A method for detecting bla based on MIRA-CRISPRCas13a KPC Reagents and methods for genes and their variants

By combining MIRA isothermal amplification and CRISPR/Cas13a nuclease, rapid, sensitive, and specific detection of the blaKPC gene and its variants has been achieved, solving the problems of high detection costs and reliance on specialized instruments in existing technologies, making it suitable for field applications.

CN122405856APending Publication Date: 2026-07-17ZHENGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610739755.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-27
Publication Date
2026-07-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate detection of carbapenemase KPC genes and their variants, especially when faced with atypical drug resistance characteristics, leading to diagnostic delays and uncertainty in treatment options. Furthermore, existing methods are costly and dependent on specialized instruments and technologies.

Method used

By combining MIRA isothermal amplification technology with CRISPR/Cas13a nuclease, specific primers and crRNA are used to identify the target blaKPC gene and its variants, and the signal is detected by fluorescent or lateral flow chromatography test strips, achieving rapid, sensitive and specific detection.

Benefits of technology

It achieves accurate identification of the blaKPC gene and its variants, reduces detection costs, does not rely on specialized instruments, is suitable for field applications, has high sensitivity and specificity, and can identify DNA, bacterial culture and clinical samples. The detection results are consistent with qPCR.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122405856A_ABST
    Figure CN122405856A_ABST
Patent Text Reader

Abstract

This invention discloses a method for detecting blavin based on MIRA-CRISPRCas13a. KPC Reagents and methods for gene and its variants. The reagents include (a) for amplifying bla KPC MIRA primer pairs for the gene, and / or (b) for detecting bla KPC The invention utilizes specific primer pairs designed to efficiently and specifically amplify multiple KPC subtype genes, with the crRNA accurately binding to the target sequence. Two result output methods were established: fluorescence and test strip methods. Both methods demonstrate high detection sensitivity and show no cross-reactivity with other drug-resistant gene DNAs. More importantly, this method effectively detects KPC-2 and newly emerging clinical KPC variants, overcoming the false negatives caused by gene mutations in existing detection technologies. The positive detection rate for clinical samples using this method is 100%, with significantly higher accuracy than existing technologies. This method is simple to operate, can rapidly detect multiple KPC subtypes under isothermal conditions, and exhibits high sensitivity and specificity, making it suitable for rapid screening and detection of KPC-producing carbapenem-resistant bacteria.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, and particularly relates to a method for detecting bla based on MIRA-CRISPRCas13a. KPC Reagents and methods for genes and their variants. Background Technology

[0002] Carbapenem-resistant Klebsiella pneumoniae (CRKP) outbreaks are frequent in many parts of the world, posing a significant challenge to hospital infection control and clinical treatment. CRKP transmission can lead to hospital-acquired infections such as bloodstream infections, pneumonia, and urinary tract infections. Due to its extremely strong drug resistance, CRKP infection is often accompanied by a high risk of death. The production of carbapenemases is the most important mechanism of CRKP resistance. Among them, Klebsiella pneumoniae carbapenemase (KPC) is one of the most prevalent carbapenemases among Enterobacteriaceae worldwide (e.g., KPC-2 and KPC-3). To combat infections caused by KPC-producing strains, several novel β-lactamase inhibitor combinations have been developed clinically, such as ceftazidime-avibactam. Avibactam inhibits class A carbapenemases (especially KPC-2), extended-spectrum β-lactamases (ESBL), class C cephalosporins, and some class D carbapenemases. Therefore, since its clinical use, CZA has been considered one of the most effective antibacterial drugs for treating CRKP infections.

[0003] However, with the widespread clinical application of CZA, bla KPC-2 Under selective pressure, genes mutate and evolve into various KPC variants. Studies have shown that some KPC variants can significantly weaken the enzymatic inhibitory effect of avibactam, leading to acquired carbapenem resistance in strains and severely impacting clinical treatment outcomes. Notably, some KPC variants, while acquiring CZA resistance, also exhibit decreased hydrolytic activity against carbapenem antibiotics and altered resistance phenotypes, increasing the difficulty of accurate identification of KPC variants in clinical laboratories and potentially causing diagnostic delays, misinterpretations, and uncertainty in subsequent treatment selection.

[0004] Currently, carbapenemase detection mainly includes two types of methods: phenotypic detection and genotypic detection. Phenotypic determination is based on the ability of carbapenemases to hydrolyze carbapenems, and detection methods include Carba NP assay, mCIM, eCIM, and 3-aminophenylboronic acid (APB) / EDTA method. These methods are relatively simple to operate and low in cost, but they rely on overnight bacterial culture, which is time-consuming and labor-intensive, and they are difficult to effectively detect KPC variants with atypical resistance characteristics. Genotypic detection includes quantitative real-time PCR, DNA molecular sequencing, and GeneXpert Carba R. Although they have high sensitivity and specificity, they require expensive specialized instruments and professional testing personnel, limiting their widespread clinical application.

[0005] Nucleic acid isothermal amplification technology, due to its ability to rapidly amplify nucleic acids under isothermal conditions, offers advantages such as ease of operation, short detection time, and low instrument dependence, and has been widely used for rapid detection of pathogens. Multiple isothermal rapid amplification (MIRA) is a domestically developed isothermal amplification technology that requires only one pair of primers to complete amplification within 5–30 minutes at 37–42℃, featuring low cost and high amplification efficiency. CRISPR / Cas13a is an RNA-targeting nuclease that specifically recognizes target RNA under crRNA guidance and activates trans-cleavage activity upon recognition, cleaving the RNA reporter probe in the system to achieve detection signal output. Currently, there are also existing technologies based on CRISPR-Cas13a for rapid detection of blavin. KPC Genetic methods, but they are all targeted at specific bacteriological systems. KPC Currently, there is no method that can simultaneously detect multiple KPC variants. Summary of the Invention

[0006] Objective of the invention: To address the problems existing in the prior art, this invention provides a method for detecting bla based on MIRA-CRISPRCas13a. KPC Reagents and methods for genes and their variants. This invention provides a rapid, sensitive, and highly specific method for detecting BLA-related genes and their variants. KPC Genetic testing methods can be used to accurately identify bacillus. KPC It also includes its variants, and sets result reading modes suitable for different application scenarios, which has important clinical application value.

[0007] Technical solution: To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a method for detecting bla KPC Reagents for genes and their variants, said reagents comprising:

[0009] (a) Used to amplify bla KPC The MIRA primer pairs for the gene are selected from:

[0010] MIRA-F1: AGGAGCGCTTCCCACTGTGCAGCTCATTCA (SEQ ID NO. 1);

[0011] MIRA-R1:GAAATTAATACGACTCACTATAGGGCCAACTCCTTCAGCAACAAATTGGCGGCGG (SEQID NO.2);

[0012] Or select from:

[0013] MIRA-F2:CCACTGTGCATTCATTCAAGGGCTTTCTT (SEQ ID NO.3);

[0014] MIRA-R2:GAAATTAATACGACTCACTATAGGGGGAACGTGGTATCGCCGATAGAGCGCATGA (SEQID NO.4);

[0015] Or select from:

[0016] MIRA-F3:CCACTGTGCAGTCATTCAAGGGCTTTCTT (SEQ ID NO.5);

[0017] MIRA-R3:GAAATTAATACGACTCACTATAGGGCACTGTATTGCACGGCGGCCGCGGACAGCT (SEQID NO.6);

[0018] Or select from:

[0019] MIRA-F4:TTCAAGGGCTTTCTTTGCTGCCGCTGTGCTG (SEQ ID NO. 7);

[0020] MIRA-R4:GAAATTAATACGACTCACTATAGGGCACTGTATTGCACGGCGGCCGCGGACAGCT (SEQID NO.8);

[0021] and / or (b) used to detect bla KPC The crRNA of the gene comprises a repeat sequence and a spacer sequence, the repeat sequence being capable of binding to the Cas protein, and the spacer sequence matching the amplification product sequence of the primer pair, the spacer sequence being as follows:

[0022] 5'-GAAAAATATCTGACAACAGGCATGACGG-3' (SEQ ID NO. 9).

[0023] Preferably, the MIRA primer pair is selected from MIRA-F1 and MIRA-R1.

[0024] As a specific implementation, the reagents also include MIRA buffer, T7 RNA polymerase, rNTPs (mix), B buffer, LwaCas13a, RNase-free dH2O, 10×Cas13a buffer, and signal reporter probe.

[0025] Furthermore, the signal reporting probe is a fluorescent reporter probe or a biotin reporter probe;

[0026] Preferably, the fluorescent reporter probe sequence is: 5'- / 6FAM / UUUUUU / 3BHQ-1-3 (SEQ ID NO. 10)', with the 5' end modified with the fluorescent group FAM and the 3' end modified with the quencher group BHQ1;

[0027] Preferably, the biotin reporter probe sequence is: 5′-6-FAM-UUUUUU-Biotin-3′ (SEQ ID NO.11), with the 5′ end modified with a 6-FAM fluorescent group and the 3′ end modified with a Biotin group.

