCATGCGAGACTAGGAGCTGAACTTGCCTAGGTGCTAGAGGTTAACGACAGGTGGTGATTGA, as shown in SEQ ID NO.4;

[0014] The nucleotide sequence of the internal control probe is shown in SEQ ID NO.5; the 5' end of the internal control probe is coupled with a second fluorescent group, and the 3' end is connected with a quenching group; the second fluorescent group is different from the first fluorescent group.

[0015] The internal control probe is: 5'-HEX-ctgacctgagcatgcgagactaggagctg–BHQ1-3'.

[0016] A third aspect of the present invention provides a product for detecting hepatitis B virus, the product comprising the above-described primer-probe combination, or comprising the above-described system for detecting hepatitis B virus.

[0017] When using qPCR for nucleic acid detection, factors such as operator error, residual inhibitors after nucleic acid extraction, and sample type can all affect the efficiency of PCR amplification, leading to a risk of false negatives. The kit provided by this invention employs dual-mode quantitative PCR technology and includes a fragment that does not interfere with the amplification of the target sequence. This fragment is ligated into an existing vector to create an artificial internal reference control (IC) plasmid and an internal reference control probe. By adding the IC plasmid and probe to the sample and simultaneously performing nucleic acid extraction and detection, the IC amplification curve can be used to monitor sample extraction loss, the presence of inhibition in the detection system, and any errors during the operation, thereby avoiding false negatives and ensuring more accurate and reliable results.

[0018] Furthermore, the product is a test kit, test strip, or test chip.

[0019] In a fourth aspect, the present invention provides a method for detecting hepatitis B virus not for the purpose of disease diagnosis and treatment, using the above-described primer-probe combination, or the above-described system for detecting hepatitis B virus, or the above-described product for detecting hepatitis B virus.

[0020] The claim in this invention that it is "not for the purpose of disease diagnosis and treatment" refers to its use in detecting HBV infection in samples, including but not limited to HBV contamination in environments / scenarios such as air, water, soil, biological products, surfaces of objects / instruments, waste liquids, and laboratories. In other words, the technical means provided by this invention can be used in any application scenario that is not directly used for the diagnosis or treatment of HBV-related diseases / symptoms in humans or animals.

[0021] Furthermore, methods for detecting hepatitis B virus not for the purpose of disease diagnosis and treatment include the following steps:

[0022] The genome of the sample to be tested was extracted and prepared into a test sample. The internal control plasmid was used to prepare a negative control. The HBV virus standard and the internal control plasmid were used to prepare a positive control. RNase-free water was used as a template-free control.

[0023] Using the primer-probe combination, the test sample, negative control, positive control, and template-free control were detected by real-time quantitative PCR.

[0024] Based on the test results, determine whether the sample tested is positive for hepatitis B virus.

[0025] Furthermore, the judgment criteria are as follows: the detection result is valid when both the first and second fluorescent channels of the template-free control are negative; and the first fluorescent channel of the negative control is negative and the second fluorescent channel is positive; and both the first and second fluorescent channels of the positive control are positive.

[0026] When the first fluorescent channel of the sample is positive, the result is determined to be positive;

[0027] When both the first and second fluorescent channels of the sample are negative; or when the first fluorescent channel of the sample is at the boundary value and the second fluorescent channel is negative, the result is determined to be qPCR inhibited.

[0028] When the first fluorescent channel of the sample is negative and the second fluorescent channel is positive, the result is judged as negative;

[0029] When the first fluorescent channel of the sample is at the boundary value and the second fluorescent channel is positive, the test result is deemed invalid and the sample volume needs to be increased for retesting.

[0030] Compared with the prior art, the advantages of the present invention are:

[0031] 1. The primer-probe combination for detecting hepatitis B virus provided by this invention, as well as its related detection system and detection products, have good specificity and high specificity. They show no cross-reactivity with HCMV, EBV, and the genomes of common engineered cells (African green monkey kidney cells Vero, Chinese hamster ovary cells CHO-K1, human embryonic kidney cells 293, etc.), and the introduction of cell genomes does not affect the normal detection of HBV. They also have good linearity and reproducibility, and high sensitivity, reaching 100 copies / reaction.

[0032] 2. It has excellent broad-spectrum detection characteristics, and has very good detection capabilities for 10 genotypes and 61 subtypes of HBV virus. Attached Figure Description

[0033] Figure 1 The results of the standard curve and linearity detection of HBV plasmid standard in Example 2 are shown.

[0034] Figure 2 The results show the sensitivity detection of the HBV plasmid standard in Example 2.

[0035] Figure 3 The results of robustness and specificity testing of the HBV qPCR detection system in Example 3 are shown. Detailed Implementation

[0036] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0037] In specific embodiments of the present invention, the main reagents used are shown in Table 1 below.

[0038] Table 1 Main Reagents

[0039] Example 1: Design and synthesis of HBV primers, probes, internal control plasmids, and internal control probes.

