Application of a molecular marker related to body height trait of sheep in extremely cold area
By applying molecular markers with the base sequence SEQ ID NO.1, especially the genotype identification and breeding selection at the 101 bp site, in sheep in extremely cold regions, the problem of low efficiency in traditional phenotypic selection has been solved, enabling early and accurate prediction of the high body height trait in grassland short-tailed sheep and efficient breeding.
Patent Information
- Application Number
- CN202610882544.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-18
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2046-06-18
AI Technical Summary
In existing technologies, the breeding of the height trait in grassland short-tailed sheep relies on traditional phenotypic selection, which is easily affected by environmental factors, has a long selection cycle, low efficiency, and is difficult to meet the needs of modern high-efficiency breeding. There is also a lack of molecular markers for early and accurate prediction of the height trait in sheep in extremely cold regions.
A molecular marker associated with body height in sheep in extremely cold regions is provided. The base sequence is shown in SEQ ID NO.1, with the base at the 101 bp site being either A or G. Body height can be identified or improved by identifying or selecting the genotype at this site. The specific method includes extracting genomic DNA for sequencing and breeding selection.
By detecting the genotype of this SNP locus, the average height of the offspring population can be significantly improved, the breeding cycle can be shortened, the breeding efficiency can be increased, and the early and accurate prediction of the height trait and efficient breeding can be achieved.
Smart Images

Figure CN122405847B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of livestock molecular genetics and breeding technology, specifically providing the application of a molecular marker related to the body height trait of sheep in extremely cold regions. Background Technology
[0002] The steppe short-tailed sheep is a superior meat sheep breed unique to extremely cold regions. It possesses adaptability advantages such as cold resistance, tolerance to roughage, and a short tail, making it valuable in regional livestock development. Body height, as a key economic trait for measuring growth and development and body structure, is one of the core objectives of genetic improvement.
[0003] Currently, breeding for the height trait in this breed still mainly relies on traditional phenotypic selection, which is easily affected by environmental factors, and has a long selection cycle and low efficiency, making it difficult to meet the needs of modern high-efficiency breeding. Although there have been some molecular marker studies on sheep body size traits, there is still a lack of functional SNP markers that are validated on a large scale and significantly associated with body height for the specific genetic background of grassland short-tailed sheep.
[0004] Therefore, there is an urgent need to develop a molecular marker suitable for sheep in extremely cold regions that can accurately predict body height traits at an early stage, in order to support the construction of an efficient and targeted molecular-assisted breeding system. Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides an application of molecular markers related to body height traits in sheep from extremely cold regions.
[0006] This invention is achieved through the following technical solution: Application of a molecular marker associated with body height trait in sheep in extremely cold regions, wherein the base sequence of the molecular marker is shown in SEQ ID NO.1, and the base at the 101 bp position is A or G.
[0007] The application refers to any one of the following (1) and (2): (1) Identification of the body height of sheep in extremely cold regions: The body height of sheep with base A at the 101bp site of SEQ ID NO.1 is greater than that of sheep with base G.
[0008] (2) Increase the height of offspring of sheep in extremely cold regions: Select individuals with base A at the 101bp site of SEQ ID NO.1 as parents for breeding to increase the height of offspring of sheep in extremely cold regions.
[0009] Preferably, the method for determining the height of sheep in extremely cold regions is as follows: Genomic DNA was extracted from sheep in extremely cold regions and sequenced.
[0010] The genotype of sheep in this extremely cold region at the 101bp site of SEQ ID NO.1 was determined.
[0011] If the genotype is AA, the sheep in this extremely cold region are generally tall; their height is greater than that of individuals with the genotype AG or GG.
[0012] Preferably, the method for increasing the body height of offspring sheep in extremely cold regions is as follows: Genomic DNA was extracted from sheep in extremely cold regions and sequenced.
[0013] The genotype of sheep in this extremely cold region at the 101bp site of SEQ ID NO.1 was determined.
[0014] Sheep individuals carrying the AA genotype from extremely cold regions were selected as parents for breeding to improve the body height of offspring from these regions.
[0015] Preferably, the genomic DNA is derived from the blood of sheep from extremely cold regions.