[0028] As a specific implementation, the repetitive sequence in the crRNA is as follows: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC (SEQ ID NO.12).

[0029] The sequence of the crRNA is shown below: 5'-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAAAAATATCTGACAACAGGCATGACGG-3' (SEQ ID NO.13).

[0030] Secondly, the present invention provides the reagent described herein for the preparation of bla KPC Applications in gene and variant detection kits.

[0031] Thirdly, the present invention provides a method for detecting bla KPC A kit for genes and their variants, the kit comprising the reagents as claimed in the claims.

[0032] Fourthly, the present invention provides the aforementioned reagent, or the aforementioned kit, for detecting blavin. KPCApplications in genes and their variants.

[0033] In a fifth aspect, the present invention provides a method for detecting bla KPC genes and their variants, comprising the following steps:

[0034] (1) Extract nucleic acids from a sample to be tested;

[0035] (2) Mix the MIRA primer pair described in claim 1 with the nucleic acids extracted in step (1), perform MIRA isothermal amplification to obtain a MIRA amplification product;

[0036] (3) Mix the MIRA amplification product obtained in step (2) with the crRNA described in claim 1, as well as Cas13a protein, signal reporter probe, MIRA buffer, T7 RNA polymerase and rNTPs, and perform a CRISPR reaction;

[0037] (4) After the reaction, perform fluorescence detection or lateral flow strip detection.

[0038] As a specific implementation, in step (2), the concentration of each primer in the MIRA primer pair is 8 - 12 μM, and the reaction conditions for MIRA isothermal amplification are constant temperature reaction at 37 - 42 °C for 10 - 30 minutes.

[0039] In step (3), the ratio of Cas13a protein to crRNA is 1:(4 - 6), and the reaction conditions for the CRISPR reaction are constant temperature reaction at 35 - 39 °C for 25 - 35 minutes.

[0040] As a specific implementation, in step (4), the method for fluorescence detection includes:

[0041] Set a negative control group with water as the template in step (2), and use a fluorescent reporter probe as the signal reporter probe in step (3); perform fluorescence detection after the CRISPR reaction, read the detection signal, and determine whether the sample to be tested contains bla KPC gene. If the detection signal value has a significant difference from the result of the negative control group, or fluorescence is significantly observed, it is determined to be positive;

[0042] The method for lateral flow strip detection includes:

[0043] Use a biotin reporter probe as the signal reporter probe in step (3); after the CRISPR reaction, add the buffer solution provided in the strip kit to the reaction system, mix well, insert the strip into it, let it stand, and then read the result; determine whether the sample to be tested contains bla KPCFor gene testing, if the test line (T line) shows color, or if both the control line (C line) and the test line (T line) show color, the result is considered positive; if only the control line (C line) shows color, the result is considered negative.

[0044] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0045] This invention leverages the precise targeting capabilities of CRISPR-Cas13a nucleic acid detection technology, combining it with MIRA isothermal amplification technology to establish two rapid and accurate methods for identifying the drug resistance gene KPC. When the KPC gene is present in the sample, crRNA recognizes and binds to the KPC sequence, activating the trans-cleavage activity of Cas13a, thereby cleaving a fluorescent reporter gene or a biotin reporter gene, generating a fluorescent signal or displaying a T-line on the test strip. When the KPC gene is absent in the sample, the side-chain cleavage activity of Cas13a cannot be activated, and no detection signal is generated.

[0046] A MIRA-CRISPR / Cas13a detection system was established, and the CRISPR-FL and CRISPR-LFS methods were optimized and their performance evaluated. After optimization, the CRISPR-FL system used MIRA primers at a concentration of 10 μM, amplification time of 20 min, and temperature of 39℃, with a Cas13a protein to crRNA ratio of 1:5 and a final fluorescent reporter gene concentration of 800 nM. Specificity evaluation showed a single positive target, but the sensitivity was the lowest. KPC-2 The detection limit was 2.5 copies / μL, and the detection limit for bacterial suspensions was 5-1000 CFU / mL. The coefficient of variation for repeatability was <10%. 16 types of bromides were detected. KPC The specificity for bacterial strains, spiked urine, and bronchoalveolar lavage fluid samples reached 100%, and the positive detection rate for clinical samples was 100%, consistent with qPCR. The optimal conditions for the CRISPR-LFS method were a Cas13a protein to crRNA ratio of 1:5 and a reaction time of 30 min. Specificity was only positive for the target nucleic acid, and sensitivity was high for detecting [blank]. KPC-2 The limit of detection (LOD) is 5 copies / μL, and the detection limit for bacterial culture is 10 CFU / mL. The specificity for detecting the above samples is also 100%, and the positive detection rate for clinical samples is 100%. Meanwhile, the commercial kit NG-Test Carba 5 detects 16 strains of *Bacillus subtilis*. KPC The positive detection rate of strains was only 37.5%, and the detection rate of newly emerging KPC variants (other than KPC-2) was only 40%.

[0047] In summary, this invention requires no specialized equipment, has low technical requirements for testing personnel, and is less expensive than standard qPCR methods. It can detect not only DNA and bacterial culture samples, but also identify bacillus in spiked and clinical samples. KPC It has the potential for field applications. Attached Figure Description

[0048] Figure 1 For primer pair screening. A: Agarose gel electrophoresis results. B: MIRA-CRISPR / Cas13a-FL results. M: 5000 DNA Maker; 1-5: primers F1 / R1, F2 / R2, F3 / R3, and F4 / R4, respectively.

[0049] Figure 2 Optimization of MIRA amplification reaction conditions. A: Primer concentration screening; B: Amplification temperature screening; C: Amplification time screening.

[0050] Figure 3 Optimization of CRISPR / Cas13a-FL reaction conditions. A: Screening of crRNA to Cas13a concentration ratio; B: Screening of final fluorescent reporter gene concentration.

[0051] Figure 4 For the specificity evaluation of MIRA-CRISPR / Cas13a-FL: A: Specificity evaluation of target nucleic acid versus non-target nucleic acid; B: Specificity evaluation based on mixed bacterial nucleic acids, with target nucleic acid to non-target nucleic acid ratios of 1:10, 1:100, and 1:1000.

[0052] Figure 5 Evaluation of the sensitivity of MIRA-CRISPR / Cas13a-FL for DNA detection.

[0053] Figure 6 For the detection of bla by MIRA-CRISPR / Cas13a-FL KPC-2 And the sensitivity of its mutant bacterial culture. A:13883-pUC19-bla KPC-2 ;B:13883-pUC19-bla KPC-12 ;C:13883-pUC19-bla KPC-14 ;D:13883-pUC19-bla KPC-25 E:13883-pUC19-bla KPC-33 ;F:13883-pUC19-bla KPC-35 ;G:13883-pUC19-bla KPC-71 ;H:13883-pUC19-bla KPC-72 ;I:13883-pUC19-bla KPC-78 ;J:13883-pUC19-bla KPC-84 ;K:13883-pUC19-bla KPC-86 ;L:13883-pUC19-bla KPC-87;M:13883-pUC19-bla KPC-88 ;N:13883-pUC19-bla KPC-90; O:13883-pUC19-bla KPC-100 ;P:13883-pUC19-bla KPC-170 NC: Negative control

[0054] Figure 7 To verify the feasibility of MIRA-CRISPR / Cas13a-LFS.

[0055] Figure 8 Screening for the concentration ratio of crRNA to Cas13a in CRISPR / Cas13a-LFS.

[0056] Figure 9 For screening reaction time in CRISPR / Cas13a-LFS.

[0057] Figure 10 For the specificity evaluation of MIRA-CRISPR / Cas13a-LFS: A: Specificity evaluation of target nucleic acid versus non-target nucleic acid; B: Specificity evaluation based on mixed bacterial nucleic acids, with target nucleic acid to non-target nucleic acid ratios of 1:10, 1:100, and 1:1000.

[0058] Figure 11 Sensitivity evaluation for MIRA-CRISPR / Cas13a-LFS. A: Based on bla KPC-2 Sensitivity evaluation of DNA concentration; B: Based on bla KPC-2 Sensitivity evaluation of bacterial concentration.

[0059] Figure 12 For repeatability evaluation of MIRA-CRISPR / Cas13a-LFS.

[0060] Figure 13 For the detection of blavin using the MIRA-CRISPR / Cas13a method and qPCR method KPC-2 And the consistency rate assessment of variant genes. A: qPCR results; B: MIRA-CRISPR / Cas13a-FL results; C: MIRA-CRISPR / Cas13a-LFS;

[0061] 1:13883-pUC19-bla KPC-2 ;2:13883-pUC19-bla KPC-12 ;3:13883-pUC19-bla KPC-14 ;4:13883-pUC19-bla KPC-25 ;5:13883-pUC19-blaKPC-33 ;6:13883-pUC19-bla KPC-35 ;7:13883-pUC19-bla KPC-71 ;8:13883-pUC19-bla KPC-72 ;9:13883-pUC19-bla KPC-78 ;10:13883-pUC19-bla KPC-84 ;11:13883-pUC19-bla KPC-86 ;12:13883-pUC19-bla KPC-87 ;13:13883-pUC19-bla KPC-88 ;14:13883-pUC19-bla KPC-90; 15:13883-pUC19-bla KPC-100 ;16:13883-pUC19-bla KPC-170 NC: Negative control.

