A non-natural amino acid fragment compound, a preparation method and application thereof, a pharmaceutical composition and application thereof

Abstract

The application provides a non-natural amino acid fragment compound, a preparation method and application thereof, a pharmaceutical composition and application thereof, and belongs to the technical field of biological medicines. The non-natural amino acid fragment compound provided by the application has significant inhibitory activity on HIV-1 protease, a wild-type HIV-1 drug-resistant virus strain and a DRV high drug-resistant virus strain, and has low cytotoxicity, and has a good application prospect.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a compound containing non-natural amino acid fragments, its preparation method and application, and a pharmaceutical composition and its application. Background Technology

[0002] Acquired Immune Deficiency Syndrome (AIDS), also known as HIV, is a sexually transmitted disease caused by infection with the Human Immunodeficiency Virus (HIV), which leads to an immune deficiency and triggers a series of complications or sequelae.

[0003] Currently, the mainstream treatment for HIV is highly active antiretroviral therapy (HAART), also known as "cocktail therapy," which combines multiple drugs (often a triple-drug combination) to effectively reduce viral replication and achieve the desired therapeutic effect. However, existing drugs cannot completely eradicate the virus, and cross-resistance caused by HAART is becoming increasingly serious, leaving patients still facing complex problems such as poor adherence and numerous complications.

[0004] Based on serological responses and gene sequence differences, HIV is generally classified into two subtypes: HIV-1 and HIV-2. HIV-1 is more infectious and pathogenic, and is the predominant circulating subtype. During HIV-1 viral replication, a specific aspartic protease encoded by the HIV gene plays a crucial role. It hydrolyzes Gap and Gap-pol precursor proteins to produce key enzymes and proteins required for viral maturation. Therefore, it has become an important target for the development of anti-HIV therapeutics.

[0005] Since the U.S. Food and Drug Administration (FDA) approved darunavir in 2006, no new protease inhibitors have been approved for use. Furthermore, the widespread use of existing protease inhibitors has led to the emergence of various drug-resistant HIV strains, such as HIV DRV RP20 and HIV DRV RP30, posing a challenge to the clinical treatment of HIV. Therefore, the development of a new and effective drug to combat drug-resistant HIV remains an urgent priority. Summary of the Invention

[0006] Therefore, the present invention aims to provide a compound containing non-natural amino acid fragments, its preparation method and application, and a pharmaceutical composition and its application. The compound containing non-natural amino acid fragments provided by the present invention exhibits significant inhibitory activity against HIV protease and DRV-resistant HIV protease.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a compound containing non-natural amino acid fragments, having the structure shown in Formula I: Formula I; Among them, R a include , , , , , , , or ; R b Including -H, , , , , , , , , amino acid residues or dipeptide residues; wherein Ry1 and Ry3 independently include oxygen or sulfur; Ry2 and Ry4~Ry6 independently include C1~C8 alkyl, C2~C8 alkenyl, C2~C9 alkynyl; Ry7 includes , , , , , or ;Ry8~Ry 10 Each is an amino acid side chain group; m1, m2, and o are independent integers from 1 to 3; R c include , , , , , , , , , , , , or ; R includes , , or ; Among them, R x1 ~R x14 Independently includes hydrogen, hydroxyl, methoxy, amino, halogen, C1-C8 alkyl, C1-C8 alkenyl, C3-C8 cycloalkenyl, C1-C8 alkoxy, C1-C8 alkoxyacyl, C2-C8 alkoxycycloyl, C3-C8 alkoxyalkenyl or C3-C8 alkoxycycloalkenyl; X includes -CH2- or oxygen.

[0008] Preferably, the amino acid residues include The dipeptide residues include Among them, Ry8~Ry 10 It can be a natural amino acid side chain group or a non-natural amino acid side chain group.

[0009] Preferably, the R b Including -H, , , , , , , or .

[0010] Preferably, the compound containing non-natural amino acid fragments comprises the structure shown in any one of I-1 to I-15: , , , , , , , , , , , , , , .

[0011] This invention also provides a method for preparing the compound containing non-natural amino acid fragments described in the above technical solution. (i) When R b When =-H, the preparation method includes the following steps: reacting compound A and amino derivative B in the presence of an amide catalyst to obtain R. bThe compound containing non-natural amino acid fragments is defined as =-H; compound A includes compound A-1 or compound A-2. ; Rx in compound A-1 includes , or ; (ii) When R b for , , , , , , or The preparation method includes the following steps: R b =-H contains non-natural amino acid fragments and R b -X' undergoes a substitution reaction to obtain the compound containing the non-natural amino acid fragment; the R b In -X', X' represents a halogen; (iii) When R b When the residue is an amino acid residue or a dipeptide residue, the preparation method includes the following steps: R b =H contains a non-natural amino acid fragment compound that undergoes a condensation reaction with a Boc-protected amino acid or a Boc-protected dipeptide, followed by a deprotection reaction to obtain the non-natural amino acid fragment compound.

[0012] Preferably, the preparation method of the amino derivative B includes the following steps: performing a condensation reaction between an amino compound and a non-natural amino acid fragment compound with a protecting group, followed by a deprotection reaction to obtain amino derivative B; The structural formula of the amino compound is: ; The non-natural amino acid fragment compounds with protective groups include or .

[0013] Preferably, the non-natural amino acid fragment compound with a protecting group includes , , , , , , , or .

[0014] Preferably, when R c for The preparation method of the amino compound includes the following steps: The amino compound B-1 was substituted with p-bromobenzenesulfonyl chloride to give amino compound B-2; The amino compound B-2 was subjected to a substitution reaction with pinacol to obtain amino compound B-3; The amino compound B-3 was subjected to a hydrolysis reaction to obtain amino compound B-4; The amino compound B-4 was subjected to a deprotection reaction to obtain the amino compound; When R c for , , , , , or The preparation method of the amino compound includes the following steps: The amino compound B-1 was substituted with 2-(methylthio)benzo[d]thiazol-6-sulfonyl chloride to give the amino compound B-5. The amino compound B-5 was oxidized in the presence of an oxidizing catalyst to obtain an oxidation intermediate. The oxidation intermediate was reacted with NH2-R O A substitution reaction was carried out to give amino compound B-6; the NH2-R O Chinese R O Including methyl, cyclopropyl, isopropyl, isobutyl, or formate groups; The amino compound B-6 was subjected to a deprotection reaction to obtain the amino compound; When R c for or The preparation method of the amino compound includes the following steps: The amino compound B-1 was subjected to a substitution reaction with 3-chloro-4-aminobenzenesulfonyl chloride to obtain the amino compound B-7. The amino compound B-7 was subjected to a substitution reaction with isoselenic cyanide to obtain amino compound B-8; the isoselenic cyanide was R. p -N=C=Se, where R p Including methyl or cyclopropyl; The amino compound B-8 was subjected to a deprotection reaction to obtain the amino compound; .

[0015] The present invention also provides a pharmaceutical composition comprising an active ingredient and pharmaceutically acceptable excipients; said active ingredient comprising a compound containing non-natural amino acid fragments as described in the above technical solutions or a compound containing non-natural amino acid fragments prepared by the preparation method described in the above technical solutions.

[0016] The present invention also provides the use of the compounds containing non-natural amino acid fragments described in the above-described technical solutions, the compounds containing non-natural amino acid fragments prepared by the preparation method described in the above-described technical solutions, or the pharmaceutical compositions described in the above-described technical solutions in the preparation of HIV protease inhibitors.

[0017] The compound containing non-natural amino acid fragments provided by this invention can form hydrogen bonds, hydrophobic bonds, salt bridges, and other forms of van der Waals interactions with the active site of HIV-1 protease. The non-natural amino acid fragments, acting as extended chains, can bind to the P3 active cavity of the HIV protease, thereby significantly inhibiting HIV protease activity; and it also exhibits significant inhibitory activity against DRV-resistant strains. Toxicity studies show that the compound containing non-natural amino acid fragments provided by this invention has low toxicity and good drug-like properties, indicating that this type of compound has good application prospects as an anti-AIDS drug. As described in the test results of the examples, the R... b =H, containing non-natural amino acid fragments, exhibited 300-1000 times greater inhibitory activity against HIV-1 protease than the positive control drug DRV. Its inhibitory activity against DRV-resistant and wild-type HIV-1 resistant strains was reduced by 1-3 times, while the inhibitory activity of the positive control HIV-1 protease inhibitor and DRV against DRV-resistant and wild-type HIV-1 resistant strains was reduced by 16.7 times. b The non--H compound containing a non-natural amino acid fragment (prodrug) significantly reduced intestinal efflux in Caco-2 cell efflux assays, exhibiting favorable pharmacokinetic characteristics. This indicates that the compound containing a non-natural amino acid fragment provided by this invention has significant inhibitory activity against both wild-type HIV-1 resistant strains and highly resistant DRV strains, with low cytotoxicity. b Compounds containing non-natural amino acid fragments that are not -H exhibit good pharmacokinetic properties and good drug-likeness, and are expected to become a new HIV protease inhibitor.

[0018] The method for preparing compounds containing non-natural amino acid fragments provided by this invention is simple in steps, easy to operate, has a high yield, low production cost, and is suitable for industrial production. Detailed Implementation

[0019] This invention provides a compound containing non-natural amino acid fragments, having the structure shown in Formula I: Formula I.

[0020] In this invention, R in Formula I a include , , , , , , , or .

[0021] In this invention, R in Formula I b Package-H, , , , , , , , The residues are amino acid residues or dipeptide residues. In this invention, Ry1 and Ry3 independently comprise oxygen or sulfur. Ry2 and Ry4-Ry6 independently comprise C1-C8 alkyl, C2-C8 alkenyl, or C2-C9 alkynyl; the C1-C8 alkyl can have 1, 2, 3, 4, 5, 6, 7, or 8 carbons, and the C1-C8 alkyl can be a C1-C8 straight-chain alkyl or a C3-C8 branched alkyl; the C2-C8 alkenyl can have 2, 3, 4, 5, 6, 7, or 8 carbons, and the C2-C8 alkenyl can be a C2-C8 straight-chain alkenyl or a C3-C8 branched alkenyl; the C2-C9 alkynyl can have 2, 3, 4, 5, 6, 7, 8, or 9 carbons, and the C2-C9 alkynyl can be a C2-C9 straight-chain alkynyl or a C3-C8 branched alkynyl. In this invention, Ry7 comprises... , , , , , or In this invention, the amino acid residues may include... The dipeptide residues may include Among them, Ry8~Ry 10Independently, it can be an amino acid side chain group, which may include natural amino acid side chain groups or non-natural amino acid side chain groups; the amino acid residue may include D-valine (D-Val) or L-valine (L-Val); the dipeptide residue may include D-valine-L-valine (D-Val-L-Val), D-valine-D-valine (D-Val-D-Val), L-valine-D-valine (L-Val-D-Val), or L-valine-L-valine (L-Val-L-Val). In this invention, m1, m2, and o are independently integers from 1 to 3, specifically 1, 2, or 3. In this invention, R... b Specifically, it can include -H, , , , , , , or .

[0022] In this invention, R in Formula I c include , , , , , , , , , , , , or .

[0023] In this invention, R in Formula I includes , , or , where R x1 ~R x14Independently includes hydrogen, hydroxyl, methoxy, amino, halogen, C1-C8 alkyl, C3-C8 alkenyl, C3-C8 cycloalkenyl, C1-C8 alkoxy, C1-C8 alkoxyacyl, C2-C8 alkoxycycloalkyl, C3-C8 alkoxyalkenyl, or C3-C8 alkoxycycloalkenyl; X includes -CH2- or oxygen. In this invention, the halogen may include fluorine, chlorine, bromine, or iodine. In this invention, the number of carbon atoms in the C1-C8 alkyl, C1-C8 alkoxy, and C1-C8 alkoxyacyl groups may independently be 1, 2, 3, 4, 5, 6, 7, or 8. In this invention, the number of carbon atoms in the C3-C8 alkenyl, C3-C8 cycloalkenyl, C3-C8 alkoxyalkenyl, and C3-C8 alkoxycycloalkenyl groups may independently be 3, 4, 5, 6, 7, or 8. In this invention, the C1-C8 alkyl, C3-C8 alkenyl, C1-C8 alkoxy, C1-C8 alkoxyacyl and C3-C8 alkoxyalkenyl groups can be independently straight-chain or branched.

[0024] In this invention, the compound containing non-natural amino acid fragments may include the structure shown in any one of I-1 to I-15: , , , , , , , , , , , , , , .

[0025] Table 1 contains the substituents corresponding to each symbol in compounds I-1 to I-15 containing non-natural amino acid fragments.

[0026] The compound containing non-natural amino acid fragments provided by this invention has significant inhibitory activity against HIV protease and DRV drug-resistant strains. It is low in toxicity, has excellent drug-like properties, and has good application prospects as an anti-AIDS drug.

[0027] In this invention, when R bWhen =-H, the method for preparing the compound containing non-natural amino acid fragments includes the following steps: reacting compound A and amino derivative B with an amide catalyst in the presence of a substitution reaction to obtain R. b =H refers to compounds containing non-natural amino acid fragments; compound A includes compound A-1 or compound A-2; the reaction route is as follows: ; Wherein, Rx in compound A-1 includes , or Rx in R x1 ~R x14 The definition of R in Equation I x1 ~R x14 The definitions are the same.