[0016] Preferably, the sequencing method is high-throughput sequencing.
[0017] Preferably, the genomic DNA is extracted using the magnetic bead method.
[0018] Preferably, the sheep from the extremely cold region is the steppe short-tailed sheep.
[0019] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of a molecular marker associated with the body height trait of sheep in extremely cold regions. The base sequence of the molecular marker is shown in SEQ ID NO.1, and the base at the 101 bp position is A or G. The application refers to any one of the following (1) and (2): (1) Identifying the height of sheep in extremely cold regions: the height of sheep with base A at the 101bp site of SEQ ID NO.1 is greater than the height of sheep with base G; (2) Improving the height of sheep offspring in extremely cold regions: Individuals with base A at the 101bp site of SEQ ID NO.1 were selected as parents for breeding to improve the height of sheep offspring in extremely cold regions. The molecular marker is located on sheep chromosome 15, reference genome Oar_v4.0, with a physical location of chr15_66036339. Genome-wide association analysis and multi-model cross-validation showed that this locus and the height trait reached genomic significance in multiple statistical models (P < 1 × 10⁻⁶). -6 .
[0020] Functional validation showed that individuals carrying the AA genotype had a significantly higher average body height than individuals carrying the AG and GG genotypes. PA value <0.05 indicates that the A allele is a favorable allele. By detecting the genotype of this SNP locus, homozygous AA individuals can be preferentially selected as breeding parents, which can effectively improve the average height of the offspring population, shorten the breeding cycle, and increase breeding efficiency. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0022] Figure 1 This is a distribution diagram of the SNPs after quality control in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.
[0023] Figure 2 This is a visualization of the genomic kinship matrix, or G matrix, of sheep populations in extremely cold regions according to the present invention.
[0024] Figure 3 Manhattan plot for genome-wide association analysis of body height trait in sheep in extremely cold regions in this invention; Figure 3 In the diagram, A represents the analysis results of the fastGWA-mlm model; B represents the analysis results of the FarmCPU model; and C represents the analysis results of the Fast3VmrMLM model. Red dots indicate SNP sites that have reached genomic significance. Detailed Implementation
[0025] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0026] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in its specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0027] The technical solution of the present invention will be further described below with reference to specific embodiments.
[0028] Manhattan Plot.
[0029] SNP: Single nucleotide polymorphism.
[0030] GWAS: Genome-wide association analysis.
[0031] Example 1 1. Experimental animals and phenotypic sources: The subject of this invention is 300 adult grassland short-tailed sheep from the Aiyiti Sheep Breeding Farm in Inner Mongolia Autonomous Region. The height of each sheep was measured using a measuring stick. Detailed phenotypic records are shown in Table 1.
[0032] Table 1. Description of body height traits in grassland short-tailed sheep
[0033] 2. Genomic DNA extraction and quality control Blood samples were collected, and genomic DNA was extracted from the blood samples using the magnetic bead method. The concentration of DNA, the ratio of the absorption wavelengths of the highest absorption peaks of nucleic acids, proteins, and phenolic substances (260 nm / 280 nm), and the ratio of the absorption wavelengths of the highest absorption peaks of carbohydrates (260 nm / 230 nm) were detected using a NanoDrop2000 spectrophotometer. The DNA quality was assessed by 1% w / v agarose gel electrophoresis.
[0034] 3. Library construction and sequencing The quality-tested DNA was randomly fragmented into approximately 350 bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly A addition, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation process. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality testing, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.
[0035] 4. Identification, screening, and annotation of variant sites Raw sequencing data was quality-controlled using FASTP software to obtain Clean reads. A genome index was built on the reference genome. The quality-controlled Clean reads were aligned with the sheep reference genome Oar_v4.0, GCF_000298735.2 using Burrows-Wheeler Aligner software version 0.7.17. The aligned SAM files were converted to BAM files and sorted using SAMtools software version 1.8-20. Duplicates were removed from the sorted BAM files using the MarkDuplicates program in Genome Analysis Toolkit version 3.8. An index was built on the final BAM file. SNP variant detection was performed using the HaplotypeCaller module in GATK software, and the resulting VCF file was filtered using the VariantFiltration module. Functional annotation of the detected gene variants was performed using the ANNOVAR software package.
