Intrathecal administration method
By measuring the total body dose after intrathecal administration of the therapeutic agent and utilizing the negative correlation between total body dose and intrathecal dose, the intrathecal dose can be precisely adjusted, solving the problem of individualized drug intake in intrathecal administration and improving the reliability of treatment effects and patient compliance.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- F HOFFMANN LA ROCHE & CO AG
- Filing Date
- 2024-12-13
- Publication Date
- 2026-07-10
Smart Images

Figure CN122374031A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for determining the cerebral uptake, effectiveness, and dosage of a therapeutic agent administered intrathecally to the brain of a subject, particularly a human patient. The invention further provides for the treatment of subjects within a subgroup of patients identified by the method of the invention and / or treatment using the dosage determined by the invention. Background Technology
[0002] Effectively delivering therapeutic agents to a patient's brain and achieving adequate brain uptake levels corresponding to the desired therapeutic outcome is extremely challenging. One reason is that the blood-brain barrier (BBB) hinders and alters the efficient transport of therapeutic agents into brain tissue. The specific route used for drug delivery to the brain is intrathecal administration, which involves injecting the therapeutic agent into the spinal canal or subarachnoid space to reach the cerebrospinal fluid (CSF), thereby bypassing the BBB.
[0003] However, intrathecal drug delivery is not without its challenges. The most significant is that even with intrathecal administration, it is difficult to predict whether a sufficient amount / concentration of the drug will reach the brain to achieve the desired therapeutic effect. This may be due to variations in the rates of CSF and metabolic free water production and reabsorption, as well as further barriers to the desired brain target sites. Therefore, it is often difficult to determine the effective dose of an intrathecally administered drug. A further complexity arises because the amount (e.g., %) of a given intrathecal dose reaching the brain can vary significantly from patient to patient in other ways that cannot necessarily be predicted.
[0004] Existing methods of intrathecal administration of therapeutic agents lack the precision to tailor effective doses for individual patients and cannot adapt to variability in patient response through dynamic dose adjustments. In this respect, existing guidelines for intrathecal dosing may not adequately consider individual patient factors. Therefore, there is a need in the art for improved methods of predicting and delivering effective doses of therapeutic agents to the brain via intrathecal administration, which would improve treatment at a patient-specific level. Such methods must also avoid causing excessive invasiveness and discomfort to patients, as this would reduce overall acceptability, the likelihood of patient compliance, and the feasibility of adjusting doses to individual patients. Patients receiving intrathecal administration have already undergone invasive injections, and it is therefore particularly important to avoid further stress and pain for these patients. This also helps to avoid extensive, complex, and expensive procedures for individual patients, such as brain imaging and CT scans.
[0005] This invention overcomes these problems in the art by providing a new and improved method for predicting, determining, and delivering effective intrathecal therapeutic agents to the brain, which is advantageously non-invasive to the patient and highly efficient to perform. Summary of the Invention
[0006] This invention relates to novel methods and uses in which, for a subject who has been administered an intrathecal dose of a therapeutic agent, the total amount of the therapeutic agent in the subject is determined and used to determine the effectiveness of the therapeutic agent, brain uptake, or subsequent intrathecal doses. In particular, the total amount of the therapeutic agent in such subjects has been surprisingly found to be negatively correlated in a robust and reliable manner with the uptake of the intrathecal dose of the therapeutic agent in the subject's brain, allowing for patient-specific successful prediction and the ability to freely customize subsequent doses.
[0007] Therefore, in a first aspect, the present invention provides a method for determining the intrathecal uptake of a therapeutic agent by the brain of a subject who has been administered an intrathecal dose of the therapeutic agent, the method comprising:
[0008] a) Determine the total dose of the treatment agent in the subject; and
[0009] b) Use the whole-body dose of the therapeutic agent to determine the intrathecal uptake of the therapeutic agent by the subject's brain.
[0010] In another aspect, the present invention provides a method for determining the likelihood that an intrathecal dose of a therapeutic agent has a therapeutic effect on the brain of a subject who has been administered an intrathecal dose of the therapeutic agent, the method comprising:
[0011] a) Determine the total dose of the treatment agent in the subject; and
[0012] b) Use the total body dose of the therapeutic agent in the subject to determine the likelihood that an intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain.
[0013] In another aspect, the present invention provides a method for determining an additional intrathecal dose of a therapeutic agent to be administered to a subject who has already been given a previous intrathecal dose of the therapeutic agent, the method comprising:
[0014] a) Determine the systemic dose of the therapeutic agent in the subject following administration of the previous intrathecal dose; and
[0015] b) Use the total dose of the therapeutic agent in the subject to determine an additional intrathecal dose of the therapeutic agent to be administered to the subject.
[0016] In another aspect, the present invention provides a therapeutic agent for use in a method of treating a subject, wherein the subject has previously been administered a previous intrathecal dose of the therapeutic agent, the total amount of the previous intrathecal dose of the therapeutic agent in the subject has been determined, and the total amount of the therapeutic agent in the subject has been determined to be above, equal to, within, or below a predetermined value or range, wherein the method includes administering an additional intrathecal dose of the therapeutic agent.
[0017] In another aspect, the present invention provides a method of treating a subject with a therapeutic agent, wherein the subject has previously been administered a previous intrathecal dose of the therapeutic agent, the total amount of the previous intrathecal dose of the therapeutic agent in the subject has been determined, and the total amount of the therapeutic agent in the subject has been determined to be above, equal to, within, or below a predetermined value or range, wherein the method includes administering an additional intrathecal dose of the therapeutic agent. Attached Figure Description
[0018] Figure 1: C-level concentration of the therapeutic agent in individual plasma observed on day 5. max (nmol / L) Comparison with the %ID (sum of gray matter, white matter, and cerebrospinal fluid) of the therapeutic agent in the head. Procedure: A = 5 mL CSF and 5 mL flush, no movement; B = 0.5 mL CSF and 0.5 mL flush, no movement; C = 15 mL CSF and 15 mL flush, no movement; D = 0.5 mL CSF and 0.5 mL flush, movement present. Detailed Implementation
[0019] This invention addresses the problem of intrathecal drug administration. While known doses of therapeutic agents can be administered intrathecally to subjects, the amount of agent successfully taken up to the subject's brain—and therefore the effectiveness and likelihood of success—can vary considerably based on factors that may also be patient-specific. Therefore, for a given intrathecal dose, it is difficult to determine how effective that dose will be in a particular patient. In this regard, the inventors aim to provide an improved method for determining brain uptake and providing adjusted intrathecal doses, which does not involve invasive procedures (such as directly measuring the amount of drug within the CSF or performing a CT scan), and avoids the expensive nature or potential dangers and adverse reactions of such procedures.
[0020] Therefore, the present invention relates to novel methods and uses in which the total amount of the therapeutic agent in a subject who has been given an intrathecal dose has been determined and used to determine / predict the effectiveness, brain uptake, or subsequent intrathecal dose of the therapeutic agent. In particular, the total amount of the therapeutic agent in such subjects (e.g., measured as the maximum concentration of the therapeutic agent in an in vitro plasma sample collected from the subject) has surprisingly been found to be negatively correlated with the brain uptake of the therapeutic agent from the intrathecal dose. Therefore, the method of the present invention utilizes this phenomenon arising from a previous intrathecal dose of the therapeutic agent and measures the total amount of the therapeutic agent after the previous dose to determine the brain uptake and effectiveness of the previous dose. The method of the present invention can also determine additional intrathecal doses of the therapeutic agent, for example, increasing the dose if the total amount of the therapeutic agent indicates low brain uptake / effectiveness, or maintaining the dose if the total amount of the therapeutic agent indicates sufficient brain uptake / effectiveness. In implementing these methods, the inventors have found them surprisingly robust and reliable, for example, with success across various patient characteristics (age, BMI, sex, etc.) and intrathecal dosing regimens. Furthermore, the method of the present invention allows for patient-specific prediction of success and customization of subsequent doses without the need for highly invasive and expensive procedures.
[0021] The method of the present invention
[0022] The methods of the present invention can generally take different forms, and it should be understood that specific embodiments and features of any method aspect of the present invention will generally also be applicable to other methods as aspects of the present invention. For example, the methods of the present invention may be methods for determining the uptake of an intrathecal dose of a therapeutic agent in the brain of a subject, methods for determining the likelihood that an intrathecal dose of a therapeutic agent has a therapeutic effect on the brain of a subject, and methods for determining additional intrathecal doses of a therapeutic agent to be administered to a subject. These methods are generally performed on subjects who have received a (previous) intrathecal dose of the therapeutic agent in question. In embodiments, the method is generally performed in the order described. In embodiments, the method of the present invention includes the steps described. In embodiments, the method of the present invention comprises the steps described.