[0028] Unless otherwise specified, the materials and equipment used in this invention are all commercially available products in the field.

[0029] In this invention, compound A-1 may include quinaldinic acid, 3-(3,4-dihydroxyphenyl)propionic acid, caffeic acid, 4-(hydroxyphenoxy)carboxylic acid, or 6-hydroxy-2-quinolinecarboxylic acid. This invention does not impose any particular limitation on the source of compound A-1; commercially available products or preparation methods well known to those skilled in the art can be used.

[0030] In this invention, the molar ratio of compound A and amino derivative B can be 1:0.8~1.2, or 1:0.9~1.15, specifically 1:0.95 or 1:1.12.

[0031] In this invention, the substitution reaction can be carried out under an amide catalyst, an organic solvent, and a protective atmosphere. Specifically, compound A, amino derivative B, and an organic solvent are mixed to obtain a mixture; the mixture is then mixed with an amide catalyst to carry out the substitution reaction.

[0032] In this invention, the amide catalyst may include one or more of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), 1-hydroxybenzotriazole (HOBt), 4-dimethylaminopyridine (DMAP), N,N'-dicyclohexylcarbodiimide (DCC), N,N'-diisopropylethylamine (DIEA), and triethylamine.

[0033] In this invention, when compound A is compound A-1, the amide catalyst may comprise a mixture of EDCI, HOBt, and DMAP, or a mixture of DCC and DIEA, or a mixture of DCC and triethylamine. In this invention, the molar ratio of EDCI, HOBt, and DMAP in the mixture may be 1.5~2.1:1.1~1.3:0.1~0.2, or 1.5~1.8:1.1~1.2:0.15~0.2, specifically 1.5:1.1:0.2. In this invention, the molar ratio of DCC and DIEA in the mixture may be 1.1~1.5:2~3, or 1.15~1.4:2.5~3, specifically 1.2:3. In this invention, the molar ratio of DCC to triethylamine in the mixture of DCC and triethylamine can be 1.1~1.5:2~3, or 1.1~1.3:2.5~2.8, specifically 1.1:2.5.

[0034] In this invention, when compound A is compound A-2, the amide catalyst may include one or more of triethanolamine, N,N'-diisopropylethylamine (DIEA), and triethylamine. In this invention, the molar ratio of compound A to the amide catalyst may be 1:1.2~2.5, or it may be 1:1.5~2.

[0035] In this invention, the organic solvent can be an anhydrous organic solvent; this invention does not have a special limitation on the type and amount of the organic solvent, and any solvent well known to those skilled in the art that can ensure the smooth progress of the substitution reaction can be used, such as one or more of dimethylformamide (DMF), dichloromethane, tetrahydrofuran (THF) and acetonitrile; the solid-liquid ratio of compound A to the organic solvent can be 1 mol: 15~20 L, or 1 mol: 16~19 L, or even 1 mol: 18~18.5 L.

[0036] In this invention, when compound A is compound A-1, the organic solvent may include one or more of dimethylformamide, dichloromethane, and tetrahydrofuran; the substitution reaction temperature may be room temperature (25~30℃); the substitution reaction time may be 90~120 min, or 100~110 min; the substitution reaction may be carried out under a protective atmosphere, which may include nitrogen, argon, or helium.

[0037] In this invention, when compound A is compound A-2, the organic solvent may include acetonitrile; the substitution reaction temperature may be room temperature (25~30℃); the substitution reaction time may be 8~10h, or 8.5~9.5h, or even 9h.

[0038] After completing the substitution reaction, the present invention may further include: concentrating the substitution reaction solution obtained from the substitution reaction and mixing it with water, extracting with ethyl acetate, drying the resulting organic phase with anhydrous sodium sulfate, filtering, concentrating the resulting liquid component, and purifying it by silica gel column chromatography to obtain a compound containing non-natural amino acid fragments. In the present invention, the eluent used for silica gel column chromatography purification may include a mixed solvent of ethyl acetate and petroleum ether; when the compound A is compound A-1, the volume ratio of ethyl acetate to petroleum ether may be 5:1 to 1:1, specifically 5:1, 3:1, or 1:1; when the compound A is compound A-2, the volume ratio of ethyl acetate to petroleum ether may be 50:1 to 2:1, specifically 50:1, 25:1, or 20:1; the silica gel column chromatography purification may be normal phase elution.

[0039] In this invention, the preparation method of compound A-2 includes the following steps: reacting a cyclic ether compound with p-nitrophenyl chloroformate via a substitution reaction to obtain compound A-2, the reaction route of which is as follows: In this invention, the molar ratio of the cyclic ether compound to p-nitrophenyl chloroformate can be 1:1.4~1.5, or it can be 1:1.45~1.5.

[0040] In this invention, the substitution reaction can be carried out in the presence of an organic solvent and a catalyst. In this invention, the organic solvent may include dichloromethane and / or N,N'-dimethylformamide. In this invention, the solid-liquid ratio of the cyclic ether compound to the organic solvent may be 1 mol: 5-10 L, or 1 mol: 6-8 L. In this invention, the catalyst may include triethylamine and / or N,N'-diisopropylethylamine. In this invention, the molar ratio of the cyclic ether compound to the catalyst may be 1:1.8-2.1, or 1:1.95-2.05, specifically 1:2.

[0041] In this invention, the temperature of the substitution reaction can be 25~30℃; the time of the substitution reaction can be 1.5~2h.

[0042] After the substitution reaction is completed, the present invention may further include: concentrating the substitution reaction solution obtained from the substitution reaction and mixing it with water, extracting with ethyl acetate, drying the resulting organic phase with anhydrous sodium sulfate and filtering, concentrating the resulting organic phase and purifying it by silica gel column chromatography to obtain compound A-2. The present invention does not have specific limitations on the method of the two concentrations; any concentration method well known to those skilled in the art can be used, such as vacuum distillation. In the present invention, the eluent used for silica gel column chromatography purification may include a mixture of petroleum ether and ethyl acetate, wherein the volume ratio of petroleum ether to ethyl acetate may be 10:1 to 1:1; the elution method for silica gel column chromatography purification may be normal phase elution.

[0043] In this invention, the preparation method of the amino derivative B may include the following steps: performing a condensation reaction between an amino compound and a non-natural amino acid fragment compound with a protecting group, followed by a deprotection reaction, to obtain amino derivative B; The structural formula of the amino compound is: ; The non-natural amino acid fragment compounds with protective groups include (Boc-Linker) or (Fmoc-Linker).

[0044] In this invention, the non-natural amino acid fragment compound with a protecting group may specifically include , , , , , , , or .

[0045] In this invention, the molar ratio of the amino compound and the non-natural amino acid fragment protected by Boc can be 9~10:7.5~8.4, or it can be 9.2~9.5:7.5~8.

[0046] In this invention, the condensation reaction may include: mixing an amino compound, a non-natural amino acid fragment compound with a protecting group, a catalyst, and an organic solvent, and carrying out the condensation reaction under a protective atmosphere.

[0047] In this invention, the catalyst may comprise a mixture of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), 1-hydroxybenzotriazole (HOBt), and 4-dimethylaminopyridine (DMAP), wherein the molar ratio of EDCI, HOBt, and DMAP in the mixture may be 13-14:8.8-11:1.5-2.0, or 13.5-13.8:9-10:1.7-1.9. In this invention, the molar ratio of the amino compound to the catalyst may be 9-10:22-23, or 9.2-9.5:22.3-22.6.

[0048] The present invention does not particularly limit the type and amount of the organic solvent. Any organic solvent known to those skilled in the art that can facilitate the condensation reaction can be used, such as dimethylformamide (DMF) and / or anhydrous tetrahydrofuran (THF).

[0049] In this invention, the protective atmosphere may include nitrogen, argon, or helium.

[0050] In this invention, the mixing may include: mixing an amino compound, a non-natural amino acid fragment with a Boc protecting group and an organic solvent, adding EDCI and HOBt in the presence of an ice bath and a protective gas, and then adding DMAP.

[0051] In this invention, the temperature of the condensation reaction can be 25~30℃; the condensation reaction time can be 2~5h, or even 3~4h; the reaction route of the condensation reaction is as follows: .

[0052] After the condensation reaction is completed, the present invention may further include: concentrating the condensation reaction solution obtained from the condensation reaction under reduced pressure to remove the organic solvent, mixing the residue with water, extracting with ethyl acetate, drying the obtained organic phase with anhydrous sodium sulfate, concentrating the dried organic phase, and purifying it by silica gel column chromatography to obtain a non-natural amino acid fragment compound with a protecting group. In the present invention, the eluent used for silica gel column chromatography purification can be a mixed solvent of ethyl acetate and petroleum ether, and the volume ratio of dichloromethane to methanol can be 1:10 to 1:1, specifically 1:10, 1:5, or 1:1; the elution method for silica gel column chromatography purification can be normal phase elution.

[0053] In this invention, the deprotection reaction may include: mixing a non-natural amino acid fragment compound with a protecting group, a deprotection reagent, and an organic solvent to carry out a deprotection reaction.

[0054] In this invention, when the protecting group in the non-natural amino acid fragment compound with the protecting group is -Boc, the deprotecting agent may include trifluoroacetic acid and / or hydrochloric acid; the solid-liquid ratio of the non-natural amino acid fragment compound with the protecting group to the deprotecting agent may be 8-10 mol: 9-10 L, or even 9 mol: 10 L; the organic solvent may include one or more of dichloromethane, methanol, and water; the solid-liquid ratio of the non-natural amino acid fragment compound with the protecting group to the organic solvent may be 8-10 mol: 9-10 L, or even 9 mol: 10 L; the temperature of the deprotection reaction may be 25-30°C, and the time of the deprotection reaction may be 2-3 h, or even 2-2.5 h; the reaction formula for the deprotection reaction is as follows: .

[0055] In this invention, when the protecting group in the non-natural amino acid fragment compound with the protecting group is -Fmoc, the deprotecting agent may include a 20wt% piperidine aqueous solution; the solid-liquid ratio of the non-natural amino acid fragment compound with the protecting group to the deprotecting agent may be 7~9 mol: 5~6 L, or 7~8 mol: 5~5.5 L; the organic solvent may include N,N-dimethylformamide (DMF) and / or dichloromethane (DCM); the solid-liquid ratio of the non-natural amino acid fragment compound with the protecting group to the organic solvent may be 7~9 mol: 9~10 L, or 7~8 mol: 10 L; the temperature of the deprotection reaction may be 25~30℃, and the time of the deprotection reaction may be 1~2 h, or 1.2~1.5 h; the reaction formula of the deprotection reaction is as follows: .

[0056] Following the deprotection reaction, the present invention may further include: concentrating the deprotected reaction solution to remove the organic solvent, mixing the resulting residue with saturated sodium bicarbonate solution, extracting with ethyl acetate, drying the resulting organic phase with anhydrous sodium sulfate, concentrating the dried organic phase, and purifying it by silica gel column chromatography to obtain amino derivative B. In this invention, the eluent used for silica gel column chromatography purification can be a mixed solvent of dichloromethane and methanol, wherein the volume ratio of dichloromethane to methanol can be 50:1 to 20:1, specifically 50:1, 30:1, or 20:1; and the elution method for silica gel column chromatography purification can be normal phase elution.

[0057] In this invention, the non-natural amino acid fragment compound with protecting groups, and The preparation method can be found in the literature (doi:10.1021 / acs.jmedchem.7b01709). , , and The preparation method can be found in the reference (doi: 10.1016 / S0040-4039(02)00448-3). , and All are commercially available products.

[0058] In this invention, the preparation method of the amino compound can be carried out with reference to the preparation method of amine compounds having the structures shown in formulas III-1, III-2 and III-3 in Chinese Patent CN 108558883A, and the reaction route is as follows: .

[0059] Will and A ring-opening reaction is carried out to obtain a first intermediate, which has the structure shown in formula (a): Equation (a); The first intermediate and A substitution reaction is carried out to obtain a second intermediate, which has the structure shown in formula (b): Equation (b); The second intermediate was subjected to a deprotection reaction to obtain an amino derivative having the structure shown in formula (c); Equation (c) In this invention, when R c for The preparation method of the amino compound may include the following steps: The amino compound B-1 was substituted with p-bromobenzenesulfonyl chloride to give amino compound B-2; The amino compound B-2 was subjected to a substitution reaction with pinacol to obtain amino compound B-3; The amino compound B-3 was subjected to a hydrolysis reaction to obtain amino compound B-4; The amino compound B-4 was subjected to a deprotection reaction to obtain the amino compound; the reaction route is as follows: .

[0060] In this invention, amino compound B-1 is subjected to a substitution reaction with p-bromobenzenesulfonyl chloride to obtain amino compound B-2.

[0061] In this invention, the substitution reaction can be carried out under a catalyst, an organic solvent, and a protective atmosphere. Specifically, the substitution reaction may include: mixing amino compound B-1, p-bromobenzenesulfonyl chloride, and an organic solvent, adding a catalyst under an ice bath and a protective atmosphere, and carrying out the substitution reaction.

[0062] In this invention, the molar ratio of the amino compound B-1 and p-bromobenzenesulfonyl chloride can be 1~1.2:1~1.5; or it can be 1~1.1:1~1.1.