[0036] 5. Group stratification correction Whole-genome resequencing was performed on 300 sheep individuals from extremely cold regions, generating a total of 15768.1 Gb of raw reads and identifying 56,632,165 SNPs. The genotyping data were quality controlled using Plink software version 1.90, removing individuals with a genotype detection rate <98%, SNPs with a detection rate <98%, SNPs with a minimum allele frequency <5%, and SNPs with a Hardy-Weinberg equilibrium p-value <10. -6 A total of 23,751,522 high-quality SNPs were identified in sheep populations in extremely cold regions. These loci are evenly distributed across the 26 pairs of autosomes in sheep from extremely cold regions. Figure 1 As shown.
[0037] The first three principal components were calculated using the "--pc3" parameter in Plink software version 1.90. These three principal components were then used as covariates to correct for population stratification in sheep from extremely cold regions. Genomic phylogenetic analysis based on the G-matrix was performed on this population using Plink v1.90, and the results are as follows: Figure 2 As shown, Figure 2 Each small square in the diagram represents the kinship value between any two individuals from the first to the last sample. The smaller the value, the closer it is to light green, indicating a more distant kinship between the two individuals, and vice versa. The results show that sheep in extremely cold regions have a more distant average kinship among individuals.
[0038] 6. Genome-wide association analysis The association between SNPs and body height traits was analyzed using the fastGWA-mlm model in GCTA software version V1.94.0beta.
[0039] y=X snp β snp +X c β c +g+e Where y is the phenotypic vector; X snp It is a genotype vector, and its effect is β. snp ;X c The correlation matrix is composed of gender, age, and the first three principal components (PCA) as fixed covariates, with corresponding coefficients β. c ;g is the vector of total genetic effects captured by the genetic relationship matrix derived from SNPs, g~N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e is the residual vector, e ~ N(0, ).
[0040] To avoid false negatives caused by the overly strict Bonferroni correction method of 0.05 / SNP, this invention adjusts the threshold for genome-wide significant association to P=1×10⁻⁶. -6 The genome expansion factor λ, calculated using R software version V3.6.0 (i.e., the slope of the linear regression between the observed quantile and the theoretical quantile), was found to be 0.960 for the body height trait, indicating no significant genome expansion. Based on resequencing data from 300 sheep from extremely cold regions, 10 significant SNP loci associated with the body height trait were detected. These loci are located on chromosomes 1, 3, 10, 13, 14, and 15, as shown in Table 2. Figure 3 As shown in A in the diagram.
[0041] Table 2. Significant SNP loci associated with body height trait in sheep from extremely cold regions.
[0042] Association analysis between SNPs and body height was performed using the FarmCPU model integrated in the rMVP package of R software. Based on resequencing data from 300 sheep from extremely cold regions, a total of 9 SNP loci significantly associated with body height were detected. These significant loci were distributed on chromosomes 3, 10, 14, and 15. (See Table 3 and...) Figure 3 As shown in B in the figure. This model effectively controls the false positive rate by iteratively optimizing the fixed and random effects, further verifying the complexity of the genetic structure of the body height trait.
[0043] Table 3. Significant SNP loci associated with body height trait in sheep from extremely cold regions.
[0044] Association analysis between SNPs and body height was performed using the Fast3VmrMLM model. Based on resequencing data from 300 sheep from extremely cold regions, 18 SNP loci significantly associated with body height were detected. These significant loci were located on chromosomes 1, 2, 4, 6, 7, 13, 15, 16, 19, 23, 24, and 26. (See Table 4). Figure 3 As shown in C. This multi-locus association analysis model can simultaneously detect multiple QTNs, improving the detection efficiency for complex trait genetic loci and revealing a wider range of chromosomal regions associated with the formation of body height traits in sheep from extremely cold regions.
[0045] Table 4. Significant SNP loci associated with body height trait in sheep from extremely cold regions.