[0023] In embodiments, the method of the present invention is an in vitro method. In embodiments, the method of the present invention is performed on a sample previously obtained from the subject in question. In embodiments, the method of the present invention is performed on a sample. In embodiments, the method of the present invention is performed on an in vitro sample. In embodiments, the intrathecal dose of the therapeutic agent is the dose of the therapeutic agent that has been / is administered intrathecally. In embodiments, the intrathecal dose of the therapeutic agent is the amount of the therapeutic agent that has been / is administered intrathecally. In embodiments, the intrathecal dose of the therapeutic agent is the dose of the therapeutic agent that has been administered intrathecally. In embodiments, the intrathecal dose of the therapeutic agent is the amount of the therapeutic agent that has been administered intrathecally. In embodiments, the subject is a mammal. In embodiments, the subject is a rhesus monkey. In embodiments, the subject is a human. In embodiments, the subject is a mouse. In embodiments, the subject is a human patient.
[0024] Intrathecal administration is a known and established route of administration. In one embodiment, intrathecal administration is applied to the CSF. In another embodiment, intrathecal administration is applied directly to the CSF. In this context, "directly" means that the blood vessel BBB is bypassed, but does not preclude the administered therapeutic agent from reaching the CSF through other secondary structures and spaces (e.g., during the normal course of intrathecal administration). In another embodiment, intrathecal administration is applied into the spinal canal or subarachnoid space. In yet another embodiment, intrathecal administration is applied into the dural sac.
[0025] In a first aspect, the present invention provides a method for determining the intrathecal uptake of a therapeutic agent by the brain of a subject who has been administered an intrathecal dose of the therapeutic agent, the method comprising:
[0026] a) Determine the total dose of the treatment agent in the subject; and
[0027] b) Use the whole-body dose of the therapeutic agent to determine the intrathecal uptake of the therapeutic agent by the subject's brain.
[0028] In an embodiment, determining the uptake of the therapeutic agent to the subject's brain includes determining the amount of the therapeutic agent reaching the subject's brain. In an embodiment, determining the uptake includes determining whether the therapeutic agent has been taken into the subject's brain. In an embodiment, determining the uptake includes determining whether an effective amount of the therapeutic agent has been taken into the subject's brain. In an embodiment, determining the uptake includes determining a percentage of the intrathecal dose of the therapeutic agent taken into the brain. In an embodiment, determining the uptake includes determining the ratio between the amount of the intrathecal dose of the therapeutic agent taken into the subject's brain and the amount of the intrathecal dose of the therapeutic agent not taken into the subject's brain. In an embodiment, determining the uptake includes determining the efficiency of the intrathecal dose uptake of the therapeutic agent. In an embodiment, the subject has previously been administered an intrathecal dose of the therapeutic agent. In an embodiment, the method itself does not include administering an intrathecal dose of the therapeutic agent to the subject. In an embodiment, the method determines the uptake of the intrathecal dose of the therapeutic agent. In an embodiment, the method determines the uptake of the intrathecal dose of the therapeutic agent previously administered.
[0029] In embodiments, determining the systemic dose of the therapeutic agent in a subject includes determining the amount of the therapeutic agent in the subject's blood. In embodiments, determining the systemic dose includes determining the amount of the therapeutic agent in the subject's plasma. In embodiments, determining the systemic dose includes determining the maximum systemic concentration of the therapeutic agent in the subject. In embodiments, determining the systemic dose includes determining the maximum concentration of the therapeutic agent in the subject's blood. In embodiments, determining the systemic dose includes determining the maximum concentration of the therapeutic agent in the subject's plasma. In embodiments, the maximum concentration is the maximum concentration after (previously) administered an intrathecal dose to the subject. In embodiments, the subject's blood is a sample of the subject's blood. In embodiments, the subject's blood is an in vitro sample of the subject's blood. In embodiments, the subject's plasma is a sample of the subject's plasma. In embodiments, the subject's plasma is an in vitro sample of the subject's plasma. In embodiments, the systemic dose of the therapeutic agent in the method of the present invention is the maximum concentration of the therapeutic agent in the subject's blood / plasma after a previously administered intrathecal dose of the therapeutic agent, preferably wherein the blood / plasma is an in vitro sample. In embodiments, the maximum concentration of the therapeutic agent "after an intrathecal dose" is the maximum concentration of the therapeutic agent reached in the subject (e.g., in the subject's blood / plasma) due to the intrathecal dose. In embodiments, the maximum concentration is the maximum concentration of a previously administered intrathecal dose that can be detected in the subject's blood / plasma (e.g., in its in vitro sample). In embodiments, "determining the amount" includes measuring the amount of the therapeutic agent. Any suitable method for the therapeutic agent in question can be used to determine the systemic amount of the therapeutic agent. In embodiments, chromatography (such as high-performance liquid chromatography or gas chromatography), enzyme-linked immunosorbent assay (ELISA), immunoassay, mass spectrometry, nuclear mass resonance, or titration can be used to determine the systemic amount of the therapeutic agent. In preferred embodiments, ELISA is used. Preferably, human complement factor H ELISA (hELISA) is used. For example, in embodiments where the therapeutic agent is an oligonucleotide, ELISA, PCR (such as quantitative PCR or digital droplet PCR), spectrophotometry, gel or capillary electrophoresis, or mass spectrometry can be used to determine the systemic amount of the therapeutic agent. In preferred embodiments where the therapeutic agent is an oligonucleotide, ELISA is used. Preferably, the therapeutic agent is an oligonucleotide, and hELISA is used.
[0030] In embodiments, the total body dose is determined within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours after administration of the (previous) intrathecal dose. In embodiments, the total body dose is determined between 1 and 24 hours, 1 and 48 hours, or 1 and 72 hours after administration of the (previous) intrathecal dose. In embodiments, the total body dose is determined within 24 hours after administration of the (previous) intrathecal dose. In embodiments, the total body dose is determined at least 24 hours after administration of the (previous) intrathecal dose. In embodiments, the total body dose is determined at least 48 hours after administration of the (previous) intrathecal dose. In embodiments, the total body dose is determined at least 72 hours after administration of the (previous) intrathecal dose. In this embodiment, the maximum systemic concentration is determined within 24 hours of administration of the (previous) intrathecal dose (such as at any point within the aforementioned 24 hours). In this embodiment, the maximum systemic concentration of rugonersen is determined within 24 hours of administration of the (previous) intrathecal dose (such as at any point within the aforementioned 24 hours).
[0031] In this embodiment, the total body dose is determined within 24 days after the (previous) intrathecal dose is administered. In this embodiment, the total body dose is determined between 1 and 24 days, 2 and 24 days, or optionally 3 and 24 days after the (previous) intrathecal dose is administered. In this embodiment, the total body dose is determined at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, and / or 24 days after the (previous) intrathecal dose is administered.
[0032] In this embodiment, the intake of an intrathecal dose of a therapeutic agent determined using a whole-body dose to the subject's brain is an intrathecal dose taken within 1 day, at least 1 day, at least 2 days, at least 3 days, at least 4 days, or at least 5 days after administration of the intrathecal dose. In this embodiment, the intake of an intrathecal dose of a therapeutic agent determined using a whole-body dose to the subject's brain is an intrathecal dose taken within 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, or 21 days after administration of the intrathecal dose. In this embodiment, the intake of an intrathecal dose of a therapeutic agent determined using a whole-body dose to the subject's brain is an intrathecal dose taken between 1 and 21 days, optionally between 5 and 12 days, after administration of the intrathecal dose. In an embodiment, the intake of an intrathecal dose of a therapeutic agent determined using a whole-body dose to the brain of the subject is the intake of an intrathecal dose within 1 day or on days 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 after administration of the intrathecal dose.