[0063] In this invention, the catalyst may include N,N'-diisopropylethylamine (DIEA) and 1-hydroxybenzotriazole (DMAP), wherein the molar ratio of DIEA to DMAP may be 1~2:0.1~0.2; or 1~1.5:0.1~0.15. In this invention, the molar ratio of amino compound B-1 to the catalyst in substitution reaction 1 may be 1~1.2:1~1.2; or 1~1.1:1~1.1.

[0064] The present invention does not have any particular limitation on the type and amount of the organic solvent. Any organic solvent that can facilitate the substitution reaction can be used, which is well known to those skilled in the art. Specifically, one or more of dimethylformamide (DMF), anhydrous dichloromethane (DCM), and anhydrous tetrahydrofuran (THF) can be used.

[0065] In this invention, the protective atmosphere may include nitrogen, argon, or helium.

[0066] In this invention, the temperature of the substitution reaction can be 25~30℃; the time of the substitution reaction can be 1~2h, or even 1~1.5h.

[0067] After completing the substitution reaction, the present invention may further include: concentrating the substitution reaction solution obtained from the substitution reaction under reduced pressure to remove the organic solvent, mixing the residue with water, extracting with ethyl acetate, drying the obtained organic phase with anhydrous sodium sulfate, concentrating the dried organic phase, and purifying it by silica gel column chromatography to obtain the amino compound B-2. In the present invention, the eluent used for the silica gel column chromatography purification can be a mixed solvent of ethyl acetate and n-hexane, wherein the volume ratio of ethyl acetate to n-hexane can be 1:6 to 1:1, specifically 1:6, 1:3, or 1:1; and the elution method for the silica gel column chromatography purification can be normal phase elution.

[0068] After obtaining amino compound B-2, the present invention performs a substitution reaction between amino compound B-2 and pinacol to obtain amino compound B-3.

[0069] In this invention, the substitution reaction can be carried out under a catalyst, an organic solvent, and a protective atmosphere. Specifically, the substitution reaction may include: mixing the amino compound B-2 and pinacol with an organic solvent, adding a catalyst under an ice bath and a protective atmosphere, and carrying out the substitution reaction.

[0070] In this invention, the molar ratio of the amino compound B-2 and pinacol diboronic acid ester can be 1~1.2:3~3.5, or it can be 1~1.1:3.1~3.2.

[0071] In this invention, the catalyst may comprise potassium acetate and Pd(dppf)Cl2-CH2Cl2, wherein the molar ratio of potassium acetate to Pd(dppf)Cl2-CH2Cl2 may be 3~3.2:0.1~0.2, or may be 3~3.1:0.1~0.15. In this invention, the molar ratio of the amino compound B-2 to the catalyst may be 1~1.2:1~1.2; or may be 1~1.1:1~1.1.

[0072] The present invention does not have any particular limitation on the type and amount of the organic solvent. Any organic solvent that can facilitate the substitution reaction can be used, which is well known to those skilled in the art. Specifically, one or more of dimethylformamide (DMF), anhydrous dichloromethane (DCM), and anhydrous 1,4-dioxane (THF) can be used.

[0073] In this invention, the protective atmosphere may include nitrogen, argon, or helium.

[0074] In this invention, the temperature of the substitution reaction can be 90~100℃ or 92~95℃; the time of the substitution reaction can be 8~12h or 9~10h.

[0075] After completing the substitution reaction, the present invention may further include: filtering the substitution reaction solution obtained from the substitution reaction through diatomaceous earth, concentrating under reduced pressure to remove the organic solvent, mixing the residue with water, extracting with ethyl acetate, drying the resulting organic phase with anhydrous sodium sulfate, concentrating the dried organic phase, and purifying it by silica gel column chromatography to obtain the amino compound B-3. In the present invention, the eluent used for the silica gel column chromatography purification can be a mixed solvent of ethyl acetate and petroleum ether, and the volume ratio of ethyl acetate to petroleum ether can be 1:5 to 1:1, specifically 1:5, 1:3, or 1:1; the elution method for the silica gel column chromatography purification can be normal phase elution.

[0076] After obtaining amino compound B-3, the present invention performs a hydrolysis reaction on amino compound B-3 to obtain amino compound B-4.

[0077] In this invention, the hydrolysis may include: mixing the amino compound B-3 with a solvent, adding a catalyst under ice bath and protective atmosphere conditions, and carrying out the hydrolysis reaction.

[0078] In this invention, the catalyst may comprise sodium periodate and ammonium acetate, wherein the molar ratio of sodium periodate to ammonium acetate may be 1~2:1~2; or it may be 1~1.5:1~1.5. In this invention, the molar ratio of the amino compound B-3 to the catalyst may be 1~1.2:4~4.2; or it may be 1~1.1:4~4.1.

[0079] The present invention does not have any particular limitation on the type and amount of the solvent. Any solvent known to those skilled in the art that can facilitate the hydrolysis reaction can be used, such as a mixed solvent of acetone and water or a mixed solvent of ethanol and water.

[0080] In this invention, the protective atmosphere may include nitrogen, argon, or helium.

[0081] In this invention, the temperature of the hydrolysis reaction can be 25~30℃; the hydrolysis time can be 10~12h, or even 11h.

[0082] After the hydrolysis reaction is completed, the present invention may further include: concentrating the hydrolysis reaction solution obtained from the hydrolysis reaction under reduced pressure to remove the organic solvent, mixing the residue with water, extracting with ethyl acetate, drying the obtained organic phase with anhydrous sodium sulfate, and concentrating the dried organic phase to constant weight to obtain amino compound B-4.

[0083] After obtaining amino compound B-4, the present invention performs a deprotection reaction on amino compound B-4 to obtain the amino compound.

[0084] In this invention, the deprotection reaction can be carried out under the conditions of deprotection reagent and organic solvent. Specifically, the deprotection reaction may include: mixing the amino compound B-4 with an organic solvent, adding the deprotection reagent under ice bath conditions, and carrying out the deprotection reaction.

[0085] In this invention, the deprotecting agent may include trifluoroacetic acid; the molar ratio of the amino compound B-4 and the deprotecting agent may be 1~1.2:18.2~20, or 1~1.1:19~20.

[0086] The present invention does not have any particular limitation on the type and amount of the solvent. Any solvent known to those skilled in the art that can facilitate the deprotection reaction can be used, such as dimethylformamide (DMF) and / or anhydrous dichloromethane (DCM).

[0087] In this invention, the deprotection temperature can be 25~30℃; the deprotection time can be 1~2h, or even 1~1.5h.

[0088] After completing the deprotection reaction, the present invention may further include: concentrating the deprotected reaction solution obtained from the deprotection reaction under reduced pressure to remove the organic solvent; mixing the residue with saturated sodium bicarbonate solution; extracting with ethyl acetate; drying the obtained organic phase with anhydrous sodium sulfate; concentrating the dried organic phase; and purifying it by silica gel column chromatography to obtain the amino compound. In the present invention, the eluent used for silica gel column chromatography purification can be a mixed solvent of ethyl acetate and petroleum ether, and the volume ratio of ethyl acetate to petroleum ether can be 50:1 to 20:1, specifically 50:1, 30:1, or 20:1; the elution method for silica gel column chromatography purification can be normal phase elution.

[0089] In this invention, when R c for , , , , , or The preparation method of the amino compound may include the following steps: The amino compound B-1 was substituted with 2-(methylthio)benzo[d]thiazol-6-sulfonyl chloride to give the amino compound B-5. The amino compound B-5 was oxidized in the presence of an oxidizing catalyst to obtain an oxidation intermediate. The oxidation intermediate was reacted with NH2-R O A substitution reaction was carried out to give amino compound B-6; the NH2-R O Chinese R O Including methyl, cyclopropyl, isopropyl, isobutyl, or formate groups; The amino compound B-6 was subjected to a deprotection reaction to obtain the amino compound; the reaction route is as follows: .

[0090] In this invention, amino compound B-1 is subjected to a substitution reaction with 2-(methylthio)benzo[d]thiazol-6-sulfonyl chloride to obtain amino compound B-5. In this invention, the preparation conditions for amino compound B-5 are the same as those for the preparation conditions for amino compound B-2 prepared by the substitution reaction of amino compound B-1 with p-bromobenzenesulfonyl chloride, and will not be repeated here.

[0091] After obtaining amino compound B-5, the present invention oxidizes amino compound B-5 under an oxidizing catalyst to obtain an oxidizing intermediate.

[0092] In this invention, the oxidation catalyst may include m-chloroperoxybenzoic acid. In this invention, the molar ratio of the amino compound B-5 to the oxidation catalyst may be 1:3 to 5, or 1:3.5 to 4.5, or even 1:4.

[0093] In this invention, the oxidation reaction can be carried out under organic solvent conditions, and the organic solvent may include dichloromethane and / or tetrahydrofuran.

[0094] In this invention, the temperature of the oxidation reaction can be 25~30℃, and the time of the oxidation reaction can be 6~10h, 7~9h, or even 8~9h.

[0095] After the oxidation reaction is completed, the present invention may further include: removing the solvent from the oxidation reaction solution obtained by the oxidation reaction under reduced pressure by distillation, diluting with ethyl acetate, washing with water and saturated sodium bicarbonate respectively, drying with anhydrous sodium sulfate and filtering, and removing the solvent from the obtained liquid component by distillation under reduced pressure to obtain an oxidation intermediate.

[0096] After obtaining the oxidation intermediate, the present invention reacts the oxidation intermediate with NH2-R o A substitution reaction was carried out to give amino compound B-6; the NH2-R O Chinese R O Including methyl, cyclopropyl, isopropyl, isobutyl or formate groups.

[0097] In this invention, the oxidizing intermediate and NH2-R o The molar ratio can be 1:1.2~1.4, or even 1:1.3.

[0098] In this invention, the substitution reaction can be carried out under organic solvent conditions, which may include anhydrous tetrahydrofuran and / or anhydrous N,N'-dimethylformamide. This invention does not have a particular limitation on the amount of the organic solvent used, as long as it allows the substitution reaction to proceed smoothly.

[0099] In this invention, the temperature of the substitution reaction can be 70~80℃, or 72~75℃; the time of the substitution reaction can be 8~10h, or 8.5~9.5h, or even 9h.

[0100] After the substitution reaction is completed, the present invention may further include: removing the solvent from the substitution reaction solution obtained by vacuum distillation, diluting with ethyl acetate, washing with water and saturated sodium chloride solution respectively, drying with anhydrous sodium sulfate, filtering, removing the solvent by vacuum distillation, and purifying by silica gel column chromatography to obtain the amino compound B-6. In the present invention, the eluent used for silica gel column chromatography purification can be a mixed solvent of dichloromethane and methanol, and the volume ratio of dichloromethane to methanol can be 50:1 to 10:1, or 30:1 to 20:1.

[0101] After obtaining amino compound B-6, the present invention subjectes amino compound B-6 to a deprotection reaction to obtain an amino compound. In the present invention, the conditions for the deprotection reaction are the same as those for the aforementioned deprotection reaction of amino compound B-4, and will not be repeated here.

[0102] In this invention, when R c for or The preparation method of the amino compound may include the following steps: The amino compound B-1 was subjected to a substitution reaction with 3-chloro-4-aminobenzenesulfonyl chloride to obtain the amino compound B-7. The amino compound B-7 was subjected to a substitution reaction with isoselenic cyanide to obtain amino compound B-8; the isoselenic cyanide was R. p -N=C=Se, where R p Including methyl or cyclopropyl; The amino compound B-8 was deprotected to yield an amino compound with the structure of formula g; the reaction route is as follows: .

[0103] In this invention, amino compound B-1 is subjected to a substitution reaction with 3-chloro-4-aminobenzenesulfonyl chloride to obtain amino compound B-7. The preparation conditions for amino compound B-7 are the same as those for amino compound B-2 prepared by the substitution reaction of amino compound B-1 with p-bromobenzenesulfonyl chloride, and will not be repeated here.

[0104] After obtaining amino compound B-7, the present invention performs a substitution reaction between amino compound B-7 and isoselenic cyanide to obtain amino compound B-8; wherein the isoselenic cyanide is R p -N=C=Se, where R p Including methyl or cyclopropyl.

[0105] In this invention, the molar ratio of the amino compound B-7 to isoselenyanide can be 1:1.2~1.5, or it can be 1:1.3~1.4.

[0106] In this invention, the method for synthesizing the isoselencyanide is referenced in: Hajime Maeda, et al. One-pot synthesis of selenoureas and selenocarbamates via selenation of isocyanates with bis(dimethylaluminum) selenide [J]. 2011, 52, 415-417. In this invention, the substitution reaction can be carried out under organic solvent conditions, wherein the organic solvent may include anhydrous N,N'-dimethylformamide and / or anhydrous tetrahydrofuran. In this invention, the temperature of the substitution reaction can be 80-90°C, or even 82-85°C; the time of the substitution reaction can be 8-10 h, or even 8.5-9.5 h, or further, 9 h.

[0107] After the substitution reaction is completed, the present invention may further include: removing the solvent from the substitution reaction solution by vacuum distillation, diluting with ethyl acetate, washing with water and saturated sodium chloride solution respectively, drying with anhydrous sodium sulfate, filtering, removing the solvent by vacuum distillation, and purifying by silica gel column chromatography to obtain the amino compound B-8. In the present invention, the eluent used for silica gel column chromatography purification may include a mixed solvent of dichloromethane and methanol, wherein the volume ratio of dichloromethane to methanol may be 50:1 to 10:1, or 30:1 to 20:1.