[0040] 1. Design and synthesis of HBV primers and probes

[0041] In this embodiment, the genomes of 10 genotypes and 61 subtypes of HBV strains (AJ) were downloaded from NCBI for sequence alignment. Primers and probes specifically designed for HBV detection were then developed, and their sequences are shown in Table 2. The primers were custom-synthesized by Tianyi Huiyuan Company (PAGE purification method), and the probes were custom-made by Sangon Biotech Company (HPLC purification method).

[0042] Table 2 HBV qPCR primer and probe sequences

[0043] 2. Design and synthesis of internal control plasmid target fragments and internal control probes

[0044] The target fragment IC of the internal control plasmid was artificially synthesized, and the recombinant plasmid pUC57-IC was constructed using pUC57 as the base vector. The nucleotide sequence of the target fragment of the internal control plasmid is as follows:

[0045] TACTTGTAAGCGGACTAATGGTTCGCTATGCTGACCTGAGCATGCGAGACTAGGAGCTGAACTTGCCTAGGTGCTAGAGGTTAACGACAGGTGGTGATTGA, as shown in SEQ ID NO.4.

[0046] This internal control plasmid was used as a template and added to the HBV qPCR detection system. The primer and probe sequences for IC are shown in Table 3. The primers were custom-made by Tianyi Huiyuan (PAGE purified), and the probes were custom-made by Sangon Biotech (HPLC purified).

[0047] Table 3 HBV qPCR primer and probe sequences

[0048] 3. Establishment of the reaction system and reaction procedure

[0049] After optimization, the reaction systems and procedures in Tables 4 and 5 showed the best results for HBV qPCR detection. The FAM channel is used to detect HBV, and the HEX channel is used to detect IC, monitoring the presence of inhibitory factors in the sample.

[0050] Table 4 HBV qPCR detection reaction system

[0051] Table 5 qPCR reaction procedure

[0052] Example 2: Linearity and sensitivity verification of the HBV qPCR detection system

[0053] Following the content of Example 1, the HBV genome sequence was artificially synthesized, and recombinant plasmids were constructed. Standards were prepared and a standard curve was established: one HBV standard plasmid pUC57-HBV and an internal control plasmid standard pUC57-IC were artificially constructed; the HBV standard plasmid pUC57-HBV was extracted using the Plasmid Mini Kit I reagent kit, and the plasmid concentration was measured and the plasmid copy number was calculated.

[0054] The HBV plasmid standard solution was diluted sequentially to 2×10⁻⁶. 6 2×10 5 2×10 4 2×10 3 2×10 2 copies / μL, and used as points on the standard curve; with 2×10 1 HBV plasmid standard solution of copies / μL was used as a sensitivity control, and 500 copies of pUC57-IC plasmid standard were added to each reaction as an internal control of the reaction system.

[0055] qPCR was performed using the amplification systems and procedures shown in Tables 4 and 5. Three independent replicate experiments were conducted on different 3 days, with 8 wells for each plasmid sensitivity control.

[0056] Test results as follows Figure 1 , Figure 2 As shown in Table 6, the qPCR detection system provided by this invention uses HBV plasmid standards as templates, and its standard curve correlation coefficient R... 2 >0.99, with a sensitivity of 100 copies / reaction.

[0057] Table 6 Detection Results of HBV Plasmid Standards

[0058] Example 3: Specificity and robustness of HBV detection methods

[0059] 1. Human and animal cellular genomic DNA

[0060] The African green monkey kidney cells (Vero), Chinese hamster ovary cells (CHO-K1), and human embryonic kidney cells (293) used in this embodiment were all preserved by the patent applicant of this invention and were analyzed using QIAamp. Genomic DNA was extracted using the Mini kit (50) (QIAGEN, 51304).

[0061] After nucleic acid extraction, working concentration genomic DNA was prepared: the concentration of the extracted cellular genomic DNA was measured using a micro-spectrophotometer; based on the measured concentration, human and animal cell genomic DNA was diluted to 20 ng / μL with RNase-free water; 200 μL of the extracted DNA with a physical titer of 10 was extracted using the Viral Nucleic Acid Purification Kit (Simgen, 4002050). 6 / ml of HCMV and EBV viral genomes were dissolved in 50 μl of RNase-free water. 5 μl was used as a template for qPCR, with 100 copies / reaction of pUC57-HBV plasmid standard as a sensitivity control. The reaction system and procedure were the same as in Tables 4 and 5.

[0062] The results are as follows Figure 3 As shown, the HBV qPCR detection system showed no cross-reactivity with HCMV, EBV, and common engineered cell genomes. Furthermore, the introduction of cell genomes did not affect the normal detection of HBV. The amplification results are summarized in Tables 7 and 8.

[0063] Table 7 Specific CT values ​​of HBV qPCR detection system

[0064] Table 8. Robustness CT values ​​of HBV qPCR detection system

[0065] Application Example 1: Detection of HBV-contaminated 293T cells using the primer-probe combination of the present invention.

[0066] The primer-probe combination provided by this invention was used to detect 293T cells contaminated with HBV artificially, as follows.