[0033] In embodiments, the above-described time ranges / points for determining the whole-body dose and the uptake to the brain are used in combination in the method of the invention. In this regard, it should be understood that the whole-body dose is not necessarily determined at the same time point as the time point at which the uptake to the brain is determined using the whole-body dose. Therefore, in embodiments, the whole-body dose of the therapeutic agent is measured within 1 hour or between 1 and 48 hours after the (previous) intrathecal dose is administered, and is used to determine the uptake to the brain at time points between 1 and 21 days after the (previous) intrathecal dose is administered. In embodiments, the whole-body dose of the therapeutic agent is measured between 24 and 48 hours after the (previous) intrathecal dose is administered, and is used to determine the uptake to the brain at time points between 5 and 12 days after the (previous) intrathecal dose is administered. In a highly preferred embodiment, the whole-body dose is the maximum whole-body concentration within a specified time period, for example, the maximum whole-body concentration between 1 and 48 hours after the (previous) intrathecal dose is administered.
[0034] For the avoidance of doubt, "day" constitutes a 24-hour period, such as 24 hours after a (previous) intrathecal dose, and "hour" constitutes a 60-minute period, such as 60 minutes after a (previous) intrathecal dose. For the avoidance of doubt, all ranges of days and hours mentioned herein include the stated days and hours, for example, determining the total body dose at least 24 hours after administration includes determining the total body dose 1 day or 24 hours after administration. As another example, determining the total body dose 1 hour after administration includes determining the total body dose at any point between 1 hour (about 60 minutes) and 2 hours (about 120 minutes) after administration (e.g., at about 90 minutes after administration). As another example, determining brain uptake 1 day after administration (e.g., about 24 hours) includes determining brain uptake at any point between 1 day (about 24 hours) and 2 days (about 48 hours) (e.g., at about 36 hours). Generally, the total body dose will be calculated as the maximum total body dose within the specified time period. Typically, brain uptake will be calculated as average, effective, or treatment-related brain uptake over a specified time period.
[0035] In an embodiment, there is a negative correlation between the total body dose and the intrathecal dose of the therapeutic agent uptake to the subject's brain. In an embodiment, the method (e.g., step b) involves negatively correlating the total body dose of the therapeutic agent with the intrathecal dose uptake. Therefore, in an embodiment, the method (e.g., step b) involves negatively correlating the total body dose of the therapeutic agent with the intrathecal dose uptake to determine the intrathecal dose uptake of the therapeutic agent.
[0036] In another aspect, the present invention provides a method for determining the likelihood that an intrathecal dose of a therapeutic agent has a therapeutic effect on the brain of a subject who has been administered an intrathecal dose of the therapeutic agent, the method comprising:
[0037] a) Determine the total dose of the treatment agent in the subject; and
[0038] b) Use the total body dose of the therapeutic agent in the subject to determine the likelihood that an intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain.
[0039] In an embodiment, determining the likelihood that an intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain includes determining whether an intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain.
[0040] In an embodiment, there is a negative correlation between the total body dose and the likelihood that the intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain. In an embodiment, the method (e.g., step b) involves negatively correlating the total body dose of the therapeutic agent with the likelihood that the intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain. Therefore, in an embodiment, the method (e.g., step b) involves negatively correlating the total body dose of the therapeutic agent with the likelihood that the intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain, thereby determining the likelihood that the intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain.
[0041] In another aspect, the present invention provides a method for determining an additional intrathecal dose of a therapeutic agent to be administered to a subject who has already been given a previous intrathecal dose of the therapeutic agent, the method comprising:
[0042] a) Determine the systemic dose of the therapeutic agent in the subject following administration of the previous intrathecal dose; and
[0043] b) Use the total dose of the therapeutic agent in the subject to determine an additional intrathecal dose of the therapeutic agent to be administered to the subject.
[0044] In an embodiment, the prior intrathecal dose of the therapeutic agent is the intrathecal dose of the therapeutic agent that has been administered to the subject prior to performing the method. In an embodiment, the prior intrathecal dose of the therapeutic agent allows for the determination of the systemic amount of the prior intrathecal dose in the subject, for example, in step a) of the method. In an embodiment, the prior intrathecal dose of the therapeutic agent allows for the determination of the maximum systemic concentration of the prior intrathecal dose in the subject, for example, in step a) of the method. In an embodiment, the maximum concentration is the maximum systemic concentration of the therapeutic agent achieved due to the administration of the prior intrathecal dose of the therapeutic agent. It should be understood here that the prior intrathecal dose is not necessarily the first dose of the therapeutic agent that has been administered to the subject. However, in an embodiment, the prior intrathecal dose is the first dose of the therapeutic agent that has been administered to the subject.
[0045] It should be understood that, in embodiments, an “additional” intrathecal dose can be any additional intrathecal dose to be administered to the subject. An additional intrathecal dose can be the amount of a single additional intrathecal dose to be administered to the subject or a single amount of one or more additional intrathecal doses, such as each of one or more additional intrathecal doses. An additional intrathecal dose does not include or relates to a previous intrathecal dose. However, in some embodiments, it can be well determined that the additional intrathecal dose is the same as the previous intrathecal dose. In embodiments, the subject is prescribed an additional intrathecal dose. In embodiments, the method includes prescribing an additional intrathecal dose to the subject. In embodiments, the additional intrathecal dose is administered to the subject. In embodiments, where specified, the method includes administering an additional intrathecal dose to the subject or providing an additional intrathecal dose to the subject. Otherwise, in embodiments, the method does not include administering or providing an additional intrathecal dose to the subject.
[0046] In an embodiment, there is a negative correlation between the total body dose and the additional intrathecal dose of the therapeutic agent to be administered to the subject. In an embodiment, the method (e.g., step b) involves negatively correlating the total body dose of the therapeutic agent with the additional intrathecal dose of the therapeutic agent to be administered to the subject. Therefore, in an embodiment, the method (e.g., step b) involves negatively correlating the total body dose of the therapeutic agent with the additional intrathecal dose of the therapeutic agent to be administered to the subject, thereby determining the additional intrathecal dose of the therapeutic agent to be administered to the subject.
[0047] In one embodiment, the method includes determining an additional intrathecal dose predicted to have a therapeutic effect on the subject's brain. Therefore, in this embodiment, the additional intrathecal dose has a therapeutic effect on the subject's brain. In this embodiment, the therapeutic effect is the beneficial therapeutic effect of the therapeutic agent. In this embodiment, the method includes determining an additional intrathecal dose that will have a therapeutic effect on the subject's brain.
[0048] In an embodiment, the method includes determining an additional intrathecal dose that is predicted to have an increased therapeutic effect on the subject's brain relative to a previous intrathecal dose. Therefore, in an embodiment, the additional intrathecal dose has an increased therapeutic effect on the subject's brain relative to a previous intrathecal dose of the therapeutic agent. In an embodiment, an increased therapeutic effect means that the additional intrathecal dose is more effective than the previous intrathecal dose. In an embodiment, an increased therapeutic effect means that the additional intrathecal dose is effective, while the previous intrathecal dose is ineffective. In an embodiment, the method includes determining an additional intrathecal dose that will have an increased therapeutic effect on the subject's brain relative to a previous intrathecal dose.
[0049] In embodiments, the method may include any relevant aspects of determining an additional intrathecal dose, including determining whether to administer an additional intrathecal dose, determining the magnitude of the intrathecal dose, determining the frequency of the intrathecal dose, and determining the amount of the intrathecal dose delivered to the brain. In embodiments, the method includes determining the magnitude of the additional intrathecal dose. In embodiments, the method includes determining the magnitude of an additional intrathecal dose to be increased. In embodiments, the method includes increasing the additional intrathecal dose. In embodiments, the method includes increasing the additional intrathecal dose relative to a previous intrathecal dose. In embodiments, the method includes decreasing the additional intrathecal dose. In embodiments, the method includes decreasing the additional intrathecal dose relative to a previous intrathecal dose. In embodiments, the method includes determining to administer an additional intrathecal dose. In embodiments, the method includes determining not to administer an additional intrathecal dose. In embodiments, the additional intrathecal dose is effective, for example, more effective than a previous intrathecal dose. In embodiments, the additional intrathecal dose is safe, for example, less likely to have adverse reactions compared to a previous intrathecal dose. In embodiments, the method includes determining the frequency of the additional intrathecal dose. In embodiments, the method includes determining the frequency of increasing one or more additional intrathecal doses. In one embodiment, the method includes determining the amount of a previous intrathecal dose that has reached the brain. In another embodiment, the method includes determining the amount of a further intrathecal dose that will reach the brain.