[0108] After obtaining amino compound B-8, the present invention performs a deprotection reaction on amino compound B-8 to obtain the amino compound. In the present invention, the conditions for the deprotection reaction are the same as those for the deprotection reaction of amino compound B-4 described above, and will not be repeated here.

[0109] In this invention, when R b for , , , , , , or The method for preparing the compound containing non-natural amino acid fragments includes the following steps: R... b =-H contains non-natural amino acid fragments and R b -X' undergoes a condensation reaction to obtain the compound containing the non-natural amino acid fragment; the R b In -X', X' represents a halogen.

[0110] In this invention, the R b=-H contains non-natural amino acid fragments and R b The molar ratio of -X' can be 1:1 to 1.4, or 1:1.1 to 1.3, specifically 1:1.2. In this invention, the halogen can include fluorine, chlorine, bromine, or iodine.

[0111] In this invention, the substitution reaction can be carried out under a catalyst, an organic solvent, and a protective atmosphere. Specifically, R... b =-H contains non-natural amino acid fragments, R b -X', catalyst, and organic solvent are mixed and a condensation reaction is carried out under a protective atmosphere. In this invention, the mixing may include: R b =-H contains non-natural amino acid fragments, R b -X' and organic solvent are mixed, and the catalyst is added and mixed under an ice bath and protective atmosphere.

[0112] In this invention, the catalyst may include N,N'-dicyclohexylcarbodiimide (DCC) and triethylamine (TEA). In this invention, the molar ratio of DCC to TEA may be 1.4~1.6:3~5, or 1.45~1.5:3.2~4, specifically 1.5:3.5.

[0113] In this invention, the protective atmosphere may include nitrogen, argon, or helium.

[0114] The present invention does not have any particular limitation on the type and amount of the solvent. Any solvent known to those skilled in the art that can facilitate the substitution reaction can be used, such as anhydrous dimethylformamide (DMF) and / or anhydrous dichloromethane (DCM).

[0115] In this invention, the temperature of the substitution reaction can be 25~30℃; the time of the substitution reaction can be 2~4h, or even 3h; the reaction route of the substitution reaction is as follows: .

[0116] After completing the substitution reaction, the present invention may further include: removing the solvent from the substitution reaction solution under reduced pressure by distillation, mixing the residue with water, extracting with dichloromethane, drying the resulting organic phase with anhydrous sodium sulfate and filtering, concentrating the resulting organic phase and purifying it by silica gel column chromatography to obtain a compound containing non-natural amino acid fragments. In the present invention, the eluent used for silica gel column chromatography purification may include a mixed solvent of petroleum ether and ethyl acetate, wherein the volume ratio of petroleum ether to ethyl acetate may be 5:1 to 1:1, specifically 5:1, 3:1 or 1:1; the elution method for silica gel column chromatography purification may be normal phase elution.

[0117] In this invention, when Rb When the residue is an amino acid residue or a dipeptide residue, the method for preparing the compound containing the non-natural amino acid fragment includes the following steps: R b =H contains a non-natural amino acid fragment compound that undergoes a condensation reaction with a Boc-protected amino acid or a Boc-protected dipeptide, followed by a deprotection reaction to obtain the non-natural amino acid fragment compound.

[0118] In this invention, when R b or At that time, the Boc-protected amino acids include The Boc-protected dipeptide includes The reaction route is as follows: .

[0119] In this invention, the condensation reaction can be carried out under a catalyst, an organic solvent, and a protective atmosphere. Specifically, R... b =-H compounds containing non-natural amino acid fragments, Boc-protected amino acids or Boc-protected dipeptides, catalysts, and organic solvents are mixed to carry out a condensation reaction. In this invention, the mixing may include: R b =-H compounds containing non-natural amino acid fragments, Boc-protected amino acids, or Boc-protected dipeptides are mixed with organic solvents, and a catalyst is added and mixed under an ice bath and a protective atmosphere.

[0120] In this invention, the catalyst may comprise a mixture of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI), 1-hydroxybenzotriazole (HOBt), and 4-dimethylaminopyridine (DMAP); the molar ratio of EDCI, HOBt, and DMAP may be 1.5~2:1.1~1.5:0.1~0.2, or 1.5~1.8:1.1~1.3:0.1~0.15, specifically 1.5:1.1:0.1. In this invention, the R... b The molar ratio of the compound containing non-natural amino acid fragments and the catalyst in the =-H group can be 1:1~2, or 1:1.1~1.5, or even 1:1.1~1.2.

[0121] In this invention, the organic solvent can be an anhydrous organic solvent; this invention does not have any special limitation on the type and amount of the organic solvent, and any solvent known to those skilled in the art that can ensure the smooth progress of the condensation reaction can be used, such as anhydrous dimethylformamide (DMF) and / or anhydrous dichloromethane (DCM).

[0122] In this invention, the protective gas may include nitrogen, argon, or helium.

[0123] In this invention, the temperature of the condensation reaction can be 25~30℃, and the time of the condensation reaction can be 2~4h, or even 3h.

[0124] After the condensation reaction is completed, the present invention may further include: removing the solvent from the condensation reaction solution under reduced pressure by distillation, mixing the residue with water, extracting with dichloromethane, drying the resulting organic phase with anhydrous sodium sulfate and filtering, concentrating the resulting organic phase and purifying it by silica gel column chromatography to obtain a compound containing Boc and non-natural amino acid fragments. In the present invention, the eluent used for silica gel column chromatography purification may include a mixed solvent of petroleum ether and ethyl acetate, wherein the volume ratio of petroleum ether to ethyl acetate may be 5:1 to 1:1, specifically 5:1, 3:1 or 1:1; the elution method for silica gel column chromatography purification may be normal phase elution.

[0125] In this invention, the deprotection reaction can be carried out under the conditions of organic solvent and deprotection reagent. Specifically, the Boc-containing fragment containing non-natural amino acids obtained from the condensation reaction, the deprotection reagent, and the organic solvent are mixed to carry out the deprotection reaction.

[0126] In this invention, the deprotecting agent may include trifluoroacetic acid and / or hydrochloric acid. In this invention, the solid-liquid ratio of the Boc-containing non-natural amino acid fragment and the deprotecting agent may be 8-10 mol: 9-10 L, or even 9 mol: 10 L.

[0127] In this invention, the organic solvent may include one or more of dichloromethane, methanol, and water. In this invention, the solid-liquid ratio of the Boc-containing compound (containing non-natural amino acid fragments) and the organic solvent may be 8-10 mol: 9-10 L, or it may be 9 mol: 10 L.

[0128] In this invention, the temperature of the deprotection reaction can be 25~30℃; the time of the deprotection reaction can be 2~3h, or even 2~2.5h.

[0129] Following the deprotection reaction, the present invention may further include: concentrating the deprotected reaction solution to remove the organic solvent, mixing the resulting residue with saturated sodium bicarbonate solution, extracting with ethyl acetate, drying the resulting organic phase with anhydrous sodium sulfate, and purifying the dried organic phase by silica gel column chromatography to obtain fragments containing non-natural amino acids. In this invention, the eluent used for silica gel column chromatography purification can be a mixed solvent of dichloromethane and methanol, wherein the volume ratio of dichloromethane to methanol can be 50:1 to 20:1, specifically 50:1, 30:1, or 20:1; and the elution method for silica gel column chromatography purification can be normal phase elution.

[0130] This invention also provides a pharmaceutical composition comprising an active ingredient and pharmaceutically acceptable excipients, wherein the active ingredient comprises the compound containing non-natural amino acid fragments described in the above-described technical solution. This invention does not specifically limit the pharmaceutically acceptable excipients; any pharmaceutically acceptable excipient well known to those skilled in the art can be used. This invention does not specifically limit the dosage form of the pharmaceutical composition; any pharmaceutical dosage form well known to those skilled in the art can be used. In this invention, the mass content of the benzo[a]heterocyclic sulfonamide compound in the pharmaceutical composition can be 0.1% to 90%, can be 5% to 50%, and can further be 10% to 30%.

[0131] This invention provides the use of the compounds containing non-natural amino acid fragments or the pharmaceutical compositions described in the above-described technical solutions in the preparation of HIV protease inhibitors.

[0132] In this invention, the HIV protease inhibitor can target HIV-1 protease.

[0133] The compound containing non-natural amino acid fragments provided by this invention has significant inhibitory activity against HIV-1 protease, wild-type HIV-1 drug-resistant strains and highly drug-resistant DRV strains, and has low cytotoxicity, showing good application prospects.

[0134] To further illustrate the present invention, the following detailed descriptions, in conjunction with embodiments, illustrate the compounds containing non-natural amino acid fragments, their preparation methods and applications, and pharmaceutical compositions and their applications provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0135] Example 1 (1) Synthesis of N-((2R,3R)-2-hydroxy-3-amino-4-phenylbutane)-N-isobutyl-4-methoxybenzenesulfonamide (compound 1a) Compound 1a was prepared according to the method for preparing amine derivatives having the structure shown in Formula III-1 disclosed in CN108558883A. The LC-MS (ESI, M+H) analysis of compound 1a was performed. + ) m / z 393.3.

[0136] (2) Synthesis of (S)-2-((tert-butoxycarbonyl)amino)-2-((R)-tetrahydrofuran-3-yl)acetic acid (compound 2a) Reference: Hidaka K, Kimura T, Sankaranarayanan R, et al. J Med Chem. 2018;61(12):5138-5153 reported the method for synthesizing compound 2a, and the LC-MS (ESI, M+H) analysis of compound 2a. +)m / z256.3.

[0137] (3) Synthesis of tert-butyl((S)-2-(((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamide)-1-phenylbut-2-yl)amino)-2-oxo-1-((R)-tetrahydrofuran-3-yl)ethyl)carbamate (compound 3a) Compound 1a (4.0 mmol) and compound 2a (3.8 mmol) were dissolved in 20 mL of anhydrous DMF. The mixture was stirred in an ice bath, and under argon protection, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI, 7.00 mmol) and 1-hydroxybenzotriazole (HOBt, 5.0 mmol) were slowly added. The reaction was carried out at 0 °C for 10 min, then at room temperature for 1 h. Subsequently, 4-dimethylaminopyridine (DMAP, 1.00 mmol) was added, and the reaction continued for 2 h. The solvent was removed from the resulting system under reduced pressure, 50 mL of water was added, and the mixture was extracted three times with ethyl acetate (50 mL each time). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to constant weight. The concentrate was purified by silica gel column chromatography (petroleum ether to ethyl acetate mass ratio 1:3~1:4) to give compound 3a (white solid, 2.26 g, yield 96.2%). Structural data of compound 3a: LC-MS (ESI, M+H) + ) m / z 619.3.

[0138] (4) Synthesis of (S)-2-amino-N-((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamido)-1-phenylbut-2-yl)-2-((R)-tetrahydrofuran-3-yl)acetamide (amino derivative II-1a) Compound 3a (3.65 mmol) was dissolved in 10 mL of dichloromethane, and trifluoroacetic acid (8 mL) was slowly added at room temperature with stirring for 3 h. After the reaction was complete, the organic solvent was removed by vacuum distillation, and the mixture was dissolved in 50 mL of ethyl acetate, washed three times with 50 mL of saturated sodium bicarbonate, and evaporated to dryness to give the amino derivative compound II-1a (white solid, 1.77 g, yield 93.6%). Structural data of amino derivative II-1a: LC-MS (ESI, M+H) + ) m / z 519.3.

[0139] (5) Synthesis of (3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl-4-(nitrophenyl)carbonic acid (compound 4) Compound 4 was synthesized according to the methods reported in the literature GhoshAK, SridharPR, Leshchenko S, et al. J Med Chem, 2006, 49, 5252-5261 and GhoshAK, Rao KV, Nyalapatal PR, et al. J Med Chem, 2017, 60, 4267-4278. The LC-MS (ESI, M+H) of compound 4 was analyzed. + ) m / z 296.3.

[0140] (6) Synthesis of (3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl((S)-2-(((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamido)-1-phenylbut-2-yl)amino)-2-oxo-1-((R)-tetrahydrofuran-3-yl)ethyl)carbamate (compound I-1) Compound 4 (0.15 mmol) and amino derivative II-1a (0.18 mmol) were dissolved in 5 mL of acetonitrile. Triethylamine (0.1 mL, 0.74 mmol) was slowly added at room temperature, and the mixture was stirred for 2 h. After the reaction was complete, the solvent was removed from the resulting system under reduced pressure, 50 mL of water was added, and the mixture was extracted three times with ethyl acetate (50 mL each time). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to constant weight. The concentrate was purified by silica gel column chromatography (petroleum ether to ethyl acetate mass ratio of 1:3 to 1:4) to give compound I-1 (white solid, 0.09 g, yield 97.1%).

[0141] Structural data of compound I-1: LC-MS (ESI, M+H) + ) m / z 619.3.