[0062] Figure 14 For the detection of blavin using the MIRA-CRISPR / Cas13a method and qPCR method KPC Concordance assessment of clinical isolates of variant strains. A: qPCR results; B: MIRA-CRISPR / Cas13a-FL results; C: MIRA-CRISPR / Cas13a-LFS results; 1-2: those containing bla KPC-14 Klebsiella pneumoniae; 3-5: containing bla KPC-33 Klebsiella pneumoniae.

[0063] Figure 15 For the detection of blavin using the MIRA-CRISPR / Cas13a method and qPCR method KPC-2 And the concordance rate assessment of variant-spikeped artificial urine. A: qPCR results; B: MIRA-CRISPR / Cas13a-FL results; C: MIRA-CRISPR / Cas13a-LFS;

[0064] 1:13883-pUC19-bla KPC-2 ;2:13883-pUC19-bla KPC-12 ;3:13883-pUC19-bla KPC-14 ;4:13883-pUC19-bla KPC-25 ;5:13883-pUC19-bla KPC-33 ;6:13883-pUC19-bla KPC-35 ;7:13883-pUC19-bla KPC-71 ;8:13883-pUC19-blaKPC-72 ;9:13883-pUC19-bla KPC-78 ;10:13883-pUC19-bla KPC-84 ;11:13883-pUC19-bla KPC-86 ;12:13883-pUC19-bla KPC-87 ;13:13883-pUC19-bla KPC-88 ;14:13883-pUC19-bla KPC-90; 15:13883-pUC19-bla KPC-100 ;16:13883-pUC19-bla KPC-170 NC: Negative control.

[0065] Figure 16 For the detection of blavin using the MIRA-CRISPR / Cas13a method and qPCR method KPC-2 And the concordance rate assessment of variant-spikeped bronchoalveolar lavage fluid. A: qPCR results; B: MIRA-CRISPR / Cas13a-FL results; C: MIRA-CRISPR / Cas13a-LFS;

[0066] 1:13883-pUC19-bla KPC-2 ;2:13883-pUC19-bla KPC-12 ;3:13883-pUC19-bla KPC-14 ;4:13883-pUC19-bla KPC-25 ;5:13883-pUC19-bla KPC-33 ;6:13883-pUC19-bla KPC-35 ;7:13883-pUC19-bla KPC-71 ;8:13883-pUC19-bla KPC-72 ;9:13883-pUC19-bla KPC-78 ;10:13883-pUC19-bla KPC-84 ;11:13883-pUC19-bla KPC-86 ;12:13883-pUC19-bla KPC-87 ;13:13883-pUC19-bla KPC-88 ;14:13883-pUC19-bla KPC-90; 15:13883-pUC19-bla KPC-100 ;16:13883-pUC19-bla KPC-170 NC: Negative control.

[0067] Figure 17 To assess the concordance rate between the MIRA-CRISPR / Cas13a method and the qPCR method for detecting clinical samples.

[0068] A: qPCR results; B: MIRA-CRISPR / Cas13a-FL results; C: MIRA-CRISPR / Cas13a-LFS results; 1-5: bla KPC Positive; 6-10: bla KPC Negative.

[0069] Figure 18 For NG-Test Carba 5 testing 13883-pUC19-bla KPC-2 And other variants. 1:13883-pUC19-bla KPC-2 ;2:13883-pUC19-bla KPC-12 ;3:13883-pUC19-bla KPC-14 ;4:13883-pUC19-bla KPC-25 ;5:13883-pUC19-bla KPC-33 ;6:13883-pUC19-bla KPC-35 ;7:13883-pUC19-bla KPC-71 ;8:13883-pUC19-bla KPC-72 ;9:13883-pUC19-bla KPC-78 ;10:13883-pUC19-bla KPC-84 ;11:13883-pUC19-bla KPC-86 ;12:13883-pUC19-bla KPC-87 ;13:13883-pUC19-bla KPC-88 ;14:13883-pUC19-bla KPC-90; 15:13883-pUC19-bla KPC-100 ;16:13883-pUC19-bla KPC-170 NC: Negative control. Detailed Implementation

[0070] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. These embodiments are only used to illustrate the present invention and are not intended to limit the scope of protection claimed by the present invention. Unless otherwise specified, the materials and reagents used in these embodiments are commercially available.

[0071] Example 1: 13883-pUC19-bla KPC-2 and bla KPCConstruction of mutants and in vitro drug sensitivity experiments

[0072] (1) Using pUC19 as a vector, genomic DNA was extracted from clinically isolated bacteria (Novozymes FastPure BacteriaDNA Isolation Mini Kit) and amplified to obtain blavin. KPC-2 Sequence, construct plasmid pUC19-bla KPC-2 Electroporation was performed on the standard strain of Klebsiella pneumoniae, ATCC13883.

[0073] (2) In 13883-pUC19-bla KPC-2 Based on bla KPC-2 Site-directed mutagenesis was performed (Novizan Mut ExpressII Fast Mutagenesis Kit V2) to obtain 15 other mutant strains (13883-pUC19-bla). KPC-12 ;3:13883-pUC19-bla KPC-14 ;4:13883-pUC19-bla KPC-25 ;5:13883-pUC19-bla KPC-33 ;6:13883-pUC19-bla KPC-35 ;7:13883-pUC19-bla KPC-71 ;8:13883-pUC19-bla KPC-72 ;9:13883-pUC19-bla KPC-78 ;10:13883-pUC19-bla KPC-84 ;11:13883-pUC19-bla KPC-86 ;12:13883-pUC19-bla KPC-87 ;13:13883-pUC19-bla KPC-88 ;14:13883-pUC19-bla KPC-90; 15:13883-pUC19-bla KPC-100 ;16:13883-pUC19-bla KPC-170 ).

[0074]

[0075] (3) Klebsiella pneumoniae ATCC13883 was used as the quality control strain in the experiment. The minimum inhibitory concentration of commonly used clinical antibiotics against the target strain was determined by the micro-broth dilution method.

[0076] Example 2: Design, synthesis of MIRA primers and crRNA, and screening of MIRA primers

[0077] (1) Design and synthesis of MIRA primers

[0078] According to 260 blah blahs published on the NCBI KPC The complete CDS sequence of the gene family was retrieved using Snapgene through multiple sequence alignments. KPC The target region should be a highly conserved region specific to the gene. The MIRA amplification region should include the crRNA target region, and the primer should not overlap with the target region to prevent crRNA from binding to the primer and increasing background levels. Primer length should be 25-35 bp, and the amplified fragment length should be 80-500 bp. A T7 RNA polymerase promoter (TAATACGACTCACTATAGGG) should be added to the 5' end of the reverse primer. Primer GC content should be between 20% and 70% to ensure better binding to the template while avoiding the formation of more dimers and hairpin structures. The Tm value should be maintained between 50-100℃ to avoid difficulties in melting.

[0079] (2) Design and synthesis of crRNA

[0080] The crRNA sequence is 64 nt in length, with a 28 nt spacer at the 3' end and a 36 nt direct repeat at the 5' end (GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC). The direct repeat sequence is fixed for different crRNAs; the spacer sequence is a crRNA-specific recognition sequence and should be complementary to a region of the ssRNA transcribed from the amplified product. It can target any region of the MIRA amplification fragment, but should avoid overlap with primers.

[0081] crRNA was synthesized using in vitro transcription. The reverse complementary sequence of the crRNA with the T7 promoter was: 5'-CCGUCAUGCCUGUUGUCAGAUAUUUUUCCGGTTTTAGGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTA-3'.

[0082] The transcribed template sequence was synthesized by Shanghai Sangon Biotech Co., Ltd. The synthesized sequence was diluted to 100 µL with sterile, enzyme-free water to prepare the annealing reaction mixture: 2 µL crRNA reverse complementary sequence (100 µM), 2 µL T7 promoter (100 µM), and 16 µL RNase-free dH2O. After mixing, the mixture was placed in a PCR instrument and incubated at 95℃ for 5 min, followed by a 1℃ decrease every 90 s for 70 cycles.

[0083] After determining the concentration using a Nanodrop spectrophotometer, 1 μg was used as a transcription template to transcribe the annealed product in vitro. The transcription system consisted of: 1 μg double-stranded DNA template, 2 µL T7 transcriptase, 4 µL NTP Mix (25 µM), and RNase-free dH2O to a final volume of 30 µL. The mixture was incubated at 37°C for 12–16 h to obtain crRNA. Excess DNA template was then digested with 2 μL DNase I. The obtained crRNA was purified using a column-based RNA purification kit. The concentration was measured spectrophotometer, aliquoted, and stored at -80°C for later use to prevent degradation.