[0050] In embodiments, the method includes comparing the total dose of the therapeutic agent with a predetermined value or range. In embodiments, the total dose of the therapeutic agent is compared or evaluated relative to a predetermined value or range. In embodiments, the predetermined value or range corresponds to the total dose of the therapeutic agent in a control subject or population, derived from or having been administered an intrathecal dose of the therapeutic agent. In embodiments, the predetermined value or range corresponds to an intrathecal dose of the therapeutic agent that achieves a therapeutic effect on the subject's brain. In embodiments, the predetermined value or range corresponds to the total dose of the therapeutic agent in a control subject or population, wherein the intrathecal dose of the therapeutic agent achieves a therapeutic effect. In embodiments, the predetermined value or range corresponds to an intrathecal dose of the therapeutic agent that achieves therapeutically effective uptake to the subject's brain. In embodiments, the predetermined value or range corresponds to the total dose of the therapeutic agent in a control subject or population, wherein the intrathecal dose of the therapeutic agent achieves therapeutically effective uptake to the brain. In embodiments, and / or in combination, the predetermined value corresponds to a safe amount of the therapeutic agent. For example, in embodiments, the predetermined value or range is the value or range of the total dose of the therapeutic agent in the subject, which corresponds to a therapeutic agent that achieves a safe therapeutic effect on the subject's brain.
[0051] In embodiments, a predetermined value or range is defined as the total amount of the therapeutic agent in a control group or subject, wherein at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or 50% of the intrathecal dose is taken up by the brain of the control subject. In embodiments with a control group, the percentage of brain uptake is the average (e.g., mean) of brain uptake in the control group. In this type of embodiment, the predetermined value or range corresponds to the desired outcome or therapeutic effect achieved by the therapeutic agent on the brain.
[0052] In an embodiment, if the total amount of the therapeutic agent in the subject indicates that intrathecal administration will be successful, the method includes continuing intrathecal administration to the subject. In an embodiment, if the total amount of the therapeutic agent in the subject indicates that intrathecal administration will be unsuccessful, the method includes not continuing intrathecal administration to the subject. In an embodiment, the method includes determining whether the total amount of the therapeutic agent in the subject is less than, equal to, within, or greater than a predetermined value or range. Therefore, in an embodiment, the method further includes:
[0053] i) If the total systemic dose of the therapeutic agent in the subject is less than a predetermined value or range, or is equal to or within a predetermined value or range, then an additional intrathecal dose of the therapeutic agent will be administered to the subject; or
[0054] ii) If the total dose of the therapeutic agent in the subject is greater than the predetermined value or range, then determine that an additional intrathecal dose of the therapeutic agent will not be administered to the subject.
[0055] In embodiments, if the total body dose of the therapeutic agent in the subject indicates that the prior dose is greater than the dose required to achieve a therapeutic effect and / or greater than the desired or maximum safe dose for the brain, the method includes reducing an additional dose of the therapeutic agent. In embodiments, if the total body dose of the therapeutic agent in the subject indicates that the prior dose is suitable for achieving or reaching a therapeutic effect, the method includes maintaining an additional dose of the therapeutic agent. In embodiments, if the total body dose of the therapeutic agent indicates that the prior dose is less than the dose required to achieve a therapeutic effect, an increased therapeutic effect, a desired therapeutic effect, or a maximum therapeutic effect, the method includes increasing an additional dose of the therapeutic agent. Therefore, in embodiments, the method further includes:
[0056] i) If the total systemic dose of the therapeutic agent in the subject is less than a predetermined value or range, determine that an additional intrathecal dose of the therapeutic agent is less than or the same as the previous intrathecal dose of the therapeutic agent administered to the subject; or
[0057] ii) If the total dose of the therapeutic agent in the subject is the same as or within a predetermined value or range, then determine that the additional intrathecal dose of the therapeutic agent is the same as the previous intrathecal dose of the therapeutic agent administered to the subject; or
[0058] iii) If the total dose of the therapeutic agent in the subject is greater than a predetermined value or range, determine that an additional intrathecal dose of the therapeutic agent is greater than the previous intrathecal dose of the therapeutic agent administered to the subject.
[0059] In embodiments, "less than" a previous dose means substantially less than. In embodiments, "the same as" a previous dose means substantially the same. In embodiments, "the same as" a previous dose means substantially the same or equivalent. In embodiments, "the same as" a previous dose means that both doses achieve substantially the same therapeutic effect. In embodiments, "greater than" a previous dose means that the additional dose achieves a much greater therapeutic effect than the previous dose. In embodiments, "greater than" a previous dose means that the additional dose achieves a therapeutic effect that was not achieved or could have been achieved with the previous dose.
[0060] In this embodiment, “determining” an additional intrathecal dose means predicting the nature of the additional intrathecal dose. In this embodiment, “determining” an additional intrathecal dose means determining the nature of the additional intrathecal dose. In this embodiment, “determining” an additional intrathecal dose means prescribing an additional intrathecal dose to the subject. In this embodiment, the method further includes administering the determined additional intrathecal dose to the subject.
[0061] In any embodiment of the method of the present invention, step a) includes measuring the amount of therapeutic agent in an in vitro sample obtained from the subject.
[0062] In any embodiment of the method of the present invention, step a) includes measuring the concentration of the therapeutic agent in the plasma of the subject.
[0063] In any embodiment of the method of the present invention, the predetermined value is the same as, equivalent to, or derived from the total amount of the therapeutic agent present in the control group / subject, wherein the control group / subject has a therapeutically effective brain uptake of the therapeutic agent. A surprising result of the present invention is the very strong negative correlation between the total amount of the therapeutic agent caused by the intrathecal dose and the brain uptake of the intrathecal dose. It applies independently of the specific intrathecal administration procedure performed, the flushing and volume administered, and the subject's movement. It also applies independently of patient characteristics such as age, sex, and BMI, although those skilled in the art can take such factors into account to obtain a more accurate prediction / dosage determination. Therefore, now that the present invention has been achieved, the total amount of the therapeutic agent known after intrathecal administration, corresponding to the effective dose to the brain in the control group / subject, can be used as a reference value and compared with the total amount of the therapeutic agent in the subject of the method of the present invention. In embodiments, the control subject is equivalent to the subject of the method of the present invention. In embodiments, the control group comprises one or more individuals equivalent to the subject of the method of the present invention. In this embodiment, "equivalent to" means that there is a correlation between intrathecal dose and brain uptake similar to or equivalent to that of the subjects of the present invention.
[0064] In one embodiment, if the total body dose of the therapeutic agent in the subject is greater than a predetermined value or range, the method includes designating the subject as a non-responder to the therapeutic agent. Preferably, in this embodiment, the predetermined value or range is a value or range for a responder control subject / group. In another embodiment, if the total body dose of the therapeutic agent in the subject is greater than or equal to a predetermined value or range, the method includes designating the subject as a non-responder to the therapeutic agent. Preferably, in this embodiment, the predetermined value or range is a value or range for a non-responder control subject / group. In another embodiment, if the total body dose of the therapeutic agent in the subject is less than a predetermined value or range, the method includes designating the subject as a responder to the therapeutic agent. Preferably, in this embodiment, the predetermined value or range is a value or range for a non-responder control subject / group. In yet another embodiment, if the total body dose of the therapeutic agent in the subject is less than or equal to a predetermined value or range, the method includes designating the subject as a responder to the therapeutic agent. Preferably, in this embodiment, the predetermined value or range is a value or range for a responder control subject / group. In this type of embodiment, "responder" and "non-responder" may respectively refer to an "responder" and "non-responder" to an intrathecal dose of a therapeutic agent that is the same as, equivalent to, or similar to a previous intrathecal dose of the therapeutic agent.
[0065] Therapeutic agents
[0066] In the embodiments, the therapeutic agent is a drug, substance, or composition. In the embodiments, the therapeutic agent is any agent capable of having a beneficial therapeutic effect. In the embodiments, the therapeutic agent is any agent capable of having a beneficial therapeutic effect on the brain of a subject. In the embodiments, the therapeutic agent is any drug targeting the brain of a subject. In the embodiments, the therapeutic agent is synthetic, artificial, or not found in nature. In the embodiments, the therapeutic agent is any agent capable of treating, reversing, curing, preventing, improving, or otherwise directly improving any of a disease, infection, or medical condition or its symptoms. Therapeutic agents are known to those skilled in the art, and it should be understood that the invention is not limited to any particular therapeutic agent. In the embodiments, the therapeutic agent is suitable for intrathecal administration. In preferred embodiments, the therapeutic agent is suitable for or capable of achieving its therapeutic effect via intrathecal administration. In the embodiments, the therapeutic agent is a brain-targeting therapeutic agent. In the embodiments, when administered intrathecally, the therapeutic agent is suitable for / capable of targeting the brain. In the embodiments, the therapeutic agent has suitable physicochemical properties (such as hydrophobicity, hydrophilicity, size, mass, and charge) for intrathecal administration to safely have a therapeutic effect on the brain. In embodiments, the therapeutic agent is capable of crossing the BBB and / or the blood-spinal barrier (BSCB). In embodiments, the therapeutic agent has appropriate physicochemical properties for crossing the BBB and / or BSCB.