[0142] 1 H NMR (500 MHz, Chloroform- d ) d 8.25 (s, 1H), 7.60 - 7.54 (m, 2H), 7.29 - 7.17 (m, 6H), 6.92 - 6.86 (m, 2H), 6.11 (d, J = 8.9 Hz, 1H), 5.22 (d, J =4.2 Hz, 1H), 4.99 (td, J = 4.5, 3.3 Hz, 1H), 4.44 (dd, J= 9.1, 5.6 Hz, 1H), 4.33(dd, J = 11.5, 4.4 Hz, 1H), 4.09 - 4.00 (m, 1H), 4.04 - 3.96 (m, 1H), 3.94 -3.76 (m, 5H), 3.76 - 3.65 (m, 2H), 3.53 (d, J = 6.1 Hz, 1H), 3.20 (dd, J = 9.8,4.9 Hz, 1H), 3.06 - 2.98 (m, 2H), 2.99 - 2.89 (m, 2H), 2.82 (dd, J = 9.3, 5.3Hz, 1H), 2.55 - 2.42 (m, 2H), 2.10 - 1.97 (m, 2H), 1.99 - 1.81 (m, 3H), 0.80(dd, J = 25.0, 6.9 Hz, 6H).

[0143] 13 C NMR (151MHz Chloroform- d ): d 173.0, 162.5, 156.3, 137.5, 132.6, 130.2, 129.3, 129.1, 127.3, 115.9, 108.7, 74.8, 71.5, 71.3, 69.7, 69.1, 66.6, 56.8, 55.3, 54.7, 52.2, 44.1, 41.9, 36.4, 28.3, 27.0, 26.6, 17.7.

[0144] Example 2 (1) Synthesis of N-(2R,3S / -3-amino-2-hydroxy-4-phenylbutyl)-4-bromo-N-isobutylbenzenesulfonamide (compound 5) Compound 5 was prepared according to the method for preparing amine derivatives having the structure shown in Formula III-1 disclosed in CN 108558883 A. The LC-MS (ESI, M+H) analysis of compound 5 was performed. + ) m / z 455.3.

[0145] (2) Synthesis of N-((2R,3S)-3-amino-2-hydroxy-4-phenylbutyl)-N-isobutyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborhexacyclopentan-2-yl)benzenesulfonamide (compound 6) Compound 5 (1.0 mmol), pinacol diboronate (3.0 mmol), potassium acetate (3.0 mmol), and Pd(dppf)Cl2-CH2Cl2 (0.1 mmol) were dissolved in 15 mL of anhydrous 1,4-dioxane. The mixture was heated to 90 °C under argon protection and stirred for 2 h. The resulting system was filtered through diatomaceous earth, and the filtrate was collected. The solvent was removed by vacuum distillation, and 50 mL of water was added. The mixture was then extracted three times with ethyl acetate (50 mL each time). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to constant weight. The concentrate was purified by silica gel column chromatography (petroleum ether to ethyl acetate mass ratio 1:3~1:4) to give compound 6 (white solid, 0.47 g, yield 93.6%). Structural data of compound 6: LC-MS (ESI, M+H) + ) m / z 503.3.

[0146] (3) Synthesis of (4-(N-((2R,3S)-3-amino-2-hydroxy-4-phenylbutyl)-N-isobutylsulfonamide)phenyl)boronic acid (compound 1b) Compound 6 (0.7 mmol) was dissolved in an acetone-water mixture (volume ratio = 2:1), and sodium periodate (2.8 mmol) and ammonium acetate (2.8 mmol) were added sequentially. The mixture was stirred at room temperature for 12 h until the reaction was complete. The solvent was removed from the resulting system under reduced pressure, 50 mL of water was added, and the mixture was extracted three times with ethyl acetate (50 mL each time). The combined organic phases were dried over anhydrous sodium sulfate, filtered to remove impurities, and the organic phase was concentrated to constant weight to give compound 1b (white solid, 0.22 g, yield 74.6%). Structural data of compound 1b: LC-MS (ESI, M+H) + ) m / z 421.3.

[0147] (4) Synthesis of (4-(N-((2R,3S)-3-amino-2-hydroxy-4-phenylbutyl)-N-isobutylsulfonamide)phenyl)boronic acid (amino derivative II-1b) The amino derivative II-1a was prepared according to the preparation method of steps (3) and (4) in Example 1, except that compound 1a was replaced with compound 1b to obtain amino derivative II-1b (white solid powder, 0.23 g, yield 85.2%). Structural data of amino derivative II-1b: LC-MS (ESI, M+H) + ) m / z 548.3.

[0148] (5) Synthesis of (4-(N-((2R,3S)-3-((S)-2-(((((3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl)oxy)carbonyl)amino)-2-((R)-tetrahydrofuran-3-yl)acetamyl)-2-hydroxy-4-phenylbutyl)-N-isobutylaminosulfonyl)phenylboronic acid (compound II-2) The compound I-1 was prepared according to the preparation method of compound I-1 in step (6) of Example 1. The only difference from Example 1 is that compound II-1a was replaced with compound II-1b to obtain compound II-2 (white solid powder, 0.12g, yield 95.3%).

[0149] Structural data of compound II-2: LC-MS (ESI, M+H) + ) m / z 704.3.

[0150] 1 H NMR (500 MHz, Chloroform- d ): d 7.83 - 7.77 (m, 2H), 7.74 - 7.67 (m,2H), 7.31 - 7.20 (m, 5H), 6.77 (d, J = 8.8 Hz, 1H), 5.98 (d, J = 9.0 Hz, 1H), 5.10 (d, J = 4.3 Hz, 1H), 5.01 - 4.92 (m, 3H), 4.70 (dd, J = 9.1, 5.6 Hz, 1H), 4.18 (dd, J = 11.5, 4.2 Hz, 1H), 4.00 - 3.88 (m, 3H), 3.88 - 3.76 (m, 2H), 3.75(dd, J = 10.6, 4.9 Hz, 1H), 3.72 - 3.58 (m, 3H), 3.35 (d, J = 6.5 Hz, 1H), 3.14 -3.05 (m, 2H), 2.91 (dd, J = 9.3, 5.3 Hz, 1H), 2.86 - 2.77 (m, 2H), 2.66 (dd, J =9.3, 5.3 Hz, 1H), 2.50 (dddd, J= 8.9, 5.5, 4.9, 4.0 Hz, 1H), 2.23 - 2.14 (m,1H), 2.18 - 2.08 (m, 2H), 1.98 - 1.83 (m, 3H), 0.83 (dd, J = 24.9, 6.9 Hz, 6H).

[0151] 13 C NMR (125 MHz, Chloroform- d ) d 172.8, 155.9, 139.5, 137.6, 135.2, 133.6, 132.1, 128.9, 127.3, 127.2, 107.2, 75.0, 71.3, 71.1, 69.6, 69.1, 66.5, 56.6, 55.4, 54.8, 52.3, 44.1, 41.8, 36.7, 28.3, 26.9, 26.6, 20.4.

[0152] Example 3 (1) Synthesis of N-((2R,3S)-3-amino-2-hydroxy-4-phenylbutyl)-2-(cyclopropylamino)-N-isobutylbenzo[d]thiazole-6-sulfonamide (compound 1c) Compound 1c was prepared according to the method for preparing amine derivatives having the structure shown in Formula III-1 disclosed in CN 108558883 A. The LC-MS (ESI, M+H) analysis of compound 1c was performed. + ) m / z 489.3.

[0153] (2) Synthesis of (S)-2-amino-N-[(2S,3R)-4-[(2-(cyclopropylamino)-N-isobutylbenzo[d]thiazole)-6-sulfonamido]-3-hydroxy-1-phenylbutane-2-yl]-2-[(R)-tetrahydrofuran-2-yl]acetamide (amino derivative II-1c) The preparation of compound II-1a was carried out according to the preparation method of steps (3) and (4) in Example 1, except that compound 1a was replaced with compound 1c to obtain amino derivative II-1c (white solid powder, 0.22 g, yield 88.2%). Structural data of amino derivative II-1c: LC-MS (ESI, M+H) + ) m / z 616.3.

[0154] (3) Synthesis of (3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl((S)-2-(((2S,3R)-4-((2-(cyclopropylamino)-N-isobutylbenzo[d]thiazole)-6-sulfonamido)-3-hydroxy-1-phenyl-2-butyl)amino)-2-oxo-1-((R)-tetrahydrofuran-3-yl)ethyl)carbamate (compound I-3) Compound I-1 was prepared according to the preparation method of compound I-1 in step (6) of Example 1. The difference from Example 1 is that the amino derivative II-1a was replaced with amino derivative II-1c to obtain compound I-3 (white solid powder, 0.10 g, yield 90.1%).

[0155] Structural data of compound I-3: LC-MS (ESI, M+H) + ) m / z 772.3.

[0156] 1 H NMR (500 MHz, Chloroform- d ): d 8.40 (d, J = 1.8 Hz, 1H), 7.98 - 7.88(m, 2H), 7.29 - 7.18 (m, 6H), 7.22 - 7.12 (m, 1H), 5.99 (d, J = 9.1 Hz, 1H), 5.28 (d, J = 4.4 Hz, 1H), 5.11 (td, J = 4.5, 3.3 Hz, 1H), 4.69 (dd, J = 9.1, 5.6Hz, 1H), 4.23 (dd, J = 11.5, 4.2 Hz, 1H), 4.15 - 4.01 (m, 3H), 3.96 (ddd, J =11.9, 5.6, 4.7 Hz, 1H), 3.88 - 3.72 (m, 4H), 3.65 (dd, J = 10.8, 4.0 Hz, 1H), 3.55 (d, J = 6.0 Hz, 1H), 3.25 - 3.15 (m, 2H), 3.03 (dd, J= 9.8, 4.7 Hz, 1H), 2.99 - 2.87 (m, 2H), 2.84 (ddt, J = 14.1, 7.1, 0.9 Hz, 1H), 2.78 (dd, J = 9.3,5.3 Hz, 1H), 2.77 - 2.68 (m, 1H), 2.26 (qd, J = 4.6, 3.7 Hz, 1H), 2.10 (ddt, J =13.4, 5.5, 4.8 Hz, 1H), 2.03 - 1.85 (m, 4H), 1.18 (dd, J = 5.7, 1.8 Hz, 4H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H).

[0157] 13 C NMR (125 MHz, Chloroform- d ) δ 173.0, 167.2, 156.3, 155.9, 137.7,133.4, 129.4, 129.2, 129.2, 127.3, 125.1, 120.4, 118.8, 108.5, 75.1, 71.4,71.2, 69.7, 69.1, 66.5, 56.6, 55.3, 54.7, 52.3, 44.1, 41.9, 36.6, 29.16,28.4, 26.9, 26.6, 20.4, 7.7.

[0158] Example 4 (1) Synthesis of N-(2R,3S / -3-amino-2-hydroxy-4-phenylbutyl)-4-methoxy-N-isobutylbenzenesulfonamide (compound 1d) Compound 1d was prepared according to the method for preparing amine derivatives with the structure shown in Formula III-1 disclosed in CN 108558883 A. The LC-MS (ESI, M+H+) m / z of compound 1d was 407.3.

[0159] (2) Synthesis of (S)-2-amino-N-((2S,3R)-3-hydroxy-4-((4-methoxy-N-isobutylphenyl)sulfonamido)-1-phenylbut-2-yl)-2-((R)-tetrahydrofuran-3-yl)acetamide (amino derivative II-1d) The amino derivative II-1a was prepared according to the preparation method of steps (3) and (4) in Example 1, except that compound 1a was replaced with compound 1d to obtain amino derivative II-1d (white solid powder, 0.18 g, yield 89.3%). Structural data of amino derivative II-1d: LC-MS (ESI, M+H) + ) m / z 534.3.

[0160] (3) Synthesis of N-[(S)-2-[[(2S,3R)-3-hydroxy-4-[(N-isobutyl-4-methoxyphenyl)sulfonamido]-1-phenylbutane-2-yl]amino]-2-oxo-1-[(R)-tetrahydrofuran-3-yl]ethyl]quinoline-2-carboxamide (compound I-4) Quinoline-2-carboxylic acid (compound 8, 0.3 mmol) and amino derivative II-1d were dissolved in 2 mL of anhydrous DMF. The mixture was stirred in an ice bath, and under argon protection, 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI, 0.45 mmol) and 1-hydroxybenzotriazole (HOBt, 0.33 mmol) were slowly added. The mixture was stirred at 0 °C for 20 min, then heated to room temperature and reacted for 1 h. 4-Dimethylpyridine (DMAP, 0.06 mmol) was added, and the reaction continued for 2 h. The solvent was removed from the resulting system under reduced pressure, 50 mL of water was added, and the mixture was extracted three times with ethyl acetate (50 mL each time). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to constant weight. The concentrate was purified by silica gel column chromatography (ethyl acetate to methanol mass ratio 10:1) to give compound I-4 (white solid powder, 0.23 g, yield 94.1%).

[0161] Structural data of compound I-4: LC-MS (ESI, M+H) + ) m / z 816.3.