[0084] (3) MIRA primer screening

[0085] Klebsiella pneumoniae culture and bla KPC-2 Plasmid DNA extraction (Tiangen Rapid Plasmid Mini-Prep Kit). After determining the nucleic acid concentration using a micro-spectrophotometer, the sample was diluted to 1×10⁻⁶. 8 Copies / µL are available for future use.

[0086] Prepare the MIRA reaction mixture in a PCR tube as follows: 29.4 µL A Buffer, 5 µL template, 2 µL F (10 µM), 2 µL R (10 µM), 9.1 µL RNase-free dH2O, and 2.5 µL B Buffer. Incubate the tube in a PCR instrument at 39°C for 20 min. Immediately after the reaction, remove the PCR tube and purify the MIRA reaction product using a DNA product purification kit (Novozymes FastPure® Gel DNA Extraction Mini Kit). Verify the purified product by 0.8% agarose gel electrophoresis. For further validation, CRISPR / Cas13a detection was performed after MIRA amplification and transcription binding reactions using different primer pairs.

[0087] Example 3: MIRA-CRISPR / Cas13a-FL Detection Method

[0088] I. Optimization of the MIRA-CRISPR / Cas13a-FL system

[0089] The MIRA-CRISPR / Cas13a-FL reaction system was prepared in a 0.2 mL PCR tube as follows: 9 µL RNase-free dH2O, 2 µL 10×Cas13a buffer, 1 µL crRNA (0.5 µM), 1 µL LwaCas13a (1 µM), 2 µL fluorescent reporter (8 µM), and 5 µL MIRA product. After brief centrifugation, the tube was placed in a qPCR instrument at 37°C for 40 min, and the fluorescence value was collected.

[0090] (1) Optimize the concentration of MIRA reaction primers

[0091] MIRA amplification and transcription reactions were performed using primers with different final concentrations, followed by CRISPR / Cas13a reaction to screen for the optimal primer concentration. Newly synthesized MIRA forward and reverse primers were centrifuged for 30 s using a handheld centrifuge, and an appropriate amount of ddH2O was added to prepare a 100 μM stock solution. The primer concentrations were then diluted to 2 µM, 4 µM, 6 µM, 8 µM, 10 µM, and 12 µM for later use. Different primer concentrations were added to the MIRA reaction system, and MIRA amplification and transcription reactions were performed at a reaction temperature of 39℃ for 20 min. The optimal primer concentration for the MIRA reaction was determined using CRISPR / Cas13a detection.

[0092] (2) Optimize the reaction temperature of MIRA

[0093] The MIRA-transcriptional binding system was placed at different reaction temperatures (37℃, 38℃, 39℃, 40℃, 41℃) and the experiment was completed according to the standard operating procedure. The primer concentration was set to 10 µM and the reaction time was set to 20 min to screen out the optimal experimental temperature for the MIRA reaction.

[0094] (3) Optimize MIRA reaction time

[0095] The MIRA-transcriptional binding system was placed in a PCR instrument and reacted for different times (5 min, 10 min, 15 min, 20 min, 25 min, 30 min) and the experiment was completed according to the standard operating procedure. The primer concentration was set to 10 µM and the reaction temperature was set to 39℃ to screen out the optimal reaction time for the MIRA reaction.

[0096] (4) Optimize the concentration of fluorescent reporter group

[0097] The concentration of the fluorescent reporter group was optimized, with final concentrations set to 100, 200, 400, 600, 800, and 1000 nmol. Other conditions remained constant, and the fluorescence intensity was compared.

[0098] (5) Optimize the concentration ratio of crRNA to LwaCas13a

[0099] The concentration ratio of crRNA to LwaCas13a was optimized. The final concentration of Cas13a protein was fixed at 150 nM, and the concentration ratios of crRNA to LwaCas13a were 1:5, 1:2, 1:1, 2:1, and 5:1. With other conditions unchanged, the fluorescence intensity was compared.

[0100] II. Specificity Evaluation of MIRA-CRISPR / Cas13a-FL

[0101] (1) Specificity evaluation of detection methods based on single bacterial DNA templates

[0102] Select genes containing other carbapenemase resistance genes (bla) preserved in our laboratory. GES-1、 bla NDM-1、 bla IMP-10、 bla OXA-23 To evaluate the specificity of the detection method, genomic DNA of the strains was first extracted using the Novizan Genomic DNA Extraction Kit to evaluate the carbapenemase resistance gene bla. KPC-2 The target nucleic acid was selected as MIRA primers, and other interfering carbapenemase resistance genes were selected as non-target nucleic acids. Amplification and detection were performed using selected MIRA primers and selected crRNA. A negative control group using water as a template was set up. Fluorescence values ​​at 40 min were compared. Values ​​showing a statistically significant difference compared to the negative control were considered positive (P<0.05), while values ​​showing no statistically significant difference were considered negative (P>0.05).

[0103] (2) Specificity evaluation of detection methods based on mixed bacterial DNA templates

[0104] Target nucleic acids and non-target nucleic acids were mixed at ratios of 1:10, 1:100, and 1:1000, and the mixed samples were then tested. This study used the carbapenemase resistance gene bla... KPC-2 As the target nucleic acid, several interfering bacterial nucleic acids (bla) are used. GES-1、 bla NDM-1、 bla IMP-10、 bla OXA-23 The target nucleic acid and non-target nucleic acid were mixed in equal proportions to form the non-target nucleic acid. The target nucleic acid and non-target nucleic acid were then mixed at final concentration ratios of 1:10, 1:100, and 1:1000. Detection was performed using the target nucleic acid, non-target nucleic acid, and the different proportions of mixed nucleic acid as templates, respectively. A negative control group using water as a template was also included. Each experiment was performed in triplicate. Fluorescence values ​​at 40 min were compared; a statistically significant difference compared to the negative control was considered positive (P<0.05), and no statistically significant difference was considered negative (P>0.05).

[0105] III. Sensitivity Evaluation of MIRA-CRISPR / Cas13a-FL

[0106] (1) Based on DNA sensitivity detection

[0107] 13883-pUC19-bla KPC-2 Single colonies were inoculated into liquid LB medium and incubated overnight at 37°C and 180 rpm. Plasmid DNA was extracted, and the plasmid copy number was calculated using the following formula. The plasmid was serially diluted 10-fold with sterile, enzyme-free water to a concentration of 1×10⁻⁶. 5 -1 copies / µL, using serially diluted nucleic acid as template. The lowest template concentration at which the fluorescence value is statistically different from the negative control is the detection limit of this method. Each experiment was performed in triplicate, with a negative control using water as template. The fluorescence values ​​at 40 min were compared. A statistically significant difference compared to the negative control was considered positive (P<0.05), and no statistically significant difference was considered negative (P>0.05).

[0108]

[0109] (2) Based on bacterial suspension sensitivity detection

[0110] Select 13883-pUC19-bla KPC-2 Single colonies of the aforementioned mutant strains were inoculated into 1 mL of LB liquid medium and cultured overnight at 37°C and 180 rpm. The next day, the bacterial pellet was collected by centrifugation at 8000 rpm for 2 min and washed twice with PBS. The bacterial suspension was then serially diluted 10-fold with PBS and counted using a dropper plate. After counting, the bacterial suspension was serially diluted with PBS buffer to a final volume of 10⁻⁶. 5 10 4 10 3 10 2 10 1 5, 2.5, 10 0 Genomic DNA was extracted using a thermal lysis method at CFU / mL, followed by MIRA amplification and CRISPR / Cas13a detection. A negative control group using water as a template was included. Each experiment was performed in triplicate. Fluorescence values ​​at 40 min were compared; a statistically significant difference compared to the negative control was considered positive (P<0.05), while no statistically significant difference was considered negative (P>0.05).

[0111] IV. Repeatability Evaluation of MIRA-CRISPR / Cas13a-FL

[0112] To verify repeatability, three 13883-pUC19-bla samples were tested respectively. KPC-2Five replicates were performed on the plasmid DNA samples. The coefficient of variation (COP) of the fluorescence values ​​was calculated using the evaluation criteria in the references. A COP < 10% indicates good reproducibility of the method.

[0113] V. The MIRA-CRISPR / Cas13a detection method for bla KPC Detection of mutant strains

[0114] 13883-pUC19-bla KPC-2 Single colonies of the mutant strains constructed above were inoculated into liquid LB medium and incubated overnight at 37°C and 180 rpm. Plasmid DNA was extracted from these strains, amplified by MIRA, and used as a template for CRISPR / Cas13a detection. A negative control group using water as a template was set up. Each experiment was performed in triplicate. Fluorescence values ​​at 40 min were compared; a statistically significant difference compared to the negative control was considered positive (P<0.05), and no statistically significant difference was considered negative (P>0.05). The specific detection method is as follows:

[0115] (1) The primer pair (MIRA-F1 and MIRA-R1) shown in SEQ ID NO.1 and 2 was mixed with the extracted bacterial plasmid DNA and MIRA was amplified isothermally for 20 min at 39℃. At the same time, a negative control group with water as template was set up to obtain MIRA amplification products.