[0067] In the embodiments, the therapeutic agent is an RNAi (RNA interference) oligonucleotide, antibody, antibody-derived therapeutic fragment or its antigen-binding fragment, monoclonal antibody, ScFv, Fab fragment, F(ab'2) fragment, microantibody, nanobody, bispecific antibody, immunotoxin, antibody-drug conjugate, antisense oligonucleotide, small molecule, biological, vaccine, peptide, enzyme, peptide therapy, nucleic acid-based therapy, cell therapy, immunomodulator, enzyme inhibitor, hormone, cytokine, or radiopharmaceutical. In a preferred embodiment, the therapeutic agent is an oligonucleotide, optionally selected from antisense oligonucleotides, siRNA (small repressor RNA), miRNA (microRNA), other RNAi oligonucleotides, aptamers, and other non-coding RNAs, preferably antisense oligonucleotides. In the embodiments, the therapeutic agent is rugonarizine, nusinersen, tofersen, tadnersen, eteplirsen, inotersen, morphine, baclofen, methotrexate, hydrocortisone, cytarabine (Ara-C), cytotoxic agents, local anesthetics, clonidine, ziconotide, bupivacaine, fentanyl, sufentanil, morphine sulfate, hydromorphone, triamcinolone, or busulfan. In a preferred embodiment, the therapeutic agent is rugonarizine as defined herein.
[0068] In one embodiment, the therapeutic agent is an antisense oligonucleotide targeting the UBE3A repressor. In another embodiment, the therapeutic agent is an antisense oligonucleotide targeting the SNHG14 long non-coding RNA transcript downstream of SNORD109B. Such antisense oligonucleotides are described in WO2017 / 081223A1, which is incorporated herein by reference in its entirety. In another embodiment, the therapeutic agent is an antisense oligonucleotide comprising a continuous nucleotide sequence of 10 to 30 nucleotides having at least 98% complementarity to positions 25278410 to 25419462 on human chromosome 15.
[0069] In an embodiment, the therapeutic agent is an antisense oligonucleotide comprising the sequence listed in SEQ ID NO: 1 (TTACACTTAATTATACTTCC). In an embodiment, the therapeutic agent is an antisense oligonucleotide having the sequence consisting of SEQ ID NO: 1 (TTACACTTAATTATACTTCC). In an embodiment, the therapeutic agent is an antisense oligonucleotide, wherein the oligonucleotide is the oligonucleotide compound TTACActtaattatactTCC (CMP ID NO: 1), where uppercase letters represent β-D-oxyLNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleotide bonds are phosphate thioester internucleotide bonds.
[0070] In alternative embodiments, the therapeutic agent is an antisense oligonucleotide comprising the sequence listed in SEQ ID NO: 2 (AATTATTTATACACCATCAT). In embodiments, the therapeutic agent is an antisense oligonucleotide having the sequence consisting of SEQ ID NO: 2 (AATTATTTATACACCATCAT). In embodiments, the therapeutic agent is an antisense oligonucleotide, wherein the oligonucleotide is the oligonucleotide compound AATTaTttatacacCATcAT (CMP ID NO: 2), where uppercase letters represent β-D-oxyLNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleotide bonds are phosphate thioester internucleotide bonds.
[0071] As used herein, the term "oligonucleotide" is known in the art and generally refers to a molecule comprising two or more covalently linked nucleosides. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in the laboratory by solid-phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, the meaning refers to the sequence or order of the nucleobase portion of the covalently linked nucleotide or nucleoside or its modifications. The oligonucleotides of the present invention are artificial and chemically synthesized, and are generally purified or isolated. The oligonucleotides of the present invention may comprise one or more modified nucleosides or nucleotides.
[0072] As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of regulating the expression of a target gene by hybridization with a target nucleic acid, particularly with a sequential sequence on the target nucleic acid. Antisense oligonucleotides are not substantially double-stranded and therefore are not siRNAs. Preferably, the antisense oligonucleotides of the present invention are single-stranded.
[0073] The term "continuous nucleotide sequence" refers to an oligonucleotide region complementary to a target nucleic acid. This term is used interchangeably herein with the terms "continuous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleotides of the oligonucleotide are present in the continuous nucleotide sequence. In some embodiments, the oligonucleotide comprises a continuous nucleotide sequence and may optionally include other nucleotides, such as nucleotide linker regions that can be used to attach functional groups to the continuous nucleotide sequence. The nucleotide linker regions may be complementary to or not complementary to the target nucleic acid.
[0074] The term complementarity describes the ability of nucleosides / nucleotides to pair with Watson-Crick bases. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It should be understood that oligonucleotides may contain nucleosides with modified nucleosides, for example, 5-methylcytosine is often used instead of cytosine; therefore, the term complementarity covers Watson-Crick base pairing between unmodified and modified nucleosides (see, for example, Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Supplement 371.4.1).
[0075] As used herein, the term "% complementarity" refers to the percentage of consecutive nucleotides in a nucleic acid molecule (e.g., an oligonucleotide) that are complementary (i.e., form Watson-Crick base pairs) to a consecutive nucleotide sequence at a given position in a different nucleic acid molecule (e.g., a target nucleic acid). The percentage is calculated by counting the number of aligned base pairs between the two sequences, dividing by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such comparisons, misaligned (base-pairing) nucleobases / nucleotides are referred to as mismatches.
[0076] Nucleotides are structural units of oligonucleotides and polynucleotides, and for the purposes of this invention, include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides, comprise a ribose moiety, a nucleobase moiety, and one or more phosphate ester groups (which are not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers".
[0077] LNA nucleotides are modified nucleotides that contain a linker group (called a bibase or bridge) between the C2' and C4' of the ribose ring of the nucleotide. These nucleotides are also referred to in the literature as bridging nucleic acids or bicyclic nucleic acids (BNA). β-D-oxy-LNA nucleotides have the following structure:
[0078]
[0079] Phosphophosphate internucleotide bonds are particularly useful due to nuclease resistance, beneficial pharmacokinetics, and ease of manufacture. In preferred embodiments, at least 50% of the internucleotide bonds in the oligonucleotide or its continuous nucleotide sequence are phosphate thioesters, such as at least 60%, at least 70%, at least 80%, or at least 90% of the internucleotide bonds in the oligonucleotide or its continuous nucleotide sequence are phosphate thioesters. In some embodiments, all internucleotide bonds in the oligonucleotide or its continuous nucleotide sequence are phosphate thioesters.
[0080] In embodiments, the therapeutic agent used in this invention is contained in a pharmaceutical composition comprising the therapeutic agent (preferably an antisense oligonucleotide) and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. Pharmaceutically acceptable diluents include phosphate-buffered saline (PBS), while pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0081] WO 2007 / 031091 (incorporated herein by reference) provides suitable and preferred examples of pharmaceutically acceptable diluents, carriers and excipients. Suitable dosages, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in WO 2007 / 031091.
[0082] The therapeutic agents used in this invention can be mixed with pharmaceutically acceptable active or inert substances to prepare pharmaceutical compositions or formulations. The composition and formulation of the pharmaceutical composition depend on many criteria, including but not limited to route of administration, disease severity, or dosage. In this regard, it is evident that the most preferred pharmaceutical compositions are suitable for intrathecal administration.
[0083] In some embodiments, the oligonucleotide or oligonucleotide conjugate of the present invention is a prodrug. In particular, for the oligonucleotide conjugate, once the prodrug is delivered to the site of action, such as a target cell (e.g., a target brain cell), the conjugate portion is cleaved from the oligonucleotide.
[0084] Therapeutic uses
[0085] In another aspect, the present invention provides a therapeutic agent for use in a method of treating a subject, wherein the subject has previously been administered a previous intrathecal dose of the therapeutic agent, the total amount of the previous intrathecal dose of the therapeutic agent in the subject has been determined, and the total amount of the therapeutic agent in the subject has been determined to be above, equal to, within, or below a predetermined value or range, wherein the method includes administering an additional intrathecal dose of the therapeutic agent.