[0162] 1 H NMR (500 MHz, Chloroform- d ): d 8.41 (d, J = 9.0 Hz, 1H), 8.29 (q, J =8.4 Hz, 2H), 8.21 - 8.16 (m, 1H), 7.98 - 7.92 (m, 1H), 7.84 (ddd, J = 8.3, 7.5,1.0 Hz, 1H), 7.58 (td, J= 7.7, 1.4 Hz, 1H), 7.47 - 7.41 (m, 2H), 7.30 (d, J =9.0 Hz, 1H), 7.29 - 7.17 (m, 5H), 7.10 - 7.04 (m, 2H), 4.57 (dd, J = 9.1, 5.6Hz, 1H), 4.17 (dq, J = 9.0, 7.1 Hz, 1H), 3.89 (tt, J = 6.6, 5.1 Hz, 1H), 3.87 -3.79 (m, 1H), 3.81 (s, 3H), 3.82 - 3.70 (m, 3H), 3.57 (d, J = 6.6 Hz, 1H), 3.19(dd, J = 9.8, 5.0 Hz, 1H), 3.02 - 2.91 (m, 3H), 2.82 (ddt, J = 14.3, 7.3, 1.0 Hz,1H), 2.72 (dd, J = 9.3, 5.3 Hz, 1H), 2.54 - 2.46 (m, 1H), 2.13 (ddt, J = 13.5,5.7, 4.8 Hz, 1H), 2.04 (dddd, J = 13.4, 5.5, 4.7, 3.9 Hz, 1H), 1.91 (dtt, J =13.9, 7.0, 5.4 Hz, 1H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H)。

[0163] 13 C NMR (125 MHz, Chloroform- d ) d 172.1, 163.9, 163.8, 148.6, 146.4,137.5, 135.3, 133.1, 129.8, 129.7, 129.3, 129.2, 129.1, 128.9, 127.5, 127.4,127.3, 120.8, 114.6, 71.4, 69.7, 69.2, 56.1, 55.3, 54.7, 52.3, 41.9, 36.5,28.3, 27.0, 20.4。

[0164] Example 5 Synthesis of (E)-3-(3,4-dihydroxyphenyl)-N-[(S)-2-[[(2S,3R)-3-hydroxy-4-[(N-isobutyl-4-methoxyphenyl)sulfonamido]-1-phenylbutane-2-yl]amino]-2-oxo-1-[(R)-tetrahydrofuran-3-yl]ethyl]acrylamide (compound I-5) The compound I-4 was prepared according to the preparation method of compound I-4 in step (3) of Example 4. The only difference from Example 4 is that compound 8 was replaced with (E)-3-(3,4-dihydroxyphenyl)acrylic acid (compound 9) to obtain compound I-5 (white solid powder, 0.08 g, yield 98.1%).

[0165] Structural data of compound I-5: LC-MS (ESI, M+H) + ) m / z 696.3.

[0166] 1 H NMR (500 MHz, Chloroform- d ) :d 8.60 (s, 1H), 7.92 (d, J = 9.2 Hz, 1H),7.73 (s, 1H), 7.65 - 7.58 (m, 2H), 7.43 (d, J = 8.8 Hz, 1H), 7.29 - 7.17 (m,6H), 7.10 - 7.02 (m, 4H), 6.85 - 6.79 (m, 1H), 6.52 (d, J = 15.9 Hz, 1H), 4.70(dd, J = 9.1, 5.6 Hz, 1H), 4.02 (dq, J = 8.8, 7.1 Hz, 1H), 3.95 - 3.70 (m, 8H), 3.53 (d, J = 6.4 Hz, 1H), 3.19 (dd, J = 9.8, 5.1 Hz, 1H), 2.96 (ddd, J = 9.3, 6.5,5.2 Hz, 2H), 2.91 (ddt, J = 14.1, 7.1, 1.0 Hz, 1H), 2.83 (ddt, J= 14.1, 7.2, 0.9Hz, 1H), 2.78 (dd, J = 9.3, 5.3 Hz, 1H), 2.62 - 2.53 (m, 1H), 2.15 - 2.06 (m,2H), 1.93 (dtt, J = 13.9, 6.9, 5.3 Hz, 1H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H).

[0167] 13 C NMR (125 MHz, Chloroform- d ) d 172.9, 164.8, 163.8, 148.6, 147.3, 141.5, 137.5, 133.1, 129.8, 129.3, 129.2, 127.5, 126.5, 123.0, 119.8, 116.4, 114.8, 112.5, 71.5, 69.8, 69.3, 55.6, 55.4, 54.8, 52.3, 41.9, 36.6, 28.3, 27.0, 20.5.

[0168] Example 6 Synthesis of (S)-N-((2S,3R)-3-hydroxy-4-((N-isobutyl-4-methoxyphenyl)sulfonamide)-1-phenylbutan-2-yl)-2-(2-(4-hydroxyphenoxy)acetamido)-2-((R)-tetrahydrofuran-3-yl)acetamide (compound I-6) The compound I-4 was prepared according to the preparation method of step (3) in Example 4, except that the compound 8 was replaced with 4-(hydroxyphenoxy)acetic acid (compound 10) to obtain compound I-6 (white solid powder, 0.13 g, yield 92.3%).

[0169] Structural data of compound I-6: LC-MS (ESI, M+H) + ) m / z 700.3.

[0170] 1 H NMR (500 MHz, Chloroform- d):δ 8.06 (s, 1H), 7.91 (d, J = 9.0 Hz,1H), 7.73 - 7.67 (m, 2H), 7.45 (d, J = 8.8 Hz, 1H), 7.24 (s, 3H), 7.29 - 7.17(m, 2H), 7.10 - 7.04 (m, 2H), 6.86 (s, 4H), 4.70 (dd, J = 9.2, 5.7 Hz, 1H),4.66 - 4.52 (m, 2H), 4.04 (tt, J = 6.7, 5.1 Hz, 1H), 3.96 - 3.86 (m, 1H),3.86 (ddd, J = 10.8, 6.6, 5.5 Hz, 2H), 3.81 (s, 3H), 3.82 - 3.71 (m, 2H),3.60 (d, J = 6.5 Hz, 1H), 3.19 (dd, J = 9.7, 5.1 Hz, 1H), 3.09 (ddt, J =14.1, 7.3, 1.0 Hz, 1H), 3.01 (dd, J = 9.7, 5.1 Hz, 1H), 2.96 (dd, J = 9.3,5.3 Hz, 1H), 2.84 - 2.75 (m, 2H), 2.56 (dddd, J = 9.1, 5.7, 4.9, 4.1 Hz, 1H),2.19 - 2.06 (m, 2H), 1.93 (dtt, J = 13.9, 6.9, 5.3 Hz, 1H), 0.80 (dd, J =25.0, 6.9 Hz, 6H)。

[0171] 13 C NMR (125 MHz, Chloroform- d ) δ 172.6, 169.2, 163.7, 150.8, 150.5,137.5, 133.1, 129.8, 129.3, 129.1, 127.4, 116.4, 115.9, 114.6, 71.4, 69.8,69.3, 67.0, 55.9, 55.4, 55.4, 54.8, 52.3, 42.0, 36.6, 28.3, 27.0, 20.5。

[0172] Example 7 (1) Synthesis of N-((2R,3S)-3-amino-2-hydroxy-4-phenylbutyl)-2-(isopropylamino)-N-isobutylbenzo[d]thiazole-6-sulfonamide (compound 1e) Compound 1e was prepared according to the method for preparing amine derivatives having the structure shown in Formula III-1 disclosed in CN 108558883 A. The LC-MS (ESI, M+H) analysis of compound 1e was performed. + ) m / z 491.3.

[0173] (2) Preparation of (S)-2-((tert-butoxycarbonyl)amino)-2-((S)-tetrahydrofuran-3-yl)acetic acid (compound 2b) The synthesis method of compound 2b is described in the literature: Hidaka K, Kimura T, Sankaranarayanan R, et al. J Med Chem. 2018;61(12):5138-5153. The LC-MS (ESI, M+H+) m / z of compound 2b is 256.3.

[0174] (3) Synthesis of (S)-2-amino-N-[(2S,3R)-4-[(2-(isopropylamino)-N-isobutylbenzo[d]thiazole)-6-sulfonamido]-3-hydroxy-1-phenylbutane-2-yl]-2-[(S)-tetrahydrofuran-2-yl]acetamide (amino derivative II-1e) The amino derivative II-1a was prepared according to the preparation method in steps (3) and (4) of Example 1, with the only difference from Example 1 being that compound 1a was replaced with compound 1e and compound 2a was replaced with (S)-2-((tert-butoxycarbonyl)amino)-2-((S)-tetrahydrofuran-3-yl)acetic acid (compound 2b), to obtain amino derivative II-1e (white solid powder, 0.18 g, yield 90.2%); structural data of amino derivative II-1e: LC-MS (ESI, M+H + ) m / z 618.3.

[0175] (4) Synthesis of (3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl[(S)-2-[[(2S,3R)-4-[(2-(isopropylamino)-N-isobutylbenzo[d]thiazole)-6-sulfonamido]-3-hydroxy-1-phenylbutane-2-yl]amino]-2-oxo-1-[(S)-tetrahydrofuran-3-yl]ethyl]carbamate (compound I-7) The compound I-1 was prepared according to the preparation method of compound I-1 in step (6) of Example 1. The only difference from Example 1 is that the amino derivative II-1a was replaced with the amino derivative II-1e to obtain compound I-7 (white solid powder, 0.15 g, yield 87.1%).

[0176] Structural data of compound I-7: LC-MS (ESI, M+H) + ) m / z 774.3.

[0177] 1 H NMR (500 MHz, Chloroform- d ): d 8.44 - 8.39 (m, 1H), 7.97 - 7.88 (m,2H), 7.29 - 7.17 (m, 6H), 7.00 (d, J = 9.3 Hz, 1H), 6.09 (d, J = 9.2 Hz, 1H), 5.27 (d, J = 4.2 Hz, 1H), 5.04 (td, J = 4.5, 3.3 Hz, 1H), 4.67 (dd, J = 9.1, 5.6Hz, 1H), 4.32 (dd, J = 11.5, 4.4 Hz, 1H), 4.20 (tt, J = 6.6, 5.0 Hz, 1H), 4.11(dq, J = 8.8, 7.1 Hz, 1H), 4.09 - 3.97 (m, 2H), 3.92 (ddd, J = 11.7, 5.6, 4.7 Hz,1H), 3.87 - 3.74 (m, 4H), 3.59 (dd, J = 10.7, 5.0 Hz, 1H), 3.52 (d, J = 6.4 Hz, 1H), 3.21 (dd, J = 9.8, 5.1 Hz, 1H), 3.03 (dd, J = 9.8, 5.0 Hz, 1H), 2.99 - 2.90(m, 2H), 2.78 (dd, J = 9.3, 5.3 Hz, 1H), 2.72 (ddt, J= 14.1, 7.1, 1.0 Hz, 1H),2.66 (dddd, J = 9.0, 5.7, 5.0, 3.9 Hz, 1H), 2.25 - 2.15 (m, 2H), 1.99 - 1.87(m, 3H), 1.83 (dddd, J = 13.7, 5.5, 4.6, 3.7 Hz, 1H), 1.27 (dd, J = 25.1, 6.4 Hz, 6H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H).

[0178] 13 C NMR (125 MHz, Chloroform- d ) d 173.1, 168.9, 156.4, 155.9, 137.8, 133.4, 129.4, 129.2, 127.4, 126.0, 125.2, 120.4, 118.7, 108.6, 75.1, 71.5, 71.2, 69.8, 69.1, 66.5, 56.7, 55.4, 54.8, 52.4, 45.9, 44.2, 41.9, 36.6, 28.4, 27.0, 26.6, 22.7, 20.5.

[0179] Example 8 (1) Synthesis of 4-amino-N-((2R,3S)-3-amino-2-hydroxy-4-phenylbutyl)-N-isobutylbenzenesulfonamide (compound 1f) Compound 1f was prepared according to the method for preparing amine derivatives having the structure shown in Formula III-1 disclosed in CN 108558883 A. The LC-MS (ESI, M+H+) m / z of compound 1f was 392.3.

[0180] (4) Synthesis of (S)-2-amino-N-((2S,3R)-4-((4-amino-N-isobutylphenyl)sulfonamido)-3-hydroxy-1-phenylbutane-2-yl)-2-((R)-tetrahydrofuran-3-yl)acetamide (amino derivative II-1f) The amino derivative II-1a was prepared according to the preparation method of steps (3) and (4) in Example 1, except that compound 1a was replaced with compound 1f to obtain amino derivative II-1f (white solid powder, 0.22 g, yield 91.3%). Structural data of amino derivative II-1f: LC-MS (ESI, M+H) + ) m / z 519.3.

[0181] (5) Synthesis of N-[(S)-2-[[(2S,3R)-3-hydroxy-4-[(N-isobutyl-4-methoxyphenyl)sulfonamido]-1-phenylbutane-2-yl]amino]-2-oxo-1-[(R)-tetrahydrofuran-3-yl]ethyl]quinoline-2-carboxamide (compound I-4) The compound I-4 was prepared according to the preparation method of step (3) in Example 4, except that the only difference from Example 4 was that compound 8 was replaced with 6-hydroxy-2-quinoline carboxylic acid (compound 11) to obtain compound I-8 (white solid powder, 0.21 g, yield 95.1%).

[0182] Structural data of compound I-8: LC-MS (ESI, M+H) + ) m / z 690.3.