[0116] (2) Mix the MIRA amplification product with the crRNA, Cas13a protein, fluorescent reporter probe shown in SEQ ID NO.13 of this invention, MIRA buffer, T7 RNA polymerase, and rNTPs, and perform CRISPR reaction detection. The reaction temperature is 37℃ and the time is 30min. Read the detection signal.

[0117] (3) Determine whether the sample to be tested contains bla based on the detection signal. KPC For genes, a positive result is indicated by a significant difference in the detection signal value compared to the negative control group, or by the obvious observation of fluorescence under ultraviolet light.

[0118]

[0119]

[0120] VI. Detection of Clinically Isolated Bacteria Using the MIRA-CRISPR / Cas13a Detection Method

[0121] Collect 5 existing strains containing blavin from the laboratory KPC Two strains of Klebsiella pneumoniae with mutated genes were identified. KPC-14 , 3 strains of blaKPC-33 Single colonies of the above-mentioned strains were inoculated into liquid LB medium and incubated overnight at 37°C and 180 rpm. Genomic DNA extracted crudely using the thermal lysis method was used as a template for MIRA amplification, and the amplification products were detected by CRISPR / Cas13a-FL. Each test was performed in triplicate. A negative control was included in each group, using water as a template. The fluorescence value was the background value. A statistically significant difference between the detected fluorescence value and the background value was considered positive (P<0.05), and no statistically significant difference was considered negative (P>0.05). The results were observed and recorded under ultraviolet light. Specific reagents and methods were the same as in step five. VII. Detection of spiked samples using the MIRA-CRISPR / Cas13a detection method.

[0122] 13883-pUC19-bla KPC-2 Single colonies of the mutant strains constructed above were inoculated into liquid LB medium and incubated overnight at 37°C and 180 rpm. 100 μL of bacterial suspensions of different concentrations were spiked into 900 μL of sterile artificial urine and bronchoalveolar lavage fluid samples.

[0123] After treating bacterial culture medium and bronchoalveolar lavage fluid samples with thermal lysis, 1 μL of the supernatant was used as a template for MIRA amplification. The amplification products were then detected by CRISPR / Cas13a-FL. Each test was performed in triplicate. A negative control was included in each group, using water, unspecified artificial urine, and bronchoalveolar lavage fluid samples as templates, respectively. The fluorescence values ​​were considered background values. A statistically significant difference between the detected fluorescence value and the background value was considered positive (P<0.05), and no statistically significant difference was considered negative (P>0.05). The results were observed and recorded under ultraviolet light. The specific reagents and methods were the same as in step five.

[0124] 8. Detection of clinical samples by MIRA-CRISPR / Cas13a

[0125] The 10 clinical samples used in this invention were obtained from a hospital. Short-term storage was performed at 4°C, and long-term storage was performed at -80°C. Based on the results of the clinical culture method, 5 samples were KPC-positive and 5 were KP-positive. C Negative samples. Pretreatment of collected samples: 750 μL of clinical sample was inoculated 1:1 into BHI broth and incubated at 37℃ and 180 rpm for 3 h using a heat lysis method. 1 μL of the supernatant was used as a template for MIRA amplification, and the amplification products were detected by CRISPR / Cas13a-FL. A negative control group was set up using water as a template, with the fluorescence value as the background value. A statistically significant difference between the detected fluorescence value and the background value was considered positive (P<0.05), and no statistically significant difference was considered negative (P>0.05). The test results were observed and recorded under ultraviolet light. Specific test reagents and methods are the same as in step five.

[0126] Example 4: MIRA-CRISPR / Cas13a-LFS Detection Method

[0127] I. Establishment of the MIRA-CRISPR / Cas13a-LFS detection method

[0128] The MIRA reaction was performed as described in Example 3. A CRISPR / Cas13a-LFS system was prepared in a 0.2 mL sterile, enzyme-free centrifuge tube: 9 µL sterile, enzyme-free water, 2 µL 10×Cas13a buffer, 1 µL crRNA (0.5 µM), 1 µL LwaCas13a (1 µM), 2 µL reporter group (500 nM), and 5 µL MIRA product. The MIRA product was added to the PCR tube cap, the cap was tightened, and the tube was briefly centrifuged. The tube was then quickly placed in a PCR instrument and set to react at 37°C for 30 min. Then, 5 µL of the product was added to a final volume of sterile, enzyme-free water (5 µL), mixed thoroughly, and the lateral flow test strip was inserted. After standing for 2 min, the test strip was removed, and the detection results were observed.

[0129] II. Optimization of the MIRA-CRISPR / Cas13a-LFS detection method

[0130] (1) Optimization of LwaCas13a to crRNA concentration ratio

[0131] To determine the optimal reaction ratio of Cas13a protein to crRNA, the initial and final concentrations of Cas13a protein were set at 50 nm, and CRISPR detection reactions were performed at different Cas13a:crRNA ratios (5:1, 2:1, 1:1, 1:2, and 1:5). After reacting at 37℃ for 30 min, the results were interpreted using LFS test strips. If the T line on the test strip showed color, it indicated a negative sample with no bladder detection. KPC The gene is present; if the C line and T line show color simultaneously, it indicates that the sample is positive and contains target RNA; if the C line shows color in the control group while only the T line shows color significantly in the sample group, it indicates that the sample is strongly positive.

[0132] (2) Optimization of CRISPR-LFS detection time

[0133] bla KPC-2 Plasmid DNA was used as a template for MIRA amplification, and the CRISPR detection time was optimized. The CRISPR-LFS detection system was prepared according to Example 3, and incubated at 37°C for 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min, respectively. After incubation, 5 µL of the incubator was taken and sterile enzyme-free water was added to a final volume of 50 µL. The mixture was thoroughly mixed and then inserted into a lateral flow test strip. After standing for 2 min, the test strip was removed and the detection results were observed.

[0134] III. Specificity Evaluation of the MIRA-CRISPR / Cas13a-LFS Detection Method

[0135] (1) Specificity evaluation of detection methods based on single bacterial DNA templates

[0136] Select genes containing other carbapenemase resistance genes (bla) preserved in our laboratory. GES-1 bla NDM-1 bla IMP-10 bla OXA-23 To evaluate the specificity of the detection method, genomic DNA of the strains was first extracted using the Novizan Genomic DNA Extraction Kit to evaluate the carbapenemase resistance gene bla. KPC-2 The target nucleic acid was used as the target nucleic acid, and other interfering carbapenemase resistance genes were used as non-target nucleic acids. Then, MIRA amplification was performed using this as a template, and CRISPR / Cas13a-LFS detection was performed according to the optimized reaction system. At the same time, a negative control with water as a template was set up. After incubation at 37°C for 30 min, the detection results were interpreted by the color development of the C line and T line on the LFS test strip.

[0137] (2) Specificity evaluation of detection methods based on mixed bacterial DNA templates

[0138] Target nucleic acids and non-target nucleic acids were mixed at ratios of 1:10, 1:100, and 1:1000, and the mixed samples were then tested. This study used the carbapenemase resistance gene bla... KPC-2 As the target nucleic acid, several interfering bacterial nucleic acids (bla) are used. GES-1 bla NDM-1 bla IMP-10 bla OXA-23 After being mixed in equal proportions, the non-target nucleic acids were used as the target nucleic acids. The target nucleic acids and non-target nucleic acids were then mixed at final concentration ratios of 1:10, 1:100, and 1:1000. MIRA amplification was performed using the target nucleic acids, non-target nucleic acids, and the different ratios of mixed nucleic acids as templates, respectively. CRISPR / Cas13a-LFS detection was performed according to the optimized reaction system. A negative control using water as a template was also included. After incubation at 37°C for 30 min, the detection results were interpreted based on the color development of the C and T lines on the LFS test strip.

[0139] IV. Sensitivity Evaluation of the MIRA-CRISPR / Cas13a-LFS Detection Method

[0140] (1) Based on DNA sensitivity detection

[0141] 13883-pUC19-bla KPC-2Single colonies were inoculated into liquid LB medium and incubated overnight at 37°C and 180 rpm. Plasmid DNA was extracted, and the plasmid copy number was calculated using the following formula. The plasmid was serially diluted 10-fold with sterile, enzyme-free water to a concentration of 1×10⁻⁶. 4 -1 copies / µL, using serially diluted nucleic acid as template. CRISPR / Cas13a-LFS detection was performed according to the optimized reaction system, with a negative control using water as template. After incubation at 37°C for 30 min, the detection results were interpreted by the color development of the C and T lines on the LFS test strip.

[0142]

[0143] (2) Based on bacterial suspension sensitivity detection

[0144] Select 13883-pUC19-bla KPC-2 Single colonies were inoculated into 1 mL of LB liquid medium and incubated overnight at 37°C and 180 rpm. The next day, the bacterial pellet was collected by centrifugation at 8000 rpm for 2 min and resuspended twice with PBS. The bacterial suspension was then serially diluted 10-fold with PBS and counted by drop plate analysis. After counting, the bacterial suspension was serially diluted with PBS buffer to a final concentration of 10⁻⁶. 5 10 4 10 3 10 2 10 1 1 Genomic DNA was extracted using a thermal lysis method at CFU / mL. CRISPR / Cas13a-LFS assay was performed according to the optimized reaction system, with a negative control using water as a template. After incubation at 37°C for 30 min, the results were interpreted based on the color development of the C and T lines on the LFS test strip.