[0067] Negative control: Take 200 μL of PBS and add 5000 copies of IC plasmid as a negative control.

[0068] Sample to be tested: Take 10 6 293T cells were added to 200 μL of PBS and serially diluted to 10⁻⁶. 2 The sample to be tested consisted of HBV virus solution at PFU / mL and 5000 copies of IC plasmid.

[0069] Positive control: Take 200 μL and serially dilute with PBS to 10⁻⁶. 2 IU / mL HBV and 5000 copies of IC plasmid served as positive controls.

[0070] DNA was extracted from all the above samples (negative control, test sample and positive control) using the Viral Nucleic Acidpurification kit (simgen, 4002050), and 5 μL was used as working solution for qPCR detection.

[0071] Template-free control: RNase-free water.

[0072] Sensitivity control: HBV plasmid standard was serially diluted to 20 copies / μL, and 5 μL of HBV was used as template, i.e., 100 copies / reaction, as a sensitivity control.

[0073] The reaction system and amplification procedure are the same as those in Tables 4 and 5. The detection results are shown in Table 9. Based on the judgment criteria in Tables 10 and 11, the 293T cells were determined to be contaminated with HBV.

[0074] Table 9 HBV qPCR Detection Results

[0075] Table 10 Criteria for Determining the Validity of HBV qPCR Detection Experiments

[0076] Table 11 Criteria for Interpreting HBV qPCR Detection Results

[0077] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. A primer-probe combination for detecting hepatitis B virus, characterized in that, It includes a forward primer HBV-FP, a reverse primer HBV-RP, and a detection probe HBV-Probe; the nucleotide sequence of the forward primer HBV-FP is shown in SEQ ID NO.1, the nucleotide sequence of the reverse primer HBV-RP is shown in SEQ ID NO.2, and the nucleotide sequence of the detection probe HBV-Probe is shown in SEQ ID NO.

3. The detection probe HBV-Probe has a first fluorescent group coupled to its 5' end and a quenching group attached to its 3' end.

2. The primer-probe combination for detecting hepatitis B virus according to claim 1, characterized in that, The first fluorescent group is FAM, TET, NED, ROX, CY3, CY5, VIC, JOE, HEX, Texas RED or LC RED460 fluorescent group, and the quenching group is MGB, TAMRA, NFQ, ECLIPSE, DABCYL, BHQ1 or BHQ2 quenching group.

3. A system for detecting hepatitis B virus, characterized in that, The system comprises the primer-probe combination as described in claim 1 or 2.

4. The system for detecting hepatitis B virus according to claim 3, characterized in that, It also includes internal control plasmids and internal control probes.

5. The system for detecting hepatitis B virus according to claim 4, characterized in that, The nucleotide sequence of the target fragment of the internal control plasmid is shown in SEQ ID NO.4, and the nucleotide sequence of the internal control probe is shown in SEQ ID NO.5; the 5' end of the internal control probe is coupled with a second fluorescent group, and the 3' end is connected with a quenching group; the second fluorescent group is different from the first fluorescent group.

6. A product for detecting hepatitis B virus, characterized in that, It comprises the primer-probe combination of claim 1 or 2, or the system of any one of claims 3-5.

7. The product for detecting hepatitis B virus according to claim 6, characterized in that, The products mentioned are test kits, test strips, or test chips.

8. A method for detecting hepatitis B virus not for the purpose of disease diagnosis and treatment, characterized in that, The detection is performed using the primer-probe combination as described in claim 1 or 2, or the system as described in any one of claims 3-5, or the product as described in claim 6 or 7.

9. The method for detecting hepatitis B virus according to claim 8, not for the purpose of disease diagnosis and treatment, is characterized in that, Includes the following steps: The genome of the sample to be tested was extracted and prepared into a test sample. The internal control plasmid was used to prepare a negative control. The HBV virus standard and the internal control plasmid were used to prepare a positive control. RNase-free water was used as a template-free control. Using the primer-probe combination, the test sample, negative control, positive control, and template-free control were detected by real-time quantitative PCR. Based on the test results, determine whether the sample tested is positive for hepatitis B virus.

10. The method for detecting hepatitis B virus according to claim 9, not for the purpose of disease diagnosis and treatment, characterized in that, The judgment criteria are as follows: the detection result is valid when both the first and second fluorescent channels of the template-free control are negative; and the first fluorescent channel of the negative control is negative and the second fluorescent channel is positive; and both the first and second fluorescent channels of the positive control are positive. When the first fluorescent channel of the sample is positive, the result is determined to be positive; When both the first and second fluorescent channels of the sample are negative; or when the first fluorescent channel of the sample is at the boundary value and the second fluorescent channel is negative, the result is determined to be qPCR inhibited. When the first fluorescent channel of the sample is negative and the second fluorescent channel is positive, the result is judged as negative; When the first fluorescent channel of the sample is at the boundary value and the second fluorescent channel is positive, the test result is deemed invalid and the sample volume needs to be increased for retesting.

Images