[0183] 1 H NMR (500 MHz, Chloroform- d):δ 8.41 (d, J = 9.2 Hz, 1H), 8.22 -8.13 (m, 2H), 8.09 (d, J = 8.3 Hz, 1H), 7.42 - 7.36 (m, 2H), 7.37 - 7.28 (m,2H), 7.31 - 7.23 (m, 2H), 7.24 (s, 2H), 7.27 - 7.17 (m, 2H), 6.72 - 6.66 (m,2H), 6.31 (s, 1H), 5.18 (s, 2H), 4.35 (dd, J = 9.1, 5.6 Hz, 1H), 4.00 (dq, J= 8.6, 7.0 Hz, 1H), 3.94 (tt, J = 6.7, 4.9 Hz, 1H), 3.84 - 3.75 (m, 2H), 3.73(dt, J = 11.7, 5.2 Hz, 1H), 3.66 (dd, J = 10.6, 4.0 Hz, 1H), 3.53 (d, J = 6.4Hz, 1H), 3.19 (dd, J = 9.9, 5.1 Hz, 1H), 3.06 - 2.85 (m, 5H), 2.80 (dd, J =9.3, 5.3 Hz, 1H), 2.02 (td, J = �.2, 4.4 Hz, 2H), 1.93 (dtt, J = 13.9, 6.9,5.3 Hz, ꜱH), 0.80 (dd, J = 25.0, 6.9 Hz, 6H)。

[0184] 13 C NMR (125 MHz, Chloroform- d ) δ 172.2, 164.0, 155.2, 153.3, 145.8,141.9, 137.5, 134.3, 131.5, 130.6, 130.1, 129.4, 129.3, 129.2, 127.4, 121.8,119.7, 114.4, 111.7, 71.4, 69.8, 69.3, 56.1, 55.4, 54.8, 52.3, 4ི.0, 36.6,28.3, 27.0, 20.5。

[0185] Example 9 It should be noted that there seem to be some incorrect characters in the original text (such as "�" in the NMR data part), which may affect the accuracy of the translation. If possible, it is recommended to correct the original text for a more accurate translation.(1) Synthesis of (9H-fluorene-9-yl)methyl((S)-1-((2S,3R)-3-hydroxy-4-((N-isobutyl-4-methoxyphenyl)sulfonamido)-1-phenylbut-2-yl)amino)-1-oxo-3-(4H-1,2,4-triazol-3-yl)propyl-2-yl)carbamate (compound 3b) Compound 3a was prepared according to the preparation method of step (3) in Example 1, the only difference from Example 1 being that compound 1a was replaced with compound 1d, and compound 2a was replaced with 2-(Fmoc-amino)-3-(1H-1,2,4-triazol-5-yl)propionic acid (compound 12), to obtain compound 3b (white solid powder, 0.20 g, yield 79.1%); structural data of compound 3b: LC-MS (ESI, M+H + ) m / z 767.3.

[0186] (2) Synthesis of (S)-2-amino-N-((2S,3R)-3-hydroxy-4-((N-isobutyl-4-methoxyphenyl)sulfonamido)-1-phenylbut-2-yl)-3-(4H-1,2,4-triazol-3-yl)propionamide (amino derivative II-1g) Compound 3b (1.5 mmol) was dissolved in 10 mL of acetonitrile, and 20 wt% piperidine-DMF (5 mL) was slowly added at room temperature, with stirring for 3 h. After the reaction was complete, the organic solvent was removed by vacuum distillation, and the mixture was dissolved in 50 mL of ethyl acetate. The solution was washed three times with 10 mL of 1 mol / L hydrochloric acid and evaporated to dryness to give amino derivative II-1 g (white solid, 0.71 g, yield 87.0%). Structural data of amino derivative II-1 g: LC-MS (ESI, M+H) + )m / z545.3.

[0187] (3) Synthesis of N-((S)-1-((2S,3R)-3-hydroxy-4-((N-isobutyl-4-methoxyphenyl)sulfonamido)-1-phenylbut-2-yl)amino)-1-oxo-3-(4H-1,2,4-triazol-3-yl)propyl-2-yl)quinoline-2-carboxamide (compound I-9) The preparation of compound I-4 was carried out according to the preparation method of step (3) in Example 4. The only difference from Example 4 was that the amino derivative II-1d was replaced with amino derivative II-1g to obtain compound I-9 (white solid powder, 0.10g, yield 88.3%).

[0188] Structural data of compound I-9: LC-MS (ESI, M+H) + ) m / z 700.3.

[0189] 1 H NMR (500 MHz, Chloroform- d ): δ 8.73 - 8.66 (m, 2H), 8.34 - 8.25 (m,2H), 8.21 - 8.16 (m, 1H), 7.95 (dt, J = 7.3, 0.8 Hz, 1H), 7.84 (ddd, J = 8.2,7.5, 1.0 Hz, 1H), 7.74 - 7.68 (m, 2H), 7.58 (td, J = 7.5, 1.2 Hz, 2H), 7.32(dq, J = 7.4, 1.0 Hz, 2H), 7.29 - 7.17 (m, 3H), 7.14 (d, J = 8.8 Hz, 1H),7.10 - 7.04 (m, 2H), 4.85 (dt, J = 9.3, 7.8 Hz, 1H), 4.17 (tt, J = 6.6, 5.0Hz, 1H), 3.93 (dq, J = 8.8, 7.1 Hz, 1H), 3.80 (s, 3H), 3.53 (d, J = 6.4 Hz, 1H), 3.29 (dd, J = 13.5, 7.7 Hz, 1H), 3.23 - 3.13 (m, 2H), 3.10 - 2.98 (m,2H), 2.96 (dd, J = 9.3, 5.3 Hz, 1H), 2.86 (ddt, J = 14.1, 7.3, 1.1 Hz, 1H),2.78 (dd, J = 9.3, 5.3 Hz, 1H), 1.91 (dpd, J = 12.3, 7.0, 1.6 Hz, 1H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H).

[0190] 13 C NMR (125 MHz, Chloroform- d) δ 171.8, 163.8, 163.6, 149.6, 148.6,146.2, 145.4, 137.6, 135.3, 133.1, 129.8, 129.7, 129.3, 129.2, 129.2, 129.0,127.6, 127.5, 127.4, 120.9, 114.6, 70.0, 55.4, 55.4, 54.5, 52.3, 52.0, 36.4,29.0, 27.0, 20.5.

[0191] Example 10 Synthesis of (R)-N-(S)-2-((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamide)-1-phenylbutane-2-yl)amino)-2-hydroxy-1-((R)-tetrahydrofuran-3-yl)ethyl)-1-(prop-1-en-2-yl)pyrrolidine-3-carboxamide (compound I-10) The compound I-4 was prepared according to the preparation method of step (3) in Example 4, except that the compound 8 was replaced with (R)-1-(prop-1-en-2-yl)pyrrolidine-3-carboxylic acid (compound 13), and the amino derivative II-1d was replaced with the amino derivative II-1a, to obtain compound I-10 (white solid powder, 0.05 g, yield 92.3%).

[0192] Structural data of compound I-10: LC-MS (ESI, M+H) + ) m / z 657.3.

[0193] 1 H NMR (500 MHz, Chloroform- d ): d 8.25 (s, 1H), 7.84 (d, J = 9.1 Hz, 1H),7.60 - 7.54 (m, 2H), 7.31 - 7.18 (m, 3H), 7.24 (s, 2H), 6.92 - 6.86 (m, 2H),4.73 (dd, J = 9.1, 5.6 Hz, 1H), 4.28 (dt, J = 2.0, 1.0 Hz, 1H), 4.23 (dq, J= 2.0,1.0 Hz, 1H), 4.15 - 4.04 (m, 2H), 3.83 (ddd, J = 11.7, 5.6, 4.8 Hz, 1H), 3.76(ddd, J = 11.7, 5.5, 4.8 Hz, 1H), 3.71 (dd, J = 10.6, 4.9 Hz, 1H), 3.66 (dd, J =10.7, 4.1 Hz, 1H), 3.58 (dd, J = 10.1, 3.8 Hz, 1H), 3.56 - 3.49 (m, 1H), 3.46 -3.37 (m, 2H), 3.24 - 3.13 (m, 2H), 3.06 - 2.98 (m, 1H), 2.96 (dd, J = 9.3, 5.3Hz, 1H), 2.89 (ddt, J = 14.1, 7.1, 0.9 Hz, 1H), 2.86 - 2.77 (m, 2H), 2.73 (ddt, J = 14.1, 7.1, 0.9 Hz, 1H), 2.56 - 2.48 (m, 1H), 2.12 (ddt, J = 13.4, 5.5, 4.7Hz, 1H), 2.10 - 2.02 (m, 1H), 2.06 - 1.98 (m, 5H), 1.93 (dtt, J = 13.8, 6.9,5.3 Hz, 1H), 1.80 (ddt, J = 12.5, 6.4, 5.3 Hz, 1H), 0.80 (dd, J = 25.0, 6.9 Hz,6H)。

[0194] 13 C NMR (125 MHz, Chloroform- d ) d175.7, 172.9, 162.6, 145.2, 137.5, 131.7, 130.2, 129.3, 129.2, 127.2, 115.9, 99.3, 71.4, 69.8, 69.3, 56.0, 55.4, 54.8, 53.2, 52.3, 51.5, 44.5, 42.0, 36.6, 30.0, 28.3, 27.0, 20.5, 18.9.

[0195] Example 11 Synthesis of (S)-1-acetyl-N-((S)-2-(((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamido)-1-phenylbut-2-yl)amino)-2-oxo-1-((R)-tetrahydrofuran-3-yl)ethyl)pyrrolidine-3-carboxamide (compound I-11) The preparation of compound I-4 was carried out according to the preparation method of step (3) in Example 4. The only difference from Example 4 was that compound 8 was replaced with (S)-1-acetylpyrrolidine-3-carboxylic acid (compound 14) to obtain amino derivative II-1d, and amino derivative II-1a was replaced with amino derivative II-1a to obtain compound I-11 (white solid powder, 0.02 g, yield 90.3%).

[0196] Structural data of compound I-11: LC-MS (ESI, M+H) + ) m / z 659.3.

[0197] 1 H NMR (500 MHz, Chloroform- d ): d 8.25 (s, 1H), 7.83 (d, J = 9.2 Hz, 1H),7.60 - 7.54 (m, 2H), 7.29 - 7.18 (m, 6H), 6.92 - 6.86 (m, 2H), 4.44 (dd, J =9.1, 5.6 Hz, 1H), 4.15 (dq, J = 8.8, 7.2 Hz, 1H), 3.91 - 3.75 (m, 4H), 3.72(dd, J = 10.1, 4.9 Hz, 1H), 3.67 - 3.55 (m, 3H), 3.53 (d, J= 6.4 Hz, 1H), 3.47(ddd, J = 12.0, 6.3, 5.3 Hz, 1H), 3.19 (dd, J = 9.9, 5.1 Hz, 1H), 3.10 (ddt, J =14.1, 7.3, 1.1 Hz, 1H), 3.04 - 2.93 (m, 3H), 2.80 (dd, J = 9.3, 5.3 Hz, 1H),2.73 - 2.64 (m, 1H), 2.61 (ddt, J = 14.1, 7.1, 0.9 Hz, 1H), 2.18 (ddt, J = 13.4,5.5, 4.8 Hz, 1H), 2.10 - 2.00 (m, 4H), 2.04 - 1.95 (m, 1H), 1.97 - 1.85 (m,2H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H).

[0198] 13 C NMR (125 MHz, Chloroform- d ) d 175.7, 172.9, 169.6, 162.6, 137.5, 131.7, 130.2, 129.3, 129.2, 127.2, 115.9, 71.4, 69.8, 69.3, 56.0, 55.4, 54.8, 52.3, 50.5, 47.4, 44.3, 42.0, 36.6, 30.0, 28.3, 27.0, 21.4, 20.5.

[0199] Example 12 (1) Synthesis of tert-butyl(S)-3-(((4-nitrophenoxy)carbonyl)oxy)pyrrolidine-1-carboxylic acid ester (compound 2b) tert-butyl(S)-3-hydroxypyrrolidine-1-carboxylate (compound 15, 1 mmol) was dissolved in anhydrous dichloromethane under argon purging and protection in an ice bath. DMAP (1.1 mmol) and phenyl 4-nitrochlorocarboxylate (1.2 mmol) were added sequentially, and the reaction was stirred at room temperature for 4 h until completion. The solvent was removed from the resulting system under reduced pressure, 50 mL of water was added, and then the mixture was extracted three times with ethyl acetate (50 mL each time). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to constant weight to give compound 2b (white solid, 0.3 g, yield 85.2%). Structural data of compound 2b: LC-MS (ESI, M+H) + ) m / z 353.3.

[0200] (1) Synthesis of tert-butyl(S)-3-((((S)-2-(((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamide)-1-phenylbut-2-yl)amino)-2-oxo-1-((R)-tetrahydrofuran-2-yl)ethyl)carbamoyloxy)pyrrolidine-1-carboxylic acid ester (compound I-12a) Compound I-1 was prepared according to the preparation method of compound I-1 in step (6) of Example 1, except that compound 2a was replaced with compound 2b to obtain compound I-12a (white solid powder, 0.56 g, yield 90.1%). Structural data of compound I-12a: LC-MS (ESI, M+H) + ) m / z 733.3.