[0145] V. Repeatability Evaluation of the MIRA-CRISPR / Cas13a-LFS Detection Method

[0146] To verify repeatability, three 13883-pUC19-bla samples were tested respectively. KPC-2 The plasmid DNA sample was tested in five replicates. The results were interpreted by observing the color development of the C and T lines on the LFS test strip.

[0147] VI. The MIRA-CRISPR / Cas13a-LFS detection method for bla KPC Detection of mutant strains

[0148] 13883-pUC19-bla KPC-2Single colonies of the aforementioned mutant strains were inoculated into liquid LB medium and incubated overnight at 37°C and 180 rpm. Plasmid DNA was extracted from these strains, amplified by MIRA, and used as a template for CRISPR / Cas13a-LFS detection. CRISPR / Cas13a-LFS detection was performed according to the optimized reaction system. A negative control using water as a template was also included. After incubation at 37°C for 30 min, the results were interpreted based on the color development of the C and T lines on the LFS test strip. The specific detection method is as follows:

[0149] (1) The primer pair (MIRA-F1 and MIRA-R1) shown in SEQ ID NO.1 and 2 was mixed with the extracted bacterial plasmid DNA and MIRA wasothermal amplification was performed to obtain MIRA amplification products; the reagents and their amounts, and amplification conditions were the same as in Example 3.

[0150] (2) Mix the MIRA amplification product with the crRNA, Cas13a protein, biotin reporter probe shown in SEQ ID NO.13 of this invention, MIRA buffer, T7 RNA polymerase, and rNTPs, and perform a CRISPR reaction at a temperature of 37°C for 30 min.

[0151]

[0152] (3) Add the buffer contained in the test strip kit to the reaction system, mix well, insert the test strip into it, and wait 2 minutes before reading the result;

[0153] (4) Determine whether the sample contains bla based on the detection bands. KPC For a gene, if the T line shows color or both the C and T lines show color, it indicates a positive result; if only the C line shows color, it indicates a negative result.

[0154] VII. Detection of Clinically Isolated Bacteria Using the MIRA-CRISPR / Cas13a-LFS Detection Method

[0155] Collect 5 existing strains containing blavin from the laboratory KPC Two strains of Klebsiella pneumoniae with mutated genes were identified. KPC-14 , 3 strains of bla KPC-33 Single colonies of the above-mentioned strain were inoculated into liquid LB medium and incubated overnight at 37°C and 180 rpm. Genomic DNA extracted crudely using the thermal lysis method was used as a template for MIRA amplification, and the amplification products were detected by CRISPR / Cas13a-LFS. A negative control using water as a template was also included; after incubation at 37°C for 30 min, the results were interpreted by observing the color development of the C and T lines on the LFS test strip. Specific reagents and methods were the same as in step six.

[0156] 8. Detection of spiked samples using the MIRA-CRISPR / Cas13a-LFS detection method

[0157] 13883-pUC19-bla KPC-2 Single colonies of the mutant strains constructed above were inoculated into liquid LB medium and incubated overnight at 37°C and 180 rpm. 100 μL of each different variant was spiked into 900 μL of sterile artificial urine and bronchoalveolar lavage fluid samples.

[0158] After treating bacterial culture medium and bronchoalveolar lavage fluid samples with thermal lysis, 1 μL of the supernatant was used as a template for MIRA amplification. The amplification products were then detected by CRISPR / Cas13a-LFS. CRISPR / Cas13a-LFS detection was performed according to the optimized reaction system. A negative control using water as a template was also included. After incubation at 37°C for 30 min, the detection results were interpreted by observing the color development of the C and T lines on the LFS test strip. Specific reagents and methods were the same as in step six.

[0159] Comparative Example 1: Establishment of a Real-Time PCR Detection Method

[0160] Referring to the carbapenemase resistance gene bla published in NCBI KPC Conserved gene sequences were used to design primers and probes, which were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0161] The primer and probe sequences are (5'-3'):

[0162] qPCR-KPC-F:AAACACGACCGGCAACCAC

[0163] qPCR-KPC-R-:GACGGCCAACACAATAGGTG

[0164] qPCR-KPC-P:FAM-GGGCAGTCGGAGACAAAACCGG-BHQ1

[0165] With the extracted bla KPC-2 Using plasmid DNA as a template to establish bla KPCThe real-time PCR reaction (Novozymes AceQ Universal U+ Probe Master Mix V2) was performed as follows: 10 μL 2×AceQ Universal U+ Probe Master Mix V2, 0.4 μL upstream primer qPCR-KPC-F (10 µM) and downstream primer qPCR-KPC-R (10 µM), 0.2 μL qPCR-KPC-P, 1 μL template, and DEPC water to a final volume of 20 μL. The reaction procedure is shown in Table 1 below.

[0166] Table 1. Quantitative Real-Time PCR Procedure

[0167]

[0168] Comparative Example 2: Evaluation of the concordance rate between MIRA-CRISPR / Cas13a-FL, MIRA-CRISPR / Cas13a-LFS detection methods and qPCR detection

[0169] The following comparative tests were performed using the MIRA-CRISPR / Cas13a-FL detection method in Example 3, the MIRA-CRISPR / Cas13a-LFS detection method in Example 4, and the qPCR method in Comparative Example 1:

[0170] (1) Detecting bla KPC-2 and mutant strains

[0171] To verify the accuracy of the MIRA-CRISPR / LwaCas13a detection method, 13883-pUC19-bla was extracted. KPC-2 The plasmid DNA of the mutant strains constructed above, and others, were used as templates for detection by MIRA-CRISPR / Cas13a-FL, MIRA-CRISPR / Cas13a-LFS, and qPCR methods, respectively, to verify the concordance rate between MIRA-CRISPR / Cas13a and qPCR.

[0172] (2) Detection of clinically isolated bacteria

[0173] To verify the accuracy of the MIRA-CRISPR / LwaCas13a detection method, five strains containing bla were tested. KPC Clinical isolates of Klebsiella pneumoniae variants were tested. Nucleic acid DNA was extracted using a thermal lysis method and a kit, and then used as a template for detection by MIRA-CRISPR / Cas13a-FL, MIRA-CRISPR / Cas13a-LFS, and qPCR methods, respectively. The concordance rate between MIRA-CRISPR / Cas13a and qPCR was verified.

[0174] (3) Testing spiked samples

[0175] To verify the accuracy of the MIRA-CRISPR / LwaCas13a detection method, nucleic acid DNA extracted from spiked bacterial culture into artificial urine and bronchoalveolar lavage fluid was extracted using a thermal lysis method and used as templates. The samples were then detected by MIRA-CRISPR / Cas13a-FL, MIRA-CRISPR / Cas13a-LFS, and qPCR methods, respectively, to verify the concordance rate between the two methods.

[0176] (4) Testing clinical samples

[0177] To verify the accuracy of the MIRA-CRISPR / LwaCas13a detection method, MIRA-CRISPR / Cas13a-FL and MIRA-CRISPR / Cas13a-LFS were performed on 10 clinical samples, and the results were compared with the qPCR method.

[0178] Comparative Example 3: NG-Test Carba 5 Detection Method

[0179] NG-Test Carba 5 is one of the commonly used methods for detecting carbapenemase resistance genes. The 13883-pUC19-bla gene constructed in this study... KPC-2 Other variants were streaked onto LB agar plates in three zones and incubated at 37°C for 12-16 h until single colonies appeared. Follow the kit instructions for further procedures.

[0180] 1. Take 5 drops of reagent buffer and add them to a 1.5 mL ep tube.

[0181] 2. Use an inoculation loop to pick up a single clone from an LB agar plate and transfer it to the liquid in an ep tube, then gently stir to mix.

[0182] Draw 100 μL of bacterial culture into a dropper, add 3 drops into the test well, and wait 5 minutes before reading the result.

[0183] Simultaneously, a negative control group was set up, consisting only of untreated buffer. The test results were observed; if the C-line and K-line showed color, it indicated that... KPC A positive result is indicated by the presence of only line C, which indicates a negative result.

[0184] The results of the above embodiments and comparative examples are as follows:

[0185] Sequence alignment confirmed that the recombinant plasmid and mutant sequences constructed in this study were entirely correct. To verify the accuracy of the 13883-pUC19-bla sequence constructed in this study... KPC-2 Whether the mutants exhibited drug resistance phenotypes is shown in Table 2. (Table 2 shows the results for 14 types of BLA.) KPC-2All mutants were resistant to ceftazidime-avibactam.