[0086] In another aspect, the present invention provides a method of treating a subject with a therapeutic agent, wherein the subject has previously been administered a previous intrathecal dose of the therapeutic agent, the total amount of the previous intrathecal dose of the therapeutic agent in the subject has been determined, and the total amount of the therapeutic agent in the subject has been determined to be above, equal to, within, or below a predetermined value or range, wherein the method includes administering an additional intrathecal dose of the therapeutic agent.
[0087] In another aspect, the present invention provides the use of a therapeutic agent in the manufacture of a medicament for treating a subject, wherein the subject has previously been administered a previous intrathecal dose of the therapeutic agent, the total amount of the previous intrathecal dose of the therapeutic agent in the subject has been determined, and the total amount of the therapeutic agent in the subject has been determined to be above, equal to, within, or below a predetermined value or range, wherein the method includes administering an additional intrathecal dose of the therapeutic agent.
[0088] In embodiments, any treatment of the present invention may further include:
[0089] i) If the total systemic dose of the therapeutic agent is higher than the predetermined value or range, administer an additional intrathecal dose of the therapeutic agent that is greater than the previous intrathecal dose; or
[0090] ii) If the total dose of the therapeutic agent is equal to or within a predetermined value or range, then administer an additional intrathecal dose of the therapeutic agent that is the same as the previous intrathecal dose; or
[0091] iii) If the total dose of the therapeutic agent is below the predetermined value or range, administer a lower intrathecal dose of the therapeutic agent or an additional intrathecal dose of the same type.
[0092] In embodiments, any treatment of the present invention may first include administering a prior intrathecal dose to the subject. In embodiments, an additional intrathecal dose to be administered is determined by comparing the total amount of the therapeutic agent in the subject with a predetermined value or range. In embodiments, the magnitude of the additional intrathecal dose to be administered is determined by comparing the total amount of the therapeutic agent in the subject with a predetermined value or range.
[0093] In embodiments, any treatment of the present invention may involve treating a patient subgroup with an additional intrathecal dose of the therapeutic agent, wherein the patient subgroup is defined as a patient who has received a previous intrathecal dose of the therapeutic agent and has been determined to have a systemic dose of the therapeutic agent that is within or below a predetermined value or range. In embodiments, the method includes measuring the systemic dose of the therapeutic agent. In embodiments, the predetermined value or range corresponds to the value or range of a responder control subject or a non-responder control group to the therapeutic agent. In embodiments, "responder" means a control subject / group that has been / has been administered an intrathecal dose of the therapeutic agent with the desired therapeutic effect. In embodiments, the responder control subject / group has been administered the same intrathecal dose of the therapeutic agent as the subject to whom the present invention was administered.
[0094] In embodiments, any treatment of the present invention may include or consist of the following:
[0095] a) The previous intrathecal dose of the therapeutic agent administered to the subject;
[0096] b) Measure the total amount of the therapeutic agent in the subject, preferably the maximum total concentration of the therapeutic agent in the subject;
[0097] c) Compare the total dose of the therapeutic agent in the subject to a predetermined value or range;
[0098] d) Determine that the total dose of the therapeutic agent in the subject is below or within a predetermined value or range; and
[0099] e) Administer an additional intrathecal dose to the subject.
[0100] In embodiments, any treatment of the present invention may include or consist of the following:
[0101] a) The previous intrathecal dose of the therapeutic agent administered to the subject;
[0102] b) Measure the total amount of the therapeutic agent in the subject, preferably the maximum total concentration of the therapeutic agent in the subject;
[0103] c) Compare the total dose of the therapeutic agent in the subject to a predetermined value or range;
[0104] d) Determine that the total dose of the therapeutic agent in the subject is below or within a predetermined value or range; and
[0105] e) Administer an additional intrathecal dose to the subject that is greater than the previous intrathecal dose.
[0106] In embodiments, any treatment of the present invention may include or consist of the following:
[0107] a) The previous intrathecal dose of the therapeutic agent administered to the subject;
[0108] b) Measure the total amount of the therapeutic agent in the subject, preferably the maximum total concentration of the therapeutic agent in the subject;
[0109] c) Compare the total dose of the therapeutic agent in the subject to a predetermined value or range;
[0110] d) Determine that the total dose of the therapeutic agent in the subject is greater than a predetermined value or range; and
[0111] e) Administer a smaller intrathecal dose or the same additional intrathecal dose to the subject.
[0112] As used herein, the term "treatment" refers to the treatment of an existing disease (such as the disease or ailment referred to herein), or the prevention of a disease. Therefore, it will be appreciated that in some embodiments, the treatment referred to herein may be preventative.
[0113] In a preferred embodiment, the disease is Angelman syndrome. In this embodiment, the invention relates to the treatment or prevention of Angelman syndrome. In a preferred embodiment, the subject of the method of the invention is an individual who has or is susceptible to Angelman syndrome. In particularly preferred embodiments of these types, the therapeutic agent is an antisense oligonucleotide, preferably rugnazose or an antisense oligonucleotide defined as SEQ ID NO: 1, CMP ID NO: 1, SEQ ID NO: 2, or CMP ID NO: 2.
[0114] Numbered paragraphs
[0115] The invention will now be further described through the following numbered paragraphs:
[0116] 1. A method for determining the intrathecal uptake of a therapeutic agent by the brain of a subject who has been administered an intrathecal dose of that therapeutic agent, the method comprising:
[0117] a) Determine the total dose of the treatment agent in the subject; and
[0118] b) Use the whole-body dose of the therapeutic agent to determine the intrathecal uptake of the therapeutic agent by the subject's brain.
[0119] 2. The method described in paragraph 1, wherein there is a negative correlation between the total dose and the intrathecal dose of the therapeutic agent to the brain uptake of the subject.
[0120] 3. A method for determining the likelihood that an intrathecal dose of a therapeutic agent has a therapeutic effect on the brain of a subject who has been administered an intrathecal dose of the therapeutic agent, the method comprising:
[0121] a) Determine the total dose of the treatment agent in the subject; and
[0122] b) Use the total body dose of the therapeutic agent in the subject to determine the likelihood that an intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain.
[0123] 4. The method described in paragraph 3, wherein there is a negative correlation between the total dose and the likelihood that the intrathecal dose of the therapeutic agent will have a therapeutic effect on the subject's brain.
[0124] 5. The method according to paragraph 3 or 4, wherein the method further comprises:
[0125] i) If the total body dose of the therapeutic agent in the subject is less than, the same as, or within a predetermined value or range, then c) determine that the intrathecal dose of the therapeutic agent may have a therapeutic effect; or
[0126] ii) If the total dose of the therapeutic agent in the subject is greater than the predetermined value or range, then c) determine that the intrathecal dose of the therapeutic agent is unlikely to have a therapeutic effect.
[0127] 6. A method for determining an additional intrathecal dose of a therapeutic agent to be administered to a subject in a subject who has previously been given an intrathecal dose of the therapeutic agent, the method comprising:
[0128] a) Determine the systemic dose of the therapeutic agent in the subject following administration of the previous intrathecal dose; and
[0129] b) Use the total dose of the therapeutic agent in the subject to determine an additional intrathecal dose of the therapeutic agent to be administered to the subject.
[0130] 7. The method described in paragraph 6, wherein there is a negative correlation between the total dose and the additional dose of the therapeutic agent to be administered to the subject.
[0131] 8. The method according to paragraph 6 or 7, wherein the method includes determining an additional intrathecal dose predicted to have a therapeutic effect on the subject's brain.
[0132] 9. The method according to any one of paragraphs 6 to 8, wherein the method includes determining an additional intrathecal dose that is predicted to have an increased therapeutic effect on the brain of the subject relative to a previous intrathecal dose.
[0133] 10. The method according to any one of paragraphs 6 to 9, wherein the method further comprises:
[0134] i) If the total systemic dose of the therapeutic agent in the subject is less than a predetermined value or range, or is equal to or within a predetermined value or range, then an additional intrathecal dose of the therapeutic agent will be administered to the subject; or
[0135] ii) If the total dose of the therapeutic agent in the subject is greater than the predetermined value or range, then determine that an additional intrathecal dose of the therapeutic agent will not be administered to the subject.