[0046] In summary, by employing three different association analysis models—GCTA-fastGWA, rMVP-FarmCPU, and Fast3VmrMLM—this invention systematically identified SNP loci significantly associated with body height traits in sheep populations in extremely cold regions. The loci revealed by the different models overlap in both number and distribution, yet each model has its own emphasis, collectively outlining a complex genetic network controlling body height traits in sheep from extremely cold regions. This provides a solid data foundation and diverse candidate targets for subsequent molecular marker development and breeding applications. A comprehensive analysis of the results from the three models revealed an SNP locus located at position 66036339 on chromosome 15 (chr15_66036339), corresponding to an A→G mutation at base position 101 in SEQ ID NO.1. This SNP showed significant correlation in all models and was stably associated with body height traits.
[0047] 7. Validation and effect analysis of key SNP sites Genotyping and phenotypic association analysis was performed on the key locus chr15_66036339, and the results are shown in Table 5.
[0048] Table 5. Association analysis between different genotypes of the key SNP locus chr15_66036339 and body height.
[0049] Note: Different lowercase letters indicate significant differences. P <0.05.
[0050] As shown in Table 5, individuals with the AA genotype have the largest height, which can serve as a genetic marker for taller individuals; while individuals with the GG genotype have the smallest height. The allele frequencies and genotype frequencies at this locus are shown in Table 6.
[0051] Table 6. Allele frequencies and genotype frequencies of key SNP loci.
[0052] The base sequence containing this mutation site is shown in SEQ ID NO.1, where position 101 is represented by [A / G], specifically: CCACAGTGTTGGGTGACTACTTCCTTGCTCTTAAGAAGGCCCAGAGTGCTGTGGGAGGATTTCTCTTAGCTCTTTTATCCTGTCCTCTAGTGTCAGTTGG[A / G]AGAAGGAAATGGCAACCCACTCCAGTATTCTTGCCTGGGAAATCCATGGAGAGAGAGGGCTGGTGGGCTATGGTCCATGGGGTTCCAAAGAGTTAGATGT.
[0053] The above results indicate that the presence of base A at the 101 bp site of this molecular marker SEQ ID NO.1 is significantly associated with the gross height trait of sheep in extremely cold regions. Therefore, in breeding practice, detecting this site and selecting individuals with the AA genotype as parents can effectively improve the average height of the offspring population.
[0054] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0055] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0056] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.
Claims
1. The application of a molecular marker associated with body height traits in sheep from extremely cold regions, characterized in that, The base sequence of the molecular marker is shown in SEQ ID NO.1, and the base at the 101 bp position is A or G; The application refers to any one of the following (1) and (2): (1) Identification of body height of sheep in extremely cold regions: The body height of sheep with base A at the 101bp site of SEQ ID NO.1 is greater than that of sheep with base G; (2) Increase the height of offspring of sheep in extremely cold regions: Select individuals with base A at the 101bp site of SEQ ID NO.1 as parents for breeding to increase the height of offspring of sheep in extremely cold regions; The sheep in the extremely cold region are grassland short-tailed sheep.
2. The application as described in claim 1, characterized in that, The method for determining the height of sheep in extremely cold regions is as follows: Genomic DNA was extracted from sheep in extremely cold regions and sequenced. Determine the genotype of sheep in this extremely cold region at the 101bp site of SEQ ID NO.1; If the genotype is AA, the sheep in this extremely cold region are generally taller than individuals with the genotype AG or GG.
3. The application as described in claim 1, characterized in that, Methods to increase the body height of offspring sheep in extremely cold regions include: Genomic DNA was extracted from sheep in extremely cold regions and sequenced. Determine the genotype of sheep in this extremely cold region at the 101bp site of SEQ ID NO.1; Sheep individuals carrying the AA genotype from extremely cold regions were selected as parents for breeding to improve the body height of offspring from these regions.
4. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was derived from the blood of sheep from extremely cold regions.
5. The application as described in claim 2 or claim 3, characterized in that, The sequencing method is high-throughput sequencing.
6. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was extracted using the magnetic bead method.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker related to goat body height character and application of SNP molecular marker
CN120158525A
Application of molecular marker influencing sheep body height character
CN122168774A