[0186] Table 2 13883-pUC19-bla KPC-2 and the MIC values ​​of its mutants for the drug

[0187]

[0188] To increase MIRA amplification products, such as Figure 1 As shown, the MIRA amplification results of the four primer pairs were good, with fragment lengths and positions consistent with expectations, and no dimers or non-specific reactions. However, primer pair 1 yielded more amplification products, and CRISPR / Cas13a detection showed a higher fluorescence value using primer pair 1. Therefore, primer pair F1 / R1 was selected for subsequent experiments. Figure 2 As shown in Figure A, the optimal range for the final concentration of MIRA primers is 2-12 µM. The highest fluorescence value was obtained when the primer concentration was 10 µM; therefore, a 10 µM concentration was chosen for the MIRA primers. Figure 2 As shown in Figure B, the optimized reaction temperature range for MIRA is 37-41℃. The highest fluorescence value was obtained at a reaction temperature of 39℃; therefore, 39℃ was selected as the reaction temperature. Figure 2 As shown in Figure C, the optimal reaction time range for MIRA is 5-30 min. The highest fluorescence value was obtained when the reaction time was 20 min, so the reaction time of 20 min was selected. Therefore, the final optimized MIRA amplification system conditions are: primer concentration 10 µM, reaction temperature 39℃, and reaction time 20 min.

[0189] To further improve the reactivity of CRISPR / Cas13a, reaction optimization was performed. For example... Figure 3 As shown in Figure A, the optimized final concentration range of the CRISPR / Cas13a fluorescent reporter gene was 100-1000 nm, and the highest fluorescence value was obtained when the final concentration of the fluorescent reporter gene was 800 nm. Figure 3 As shown in Figure B, to verify the optimal detection ratio of Lwa Cas13a to crRNA, the final concentration of Cas13a protein was fixed at 50 nm, and CRISPR detection reactions were performed with different Cas13a to crRNA ratios (5:1, 2:1, 1:1, 1:2, 1:5). The results showed that the cleavage efficiency varied with different ratios, and the highest fluorescence value was achieved when the Cas13a protein:crRNA ratio was 1:5. Therefore, a final Cas13a protein fixation concentration of 50 nm and a final crRNA concentration of 250 nm were selected. Thus, the final optimized CRISPR / Cas13a detection system conditions are: Cas13a protein:crRNA = 1:5, and a final fluorescent reporter gene concentration of 800 nm.

[0190] To evaluate the specificity of the established MIRA-CRISPR / Cas13a-FL nucleic acid detection method, bla KPC-2 DNA was used as the target nucleic acid, while other carbapenemase resistance gene nucleic acids were used as non-target nucleic acids for MIRA-CRISPR / Cas13a detection. For example... Figure 4 A shows that, using the target nucleic acid bla KPC-2 When DNA was tested, the fluorescence value increased, showing a statistically significant difference compared to the negative control (P<0.05); non-target nucleic acids (bla... GES-1 bla NDM-1 bla IMP-10 bla OXA-23 Using ) as a template for detection, the fluorescence value was not statistically different from that of the negative control (P>0.05), and was considered as a background value.

[0191] To further evaluate the specificity of this method in complex samples, a mixed bacterial nucleic acid specificity evaluation was conducted. Nucleic acids from several interfering bacteria were mixed in equal proportions as non-target nucleic acids. KPC-2 DNA and non-target nucleic acids were mixed at ratios of 1:10, 1:100, and 1:1000 and used as templates for MIRA amplification, followed by MIRA-CRISPR / Cas13a detection. Detection results... Figure 4 B showed statistically significant differences compared to the negative control (P<0.05), but no statistically significant differences compared to the results of the target nucleic acid group detected alone (P>0.05). This indicates that the method can still specifically detect the target nucleic acid even when the target nucleic acid content is much lower than the non-target nucleic acid content, demonstrating good specificity.

[0192] like Figure 5 As shown, to evaluate the detection limit of this method, the extracted bacterial DNA was serially diluted and then subjected to MIRA amplification. The amplification products were detected using CRISPR-FL. KPC-2 The detection limit for drug resistance genes is 2.5 copies / μL of bacterial nucleic acid.

[0193] like Figure 6 As shown, in order to improve the understanding of 13883-pUC19-bla KPC-2 To investigate the sensitivity of the mutant bacteria constructed above, the bacterial cultures of all strains were serially diluted, and the nucleic acid extraction procedure was simplified. Nucleic acid extracted using thermal lysis was used as a template for MIRA amplification. The amplification products were detected using CRISPR-FL. KPC-2 The detection limit for its mutant bacterial cultures is 5-1000 CFU / mL.

[0194] The repeatability evaluation results are shown in Table 3. The coefficient of variation for repeated detection of this method is 2.30%-3.50%, all of which are less than 10%, indicating that the established method has good repeatability.

[0195] Table 3 Repeatability Evaluation of MIRA-CRISPR / Cas13a-FL

[0196]

[0197] like Figure 7 As shown, 13883-pUC19-bla KPC-2 MIRA amplification was performed using plasmid DNA as a template, and the amplification products were detected by CRISPR / Cas13a-LFS. (The last sentence appears to be incomplete and possibly refers to a different topic.) KPC-2 When plasmid DNA was used as a template, both the C and T lines on the LFS test strip showed color; however, the negative control group (containing no crRNA, no template DNA, and only ssRNA) showed color only on the C line. This indicates that the detection method was successfully established and can accurately identify the target DNA when it is present.

[0198] like Figure 8 As shown, to determine the optimal concentration ratio of LwaCas13a protein to crRNA, the final concentration of Cas13a protein was set to 50 nm, and detection was performed at ratios of 5:1, 2:1, 1:1, 1:2, and 1:5. The results showed that a strong positive result was observed when the ratio of Cas13a protein to crRNA was 1:5, characterized by significant T-line development and weak or no C-line development. Therefore, the optimal reaction ratio of Cas13a protein to crRNA was determined to be 1:5, i.e., a final crRNA concentration of 250 nm. The final detection system is shown in Table 4.

[0199] Table 4 Final reaction system of CRISPR / Cas13a-LFS

[0200]

[0201] like Figure 9 As shown, the optimal reaction time range for CRISPR / Cas13a is 5-30 min. MIRA-CRISPR / Cas13a-LFS detection showed a strong positive result at a reaction time of 30 min, characterized by significant T-line development and weak or no C-line development. Therefore, a reaction time of 30 min was selected. Thus, the final optimized MIRA-CRISPR / Cas13a system conditions are: an optimal Cas13a protein to crRNA ratio of 1:5 and a reaction time of 30 min.

[0202] like Figure 10As shown in Figure A, to evaluate the specificity of the established MIRA-CRISPR / Cas13a-LFS nucleic acid detection method, bla KPC-2 DNA was used as the target nucleic acid, and other carbapenemase resistance gene nucleic acids were used as non-target nucleic acids for MIRA-CRISPR / Cas13a-LFS detection. The target nucleic acid bla... KPC-2 DNA testing showed clear bands at the T line on all test strips, resulting in positive results. Non-target nucleic acid (BLA) testing was also performed. GES-1、 bla NDM-1、 bla IMP-10、 bla OXA-23 Using this as a template for testing, the T-line of the test strip showed no obvious bands, indicating a negative result, consistent with the negative control. Figure 10 As shown in B, to further evaluate the specificity of this method in complex samples, a mixed bacterial nucleic acid specificity evaluation was performed. Nucleic acids from several interfering bacteria were mixed in equal proportions and used as non-target nucleic acids. KPC-2 DNA and non-target nucleic acids were mixed at ratios of 1:10, 1:100, and 1:1000 and used as templates for MIRA amplification, followed by MIRA-CRISPR / Cas13a-LFS detection. Results showed that target nucleic acids were detected in all mixtures, even when the target nucleic acid concentration was significantly lower than that of non-target nucleic acids. Both non-target nucleic acids and the negative control were negative, indicating good specificity of the method.

[0203] like Figure 11 As shown in Figure A, to evaluate the sensitivity of the MIRA-CRISPR / Cas13a-LFS detection method for DNA detection, 13883-pUC19-bla was used. KPC-2 plasmid DNA diluted to 1×10 4 1×10 3 1×10 2 The detection limits are 10, 5, 2.5, and 1 copies / µL, with a minimum detection limit of 5 copies / µL for DNA. Therefore, the limit of detection for DNA is 5 copies / µL. Figure 11 As shown in B, to evaluate the sensitivity of the MIRA-CRISPR / Cas13a-LFS detection method for detecting bacterial suspensions, 13883-pUC19-bla was used. KPC-2 Dilute the bacterial solution to 10 5 10 4 10 3 10 2 10 1 The limit of detection is 1 CFU / mL, and it can be detected when the lowest concentration of the bacterial culture is 10 CFU / mL. Therefore, the limit of detection based on the bacterial culture is 10 CFU / mL.

[0204] like Figure 12 As shown, to evaluate the reproducibility of the MIRA-CRISPR / Cas13a-LFS detection method, 13883-pUC19-bla was extracted at three different time points. KPC-2 Plasmid DNA, using MIRA amplification products as templates, was used for intra-batch and inter-batch repeatability testing. This method consistently detected bla in plasmid DNA extracted from the same batch and at three different times. KPC In the control group (without DNA), both the C and T lines of the test strip showed color; while in the negative control group (without DNA), only the C line showed color. This indicates that different detection times and different extraction times of genomic DNA did not affect the accuracy of the test results, demonstrating good repeatability.