[0136] 11. The method according to any one of paragraphs 6 to 9, wherein the method further comprises:
[0137] i) If the total systemic dose of the therapeutic agent in the subject is less than a predetermined value or range, determine that an additional intrathecal dose of the therapeutic agent is less than or the same as the previous intrathecal dose of the therapeutic agent administered to the subject; or
[0138] ii) If the total dose of the therapeutic agent in the subject is the same as or within a predetermined value or range, then determine that the additional intrathecal dose of the therapeutic agent is the same as the previous intrathecal dose of the therapeutic agent administered to the subject; or
[0139] iii) If the total dose of the therapeutic agent in the subject is greater than a predetermined value or range, determine that an additional intrathecal dose of the therapeutic agent is greater than the previous intrathecal dose of the therapeutic agent administered to the subject.
[0140] 12. The method according to any one of paragraphs 1 to 11, wherein step a) includes measuring the amount of therapeutic agent in an in vitro sample obtained from the subject.
[0141] 13. The method according to any one of paragraphs 1 to 12, wherein step a) includes measuring the concentration of the therapeutic agent in the blood or plasma of the subject.
[0142] 14. The method according to any one of paragraphs 1 to 13, wherein the therapeutic agent is an oligonucleotide or a small molecule, preferably wherein the therapeutic agent is an antisense oligonucleotide.
[0143] 15. The method according to any one of paragraphs 1 to 14, wherein the therapeutic agent is an antisense oligonucleotide that induces the expression of UBE3A.
[0144] 16. The method according to any one of paragraphs 1 to 15, wherein the therapeutic agent is an antisense oligonucleotide comprising a continuous nucleotide sequence of 10 to 30 nucleotides having at least 98% complementarity with positions 25278410 to 25419462 on human chromosome 15.
[0145] 17. The method according to any one of paragraphs 1 to 16, wherein the therapeutic agent is an antisense oligonucleotide, wherein the oligonucleotide is an oligonucleotide compound TTAcActtaattatactTCC (CMP ID NO: 1), wherein uppercase letters represent β-D-oxyLNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleotide bonds are phosphate thioester internucleotide bonds.
[0146] 18. The method according to any one of paragraphs 1 to 17, wherein the predetermined value is the same as, equivalent to, or derived from the total amount of the therapeutic agent present in the control group / subject, wherein the control group / subject has therapeutically effective brain uptake of the therapeutic agent.
[0147] 19. A therapeutic agent for use in a method of treating a subject, wherein the subject has previously been administered a prior intrathecal dose of the therapeutic agent, a total amount of the prior intrathecal dose of the therapeutic agent in the subject has been determined, and a total amount of the therapeutic agent in the subject that is above, equal to, within, or below a predetermined value or range has been determined, wherein the method includes administering an additional intrathecal dose of the therapeutic agent.
[0148] 20. The therapeutic agent used according to paragraph 19, wherein the method further comprises:
[0149] i) If the total systemic dose of the therapeutic agent is higher than the predetermined value or range, administer an additional intrathecal dose of the therapeutic agent that is greater than the previous intrathecal dose; or
[0150] ii) If the total dose of the therapeutic agent is equal to or within a predetermined value or range, then administer an additional intrathecal dose of the therapeutic agent that is the same as the previous intrathecal dose; or
[0151] iii) If the total dose of the therapeutic agent is below the predetermined value or range, administer a lower intrathecal dose of the therapeutic agent or an additional intrathecal dose of the same type.
[0152] 21. A method of treating a subject with a therapeutic agent, wherein the subject has previously been administered a previous intrathecal dose of the therapeutic agent, the total amount of the previous intrathecal dose of the therapeutic agent in the subject has been determined, and the total amount of the therapeutic agent in the subject has been determined to be above, equal to, within, or below a predetermined value or range, wherein the method includes administering an additional intrathecal dose of the therapeutic agent.
[0153] 22. The method according to paragraph 21, wherein the method further comprises:
[0154] i) If the total systemic dose of the therapeutic agent is higher than the predetermined value or range, administer an additional intrathecal dose of the therapeutic agent that is greater than the previous intrathecal dose; or
[0155] ii) If the total dose of the therapeutic agent is equal to or within a predetermined value or range, then administer an additional intrathecal dose of the therapeutic agent that is the same as the previous intrathecal dose; or
[0156] iii) If the total dose of the therapeutic agent is below the predetermined value or range, administer a lower intrathecal dose of the therapeutic agent or an additional intrathecal dose of the same type.
[0157] The invention will now be further described by way of examples intended to help those skilled in the art to implement the invention, and not intended to limit the scope of the invention in any way.
[0158] Example
[0159] 10 mg of rugonasal and radiolabeled [agent] were administered to healthy male participants via intrathecal administration with varying flush volumes. 89 A mixture of Zr]DFO and rugnazine. The fraction of rugnazine administered to the brain (sum of gray matter, white matter, and brain CSF, %ID) was quantified by PET / CT. Simultaneously, blood samples were collected at different time points to determine rugnazine plasma concentrations.
[0160] In order to quantify the [ 89 The Zr]DFO-Rugona-generated quantity co-registered PET images with MRI scans to define the volume of interest (VOI). As part of normalization, the MRI images were divided into six parts: gray matter (GM), white matter (WM), CSF, non-brain soft tissue, skin and skull, and remaining tissue. Delivery to the head was calculated as the sum of GM, WM, and brain CSF.
[0161] The concentration of rugonarizine was measured using a specific and validated hELISA method. The limit of quantification for rugonarizine is <0.049 nmol / L. Concentrations of rugonarizine measured from both venous and capillary plasma samples were determined to be comparable. The protocol used for each measurement was as follows:
[0162] Venous plasma: Following administration of 10 mg [89Zr]DFO-rugnarsen at the time of first dosing (IT), rugnarsen concentrations were first detected in venous plasma in 22 participants at 1 hour post-dosing (the time point for blood collection after the first dose) and in 2 participants at 2 hours post-dosing, and remained quantifiable in all 24 participants until 24 hours post-dosing. Individual maximum rugnarsen plasma concentrations ranged from 1.20 nmol / L to 7.90 nmol / L and were observed from 3 to 24 hours post-dosing.
[0163] Capillary plasma: Following administration of 10 mg [89Zr]DFO-rugnarsen at the time of administration (IT), rugnarsen concentrations were first detected in capillary plasma in 24 participants at 2 hours post-administration (the time point for blood collection after the first dose) and remained quantifiable in all 24 participants until 24 hours post-administration. Individual maximum rugnarsen plasma concentrations ranged from 0.991 nmol / L to 7.14 nmol / L and were observed from 2 to 24 hours post-administration.
[0164] Throughout the study, all IT procedures were [ 89 Similar kinetics were observed in the brain uptake of ZrDFO-Rugonasin. Low uptake rates were observed in the brain on day 1, with the highest uptake rate observed on day 2. Uptake values remained constant from day 5 until the last measurement on day 12. Brain uptake showed a large variation from 5% to 46%.
[0165] For each individual participant, the highest plasma concentration (Cmax) reached was determined. Figure 1 shows the individual plasma Cmax observed on day 5. max Concentration (nmol / L) as a percentage of the sum of total concentrations in the head (GM, WM, and brain CSF) as %ID. Surprisingly, rugnazine administration showed elevated plasma C levels after rugnazine administration. max Individuals consistently showed lower brain delivery as assessed by PET imaging. This negative correlation was observed independently of the IT administration procedure and in each of the procedures A, B, C, and D in Figure 1 (A = 5 mL CSF and 5 mL flush, no movement; B = 0.5 mL CSF and 0.5 mL flush, no movement; C = 15 mL CSF and 15 mL flush, no movement; D = 0.5 mL CSF and 0.5 mL flush, movement).
[0166] Therefore, the inventors have determined that, following an intrathecal dose of a therapeutic agent, the brain uptake and delivery of the intrathecal dose of the therapeutic agent within a subject can be determined to be negatively correlated with the total amount of the therapeutic agent present in the subject. Thus, determining the total amount of the therapeutic agent in a subject after a previous intrathecal dose can be used to determine the likelihood of brain uptake and effectiveness of the therapeutic agent, as well as subsequent dosages. These findings are not intended to be limited to Rugnersen, and it should be understood that those skilled in the art can make appropriate adjustments to make similar determinations for other intrathecal doses of suitable therapeutic agents in the same manner.
[0167] The disclosure illustrated herein may be practiced without any one or more elements, limitations, or restrictions not specifically disclosed herein. As used herein, the term “comprising / comprises / comprised of” is synonymous with “including / includes” or “containing / contains” and is inclusive or open-ended, and does not exclude additional, unreferenced members, elements, or method steps. The term “comprising” also includes the term “consisting of.” The terms and expressions used are used as descriptive rather than restrictive terms, and in using such terms and expressions, no equivalent of any features or portions thereof shown and described is intended to be excluded; however, it should be recognized that various modifications are possible within the scope of the claimed invention. Therefore, it should be understood that while the invention has been specifically disclosed by way of preferred embodiments and optional features, modifications and variations of the concepts disclosed herein can be made by those skilled in the art, and such modifications and variations are considered to be within the scope of the invention as defined in the specification and appended claims.
[0168] In the context of describing the invention (especially in the context of the following claims), the terms “a” and “the” and similar designations should be interpreted as encompassing both singular and plural forms, unless otherwise indicated herein or clearly contradicted by the context. Unless otherwise stated, the terms “comprising,” “having,” “including,” and “containing” should be interpreted as open-ended terms (i.e., meaning “including but not limited to”). Unless otherwise indicated herein, the recitation of numerical ranges herein is intended only as a way of abbreviating each individual value falling within that range, and each individual value is incorporated into the specification as if it were separately recited herein. Unless otherwise indicated herein or clearly contradicted by the context, all methods described herein can be performed in any suitable order. Unless otherwise claimed, the use of any and all instances or exemplary language (e.g., “such as”) provided herein is intended only to better illustrate the invention and does not constitute a limitation on the scope of the invention. No language in the specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.
[0169] This document describes embodiments of the invention, including the best mode known to the inventors for carrying out the invention. Variations in these embodiments may become apparent to those skilled in the art upon reading the foregoing description.
[0170] According to the present invention, all embodiments of the oligonucleotides used in the method are also considered as methods of treatment and / or methods of manufacturing pharmaceuticals.
[0171] The inventors intend that those skilled in the art will appropriately employ such variations, and the inventors intend to practice the invention in ways different from those specifically described herein. Therefore, the invention includes all modifications and equivalents of the subject matter described in the appended claims as permitted by applicable law. Furthermore, unless otherwise stated herein or otherwise clearly contradicted by the context, any combination of the foregoing elements in all possible variations is covered by the invention. Those skilled in the art will recognize or be able to identify many equivalents of the specific embodiments of the invention described herein using only conventional experimentation. Such equivalents are intended to be covered by the following claims.
Claims
1. A method for determining the uptake of an intrathecal dose of a therapeutic agent by the brain of a subject who has been administered an intrathecal dose, the method comprising: a) Determine the systemic dose of the therapeutic agent in the subject; as well as b) Using the whole-body dose of the therapeutic agent, determine the brain uptake of the subject by the intrathecal dose of the therapeutic agent.
2. The method of claim 1, wherein there is a negative correlation between the total dose and the uptake of the intrathecal dose of the therapeutic agent by the subject's brain.
3. A method for determining the likelihood that an intrathecal dose of a therapeutic agent has a therapeutic effect on the brain of a subject who has been administered the intrathecal dose of the therapeutic agent, the method comprising: a) Determine the systemic dose of the therapeutic agent in the subject; as well as b) Using the total body dose of the therapeutic agent in the subject to determine the likelihood that the intrathecal dose of the therapeutic agent has a therapeutic effect on the brain of the subject.
4. The method of claim 3, wherein there is a negative correlation between the total dose and the likelihood that the intrathecal dose of the therapeutic agent has a therapeutic effect on the brain of the subject.
5. The method according to claim 3 or 4, wherein the method further comprises: i) If the systemic dose of the therapeutic agent in the subject is less than, the same as, or within a predetermined value or range, then c) it is determined that the intrathecal dose of the therapeutic agent may have a therapeutic effect; or ii) If the total dose of the therapeutic agent in the subject is greater than a predetermined value or range, then c) it is determined that the intrathecal dose of the therapeutic agent is unlikely to have a therapeutic effect.
6. A method for determining an additional intrathecal dose of the therapeutic agent to be administered to a subject who has previously been given an intrathecal dose of the therapeutic agent, the method comprising: a) Determine the systemic dose of the therapeutic agent in the subject after administration of the prior intrathecal dose; as well as b) Use the total amount of the therapeutic agent in the subject to determine an additional intrathecal dose of the therapeutic agent to be administered to the subject.
7. The method of claim 6, wherein the total dose is negatively correlated with an additional dose of the therapeutic agent to be administered to the subject.
8. The method of claim 6 or 7, wherein the method comprises determining an additional intrathecal dose predicted to have a therapeutic effect on the brain of the subject, optionally wherein the method comprises determining an additional intrathecal dose predicted to have an increased therapeutic effect on the brain of the subject relative to the previous intrathecal dose.
9. The method according to any one of claims 6 to 8, wherein the method further comprises: i) If the total body dose of the therapeutic agent in the subject is less than a predetermined value or range, or is equal to or within a predetermined value or range, then determine that an additional intrathecal dose of the therapeutic agent will be administered to the subject; or ii) If the total dose of the therapeutic agent in the subject is greater than a predetermined value or range, then it is determined that an additional intrathecal dose of the therapeutic agent will not be administered to the subject.
10. The method according to any one of claims 6 to 8, wherein the method further comprises: i) If the systemic dose of the therapeutic agent in the subject is less than a predetermined value or range, then determine that the additional intrathecal dose of the therapeutic agent is less than or the same as the previous intrathecal dose of the therapeutic agent administered to the subject; or ii) If the total systemic dose of the therapeutic agent in the subject is the same as or within a predetermined value or range, then determine that the additional intrathecal dose of the therapeutic agent is the same as the previous intrathecal dose of the therapeutic agent administered to the subject; or iii) If the total dose of the therapeutic agent in the subject is greater than a predetermined value or range, then the additional intrathecal dose of the therapeutic agent is determined to be greater than the previous intrathecal dose of the therapeutic agent administered to the subject.
11. The method according to any one of claims 1 to 10, wherein step a) comprises measuring the amount of the therapeutic agent in an in vitro sample obtained from the subject, optionally wherein step a) comprises measuring the concentration of the therapeutic agent in the blood or plasma of the subject.
12. The method according to any one of claims 1 to 11, wherein the therapeutic agent is an oligonucleotide or a small molecule, preferably wherein the therapeutic agent is an antisense oligonucleotide, optionally wherein the therapeutic agent is an antisense oligonucleotide that induces the expression of UBE3A, optionally wherein the therapeutic agent is an antisense oligonucleotide comprising a continuous nucleotide sequence of 10 to 30 nucleotides having at least 98% complementarity with positions 25278410 to 25419462 on human chromosome 15, optionally wherein the therapeutic agent is an antisense oligonucleotide, wherein the oligonucleotide is an oligonucleotide compound TTACActtaattatactTCC (CMP ID NO: 1), wherein uppercase letters represent β-D-oxyLNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleotide bonds are phosphate thioester internucleotide bonds.
13. The method according to any one of claims 1 to 12, wherein the predetermined value is the same as, equivalent to, or derived from the total amount of the therapeutic agent present in the control group / subject, wherein the control group / subject has therapeutically effective brain uptake of the therapeutic agent.
14. A therapeutic agent for use in a method of treating a subject, wherein the subject has previously been administered a previous intrathecal dose of the therapeutic agent, a systemic dose of the previous intrathecal dose of the therapeutic agent in the subject has been determined, and the subject has been determined to have a systemic dose of the therapeutic agent that is above, equal to, within, or below a predetermined value or range, wherein the method includes administering an additional intrathecal dose of the therapeutic agent.
15. The therapeutic agent according to claim 14, wherein the method further comprises: i) If the total dose of the therapeutic agent is higher than the predetermined value or range, then administer an additional intrathecal dose of the therapeutic agent that is greater than the previous intrathecal dose; or ii) If the total systemic dose of the therapeutic agent is equal to or within the predetermined value or range, then administer an additional intrathecal dose of the therapeutic agent that is the same as the previous intrathecal dose; or iii) If the total dose of the therapeutic agent is below the predetermined value or range, then administer a dose of the therapeutic agent that is lower than the previous intrathecal dose or an additional intrathecal dose that is the same as it.
Citation Information
Patent Citations
RNA antagonist compounds for the modulation of p21 ras expression
WO2007031091A2
Oligonucleotides for inducing paternal UBE3a expression
WO2017081223A1