[0205] like Figure 13 As shown, to preliminarily evaluate the concordance rate between the MIRA-CRISPR / Cas13a-LF and MIRA-CRISPR / Cas13a-LFS detection methods and the qPCR method, a Ct value <35 was considered positive according to the standards in the references. Using bla... KPC-2 Using mutant bacterial DNA as a template, detection was performed simultaneously using MIRA-CRISPR / Cas13a-LF, MIRA-CRISPR / Cas13a-LFS, and qPCR methods. qPCR results showed Ct values ​​all <35 (…). Figure 13 A); both CRISPR / Cas13a-FL methods produced strong fluorescence ( Figure 13 B); CRISPR / Cas13a-LFS method detects color in both C-lines and T-lines (B); Figure 13 C); all test results were bla KPC Positive. This indicates that the three methods have a 100% accuracy rate.

[0206] like Figure 14 As shown, to further verify the accuracy of the MIRA-CRISPR / Cas13a-LF and MIRA-CRISPR / LwaCas13a-LFS detection methods, five strains containing bla were analyzed. KPC Clinical isolates of Klebsiella pneumoniae from variants were tested. qPCR results showed Ct values ​​all <35 ( Figure 14 A); both CRISPR / Cas13a-FL methods produced strong fluorescence ( Figure 14 B); CRISPR / Cas13a-LFS method detects color in both C-lines and T-lines (B); Figure 14 C); all test results were bla KPC Positive. This indicates that the three methods have a 100% accuracy rate.

[0207] like Figure 15 , 16As shown, to further evaluate the concordance rate between the MIRA-CRISPR / Cas13a-LF and MIRA-CRISPR / Cas13a-LFS detection methods and the qPCR method, the MIRA-CRISPR / Cas13a-LFS method was used to detect bla... KPC Spiked samples of *Varioid*, in both spiked urine and bronchoalveolar lavage fluid samples, showed CT values ​​<35 in qPCR detection. Figure 15 Both A and 16A; strong fluorescence was detected by the CRISPR / Cas13a-FL method. Figure 15 B, 16B); CRISPR / Cas13a-LFS method detected color in both C-lines and T-lines (B, 16B); Figure 15 C, 16C); the test results were all bla KPC Positive. This indicates that the three methods have a 100% accuracy rate.

[0208] like Figure 17 As shown, 10 clinical samples were collected for testing. According to the test results provided by the hospital, samples 1-5 were positive, and samples 6-10 were negative. Then, qPCR and MIRA-CRISPR / Cas13a-LFS tests were performed using nucleic acid as a template. In samples 1-5, the qPCR test results showed that the CT value was <35 (…). Figure 17 A); both CRISPR / Cas13a-FL methods produced strong fluorescence ( Figure 17 B); CRISPR / Cas13a-LFS method detects color in both C-lines and T-lines (B); Figure 17 C); all test results were bla KPC Positive. This indicates a 100% concordance rate among the three methods. In samples 6-10, the qPCR CT value was >35, the CRISPR / Cas13a-FL method produced almost no fluorescence, and the MIRA-CRISPR / Cas13a-LFS method showed only C-line coloration, indicating negative results. Therefore, the concordance rate among the three methods is 100%.

[0209] like Figure 18 As shown, NG-Test Carba 5 is one of the commonly used methods for detecting carbapenemase resistance genes. The NG-Test Carba 5 kit was used to detect the 13883-pUC19-bla gene constructed in this invention. KPC-2 Other variants, of which only bla KPC-2 bla KPC-12 bla KPC-14 bla KPC-35 bla KPC-72 bla KPC-84 One result was positive, and the rest were negative.

[0210] The embodiments of the present invention have been described in detail above with reference to specific examples. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention.

Claims

1. A method for detecting bla KPC Reagents for genes and their variants, characterized in that, The reagents include: (a) Used to amplify bla KPC The MIRA primer pairs for the gene are selected from: MIRA-F1: AGGAGCGCTTCCCACTGTGCAGCTCATTCA (SEQ ID NO. 1); MIRA-R1:GAAATTAATACGACTCACTATAGGGCCAACTCCTTCAGCAACAAATTGGCGGCGG (SEQ IDNO.2); Or select from: MIRA-F2:CCACTGTGCATTCATTCAAGGGCTTTCTT (SEQ ID NO.3); MIRA-R2:GAAATTAATACGACTCACTATAGGGGGAACGTGGTATCGCCGATAGAGCGCATGA (SEQ IDNO.4); Or select from: MIRA-F3:CCACTGTGCAGTCATTCAAGGGCTTTCTT (SEQ ID NO.5); MIRA-R3:GAAATTAATACGACTCACTATAGGGCACTGTATTGCACGGCGGCCGCGGACAGCT (SEQ IDNO.6); Or select from: MIRA-F4:TTCAAGGGCTTTCTTTGCTGCCGCTGTGCTG (SEQ ID NO. 7); MIRA-R4:GAAATTAATACGACTCACTATAGGGCACTGTATTGCACGGCGGCCGCGGACAGCT (SEQ IDNO.8); and / or (b) used to detect bla KPC The crRNA of the gene comprises a repeat sequence and a spacer sequence, the repeat sequence being capable of binding to the Cas protein, and the spacer sequence matching the amplification product sequence of the primer pair, the spacer sequence being as follows: 5'-GAAAAATATCTGACAACAGGCATGACGG-3' (SEQ ID NO. 9).

2. The reagent according to claim 1, characterized in that, The MIRA primer pair is selected from MIRA-F1 and MIRA-R1.

3. The reagent according to claim 1, characterized in that, The reagents also include MIRA buffer, T7 RNA polymerase, rNTPs (mix), B buffer, LwaCas13a, RNase-free dH2O, 10×Cas13a buffer, and signal reporter probe; Furthermore, the signal reporting probe is a fluorescent reporter probe or a biotin reporter probe; Preferably, the fluorescent reporter probe sequence is: 5'- / 6FAM / UUUUUU / 3BHQ-1-3 (SEQ ID NO.10)', with the 5' end modified with the fluorescent group FAM and the 3' end modified with the quencher group BHQ1; Preferably, the biotin reporter probe sequence is: 5′-6-FAM-UUUUUU-Biotin-3′ (SEQ ID NO.11), with the 5′ end modified with a 6-FAM fluorescent group and the 3′ end modified with a Biotin group.

4. The reagent according to claim 1, characterized in that, The repeating sequence in the crRNA is as follows: GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC (SEQ ID NO.12). The sequence of the crRNA is shown below: 5'-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAAAAATATCTGACAACAGGCATGACGG-3' (SEQ ID NO.13).

5. The reagent according to any one of claims 1-4 in the preparation of bla KPC Applications in gene and variant detection kits.

6. A method for detecting bla KPC A kit for genes and their variants, characterized in that, The kit comprises the reagent according to any one of claims 1-4.

7. The reagent according to any one of claims 1-4, or the kit according to claim 6, for detecting b... KPC Applications of genes and their variants.

8. A method for detecting bla based on MIRA-CRISPR / Cas13a KPC The method for genes and their variants is characterized by, Includes the following steps: (1) Extract nucleic acid from the sample to be tested; (2) Mix the MIRA primer pair described in claim 1 with the nucleic acid extracted in step (1) and perform MIRA isothermal amplification to obtain MIRA amplification products; (3) The MIRA amplification product obtained in step (2) is mixed with the crRNA described in claim 1, as well as Cas13a protein, signal reporter probe, MIRA buffer, T7 RNA polymerase and rNTPs, and a CRISPR reaction is performed. (4) After the reaction, fluorescence detection or side-flow chromatography test strip detection is performed.

9. The method according to claim 8, characterized in that, In step (2), the concentration of each primer in the MIRA primer pair is 8-12 μM, and the reaction conditions for MIRA isothermal amplification are 37-42°C for 10-30 minutes. In step (3), the ratio of Cas13a protein to crRNA is 1:(4-6), and the CRISPR reaction conditions are a constant temperature reaction at 35-39°C for 25-35 minutes.

10. The method according to claim 8, characterized in that, In step (4), the fluorescence detection method includes: In step (2), a negative control group using water as a template is set up. In step (3), a fluorescent reporter probe is used as the signal reporting probe. After the CRISPR reaction, fluorescence detection is performed, the detection signal is read, and the presence of bacillus in the sample is determined based on the detection signal. KPC If the gene detection signal value is significantly different from that of the negative control group, or if fluorescence is clearly observed, it is considered positive. The method for detection using the lateral flow chromatography test strip includes: In step (3), the signal reporting probe is a biotin reporting probe; after the CRISPR reaction, add the buffer solution supporting the test strip kit into the reaction system, mix well, insert the test strip into it, let it stand and then read the result; determine whether the tested sample contains the bla KPC gene. If the test line T line shows color, or both the quality control line C line and the test line T line show color, it is determined as positive; if only the quality control line C line shows color, it is determined as negative.