[0201] (3) Synthesis of (S)-3-pyrrolidinyl ((S)-2-(((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamido)-1-phenylbut-2-yl)amino)-2-oxo-1-((R)-tetrahydrofuran-2-yl)ethyl)carbamate (compound I-12) The compound was prepared according to the preparation method of compound II-1a in step (4) of Example 1. The only difference from Example 4 is that compound 3a was replaced with compound I-12a to obtain compound I-12 (white solid powder, 0.10g, yield 85%).

[0202] Structural data of compound I-12: LC-MS (ESI, M+H) + ) m / z 633.3.

[0203] 1 H NMR (500 MHz, Chloroform-d ): d 8.25 (s, 1H), 7.77 (d, J = 9.2 Hz, 1H),7.60 - 7.54 (m, 2H), 7.24 (s, 3H), 7.29 - 7.18 (m, 2H), 7.18 (d, J = 8.8 Hz,1H), 6.92 - 6.86 (m, 2H), 4.42 (dd, J = 9.1, 5.6 Hz, 1H), 4.17 (dq, J = 8.8, 7.1Hz, 1H), 3.96 - 3.59 (m, 10H), 3.53 (d, J = 6.4 Hz, 1H), 3.45 (dt, J = 7.8, 3.8Hz, 1H), 3.19 (dd, J = 9.9, 5.1 Hz, 1H), 3.14 (ddt, J = 14.1, 7.1, 0.9 Hz, 1H),3.01 - 2.85 (m, 4H), 2.80 (dd, J = 9.3, 5.3 Hz, 1H), 2.71 - 2.64 (m, 1H), 2.68- 2.59 (m, 1H), 2.17 (ddt, J = 13.5, 5.7, 4.8 Hz, 1H), 2.03 (dddd, J = 13.4, 5.5,4.8, 4.0 Hz, 1H), 1.91 (dpd, J = 12.3, 7.0, 1.6 Hz, 1H), 0.80 (dd, J = 25.0, 6.9Hz, 6H)。

[0204] 13 C NMR (125 MHz, Chloroform- d ) d172.6, 171.9, 162.5, 137.5, 131.7, 130.2, 129.3, 129.2, 127.4, 115.9, 71.4, 69.8, 69.3, 67.9, 67.2, 56.6, 55.9, 55.4, 54.8, 52.3, 44.0, 42.0, 36.6, 28.3, 27.0, 20.5.

[0205] Example 13 (1) Synthesis of tert-butyl(R)-3-(3-(((S)-2-(((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamido)-1-phenylbut-2-yl)amino)-2-oxo-1-((R)-tetrahydrofuran-3-yl)ethyl)ureo)pyrrolidine-1-carboxylic acid ester (compound I-13a) Triphosgene (0.35 mmol) was dissolved in anhydrous THF, purged with argon and protected under ice bath conditions. Tert-butyl(R)-3-aminopyrrolidine-1-carboxylic acid ester (compound 16, 1 mmol) and DMAP (2 mmol) were slowly added. After addition, the mixture was stirred for approximately 0.5 h. The reaction mixture was then cooled to room temperature and stirred for 1 h. After further cooling in an ice bath, an amino derivative (compound II-1a, 1 mmol) and DMAP (2 mmol) were slowly added. After addition, the mixture was stirred at room temperature for 12 h. After the reaction was complete, the solvent was removed from the resulting system under reduced pressure. 50 mL of water was added, followed by extraction three times with ethyl acetate (50 mL each time). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to constant weight to obtain intermediate I-13a (white solid, 0.69 g, yield 94.4%). Structural data of compound I-13a: LC-MS (ESI, M+H) + ) m / z 732.3.

[0206] (2) Synthesis of (S)-N-((2S,3R)-3-hydroxy-4-((4-hydroxy-N-isobutylphenyl)sulfonamido)-1-phenylbut-2-yl)-2-(3-((R)-pyrrolidine-3-yl)ureo)-2-((R)-tetrahydrofuran-3-yl)acetamide (compound I-13) The preparation was carried out according to the preparation method of compound II-1a in step (4) of Example 1. The only difference from Example 4 is that compound 3a was replaced with compound I-13a to obtain compound I-13 (white solid powder, 0.10g, yield 85.3%).

[0207] Structural data of compound I-13: LC-MS (ESI, M+H) + ) m / z 632.3.

[0208] 1 H NMR (500 MHz, Chloroform- d ): d 8.25 (s, 1H), 7.60 - 7.51 (m, 3H), 7.30 - 7.17 (m, 6H), 6.92 - 6.86 (m, 2H), 6.03 (d, J = 8.0 Hz, 1H), 4.55 - 4.42(m, 2H), 4.19 - 4.08 (m, 2H), 3.89 (dd, J = 10.7, 5.0 Hz, 1H), 3.78 (dt, J =11.7, 5.0 Hz, 1H), 3.71 (dt, J = 11.7, 5.1 Hz, 1H), 3.63 (dd, J = 10.7, 3.9 Hz,1H), 3.57 - 3.49 (m, 1H), 3.34 - 3.12 (m, 5H), 3.05 - 2.98 (m, 1H), 3.02 -2.92 (m, 2H), 2.90 (ddt, J = 14.1, 7.3, 1.1 Hz, 1H), 2.82 (dd, J = 9.3, 5.3 Hz,1H), 2.61 - 2.52 (m, 1H), 2.08 - 1.85 (m, 6H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H).

[0209] 13 C NMR (125 MHz, Chloroform- d ) d 173.0, 162.5, 158.5, 137.6, 132.9, 131.7, 130.2, 129.3, 127.4, 115.9, 71.4, 69.8, 69.3, 56.7, 55.4, 54.8, 54.0, 52.3, 51.8, 46.2, 41.9, 36.6, 33.9, 28.3, 27.0, 20.5.

[0210] Example 14 (1) Synthesis of (2R,3S)-3-((S)-2-(((((3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl)oxy)carbonyl)amino)-2-((R)-tetrahydrofuran-3-yl)acetamido)-1-((4-hydroxy-N-isobutylphenyl)sulfonylamino)-4-phenylbut-2-yl(tert-butoxycarbonyl)-L-valine ester (compound I-14a) Compound I-1 (1.0 mmol) from Example 1 and (tert-butoxycarbonyl)-L-valine (compound 17, 1.2 mmol) were mixed and dissolved in anhydrous dichloromethane. The mixture was purged with argon and protected under ice bath conditions. DCC (2.0 mmol), DMAP (0.2 mmol), and TEA (1.5 mL) were added sequentially, and the mixture was stirred at room temperature for 6 h until the reaction was complete. The solvent was removed from the resulting system under reduced pressure, 50 mL of water was added, and the mixture was extracted with ethyl acetate (3 × 50 mL). The combined organic phases were dried over anhydrous sodium sulfate, filtered, and concentrated to constant weight to give compound I-14a (white solid, 0.8 g, yield 91.5%). Structural data of compound I-14a: LC-MS (ESI, M+H) + ) m / z 875.3.

[0211] (2) Synthesis of (2R,3S)-3-[(S)-2-[[[(3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl]oxy]carbonyl]amino-2-[(R)-tetrahydrofuran-3-yl]acetamyl]-1-[(4-hydroxy-N-isobutylphenyl)sulfonamide]-4-phenylbutane-2-yl L-valine ester (compound I-14b) The preparation of amino derivative II-1a was carried out according to the preparation method of step (4) in Example 1, with the only difference from Example 4 being that compound 3a was replaced with compound I-14a, yielding compound I-14b (white solid powder, 0.68 g, yield 89.2%). Structural data of compound I-14b: LC-MS (ESI, M+H) + ) m / z 775.3.

[0212] (3) Synthesis of (2R,3S)-3-[(S)-2-[[[(3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl]oxy]carbonyl]amino-2-[(R)-tetrahydrofuran-3-yl]acetamyl]-1-[(4-hydroxy-N-isobutylphenyl)sulfonamide]-4-phenylbutane-2-yl(tert-butoxycarbonyl)-D-valine-L-valine ester (compound I-14c) Compound I-4 was prepared according to the preparation method of compound I-4 in step (3) of Example 4, with the only difference from Example 4 being that compound 8 was replaced with (tert-butoxycarbonyl)-D-valine (compound 18), and amino derivative II-1d was replaced with amino derivative I-14b, to obtain compound I-14c (white solid powder, 0.72 g, yield 89.3%). Structural data of compound I-14c: LC-MS (ESI, M+H + ) m / z 974.3.

[0213] (4) Synthesis of (2R,3S)-3-[(S)-2-[[[(3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl]oxy]carbonyl]amino-2-[(R)-tetrahydrofuran-3-yl]acetamyl]-1-[(4-hydroxy-N-isobutylphenyl)sulfonamide]-4-phenylbutane-2-yl D-valine-L-valine ester (compound I-14) The preparation was carried out according to the preparation method of amino derivative II-1a in step (4) of Example 1. The only difference from Example 4 is that compound 3a was replaced with compound I-14c to obtain compound I-14 (white solid powder, 0.60g, yield 91.2%).

[0214] Structural data of compound I-14: LC-MS (ESI, M+H) + ) m / z 874.3.

[0215] 1 H NMR (500 MHz, Chloroform- d ): d 8.16 (s, 1H), 7.60 - 7.53 (m, 2H), 7.41 (d, J = 9.2 Hz, 1H), 7.32 (d, J = 8.8 Hz, 1H), 7.30 - 7.17 (m, 5H), 6.92 -6.86 (m, 2H), 6.02 (d,J = 9.2 Hz, 1H), 5.16 (d, J = 4.4 Hz, 1H), 5.12 - 5.00 (m,2H), 4.92 (td, J = 4.4, 3.3 Hz, 1H), 4.59 (dd, J = 9.1, 6.5 Hz, 1H), 4.52 (dtd, J =9.0, 7.3, 5.3 Hz, 1H), 4.39 (dd, J = 11.5, 4.2 Hz, 1H), 4.05 (d, J = 5.5 Hz, 2H),3.96 (dd, J = 11.5, 3.3 Hz, 1H), 3.85 (ddd, J = 11.7, 5.5, 4.8 Hz, 1H), 3.84 -3.76 (m, 1H), 3.79 - 3.69 (m, 4H), 3.63 - 3.55 (m, 2H), 3.44 (dd, J = 9.9, 4.6Hz, 1H), 2.96 (dd, J = 9.3, 5.4 Hz, 1H), 2.90 - 2.79 (m, 2H), 2.67 - 2.57 (m,2H), 2.27 (qd, J = 4.6, 3.8 Hz, 1H), 2.14 - 1.98 (m, 4H), 1.99 - 1.83 (m, 3H),0.95 (ddd, J = 25.1, 6.7, 5.8 Hz, 12H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H)。

[0216] 13 C NMR (125 MHz, Chloroform- d ) d172.8, 172.3, 172.0, 162.4, 156.3, 137.6, 131.5, 130.2, 129.2, 129.2, 127.4, 115.9, 108.6, 75.4, 72.4, 71.5, 71.2, 69.1, 66.5, 58.1, 58.1, 56.7, 55.3, 53.0, 50.3, 44.2, 41.9, 36.4, 30.8, 30.5, 28.4, 26.9, 26.5, 20.5, 18.7, 18.5.

[0217] Example 15 (1) Synthesis of N-((2R,3R)-2-amino-3-amino-4-phenylbutane)-N-isobutyl-4-methoxybenzenesulfonamide (compound 1g) Compound 1f was prepared according to the method for preparing amine derivatives having the structure shown in Formula III-1 disclosed in CN 108558883 A. The LC-MS (ESI, M+H) analysis of compound 1f was performed. + ) m / z 422.3.

[0218] Compound 1f (1 mmol) was dissolved in a mixture of ethyl acetate and methanol (volume ratio 1:2), and 10% Pd / C catalyst (compound to catalyst mass ratio 1:1) was added. The reaction system was purged three times with nitrogen and then three times with hydrogen. The reaction solution was stirred at room temperature for 7 h at 50 psi hydrogen pressure. After the reaction was complete, the reaction system was purged with nitrogen. The reaction solution was filtered through diatomaceous earth, and the filtrate was collected and the solvent was removed by vacuum distillation to give 1 g of compound (white solid, 0.32 g, yield 81.8%). Structural data of compound 1 g: LC-MS (ESI, M+H) + ) m / z 392.3.

[0219] (2) Synthesis of (S)-2-[(tert-butoxycarbonyl)amino]-2-[(3S,3aR,6aS)-hexahydrofurano[2,3-b]furan-3-yl]acetic acid (compound 2c) Reference: [E. Ami et al. / Tetrahedron Letters 43 (2002) 2931-2934] reported the method for synthesizing compound 2c, and the LC-MS (ESI, M+H) analysis of compound 2c. + ) m / z 288.3.

[0220] (3) Synthesis of tert-butyl((S)-2-[[(2S,3R)-4-[(4-amino-N-isobutylphenyl)sulfonamido]-3-hydroxy-1-phenylbutane-2-yl]amino]-1-[(3S,3aR,6aS)-hexahydrofurano[2,3-b]furan-3-yl]-2-oxoethyl)carbamate (compound 3b) Compound 3b was prepared according to the preparation method of compound I-4 in step (3) of Example 4, except that compound 4 was replaced with compound 2c and amino derivative II-1d was replaced with compound 1g, yielding compound 3b (white solid powder, 0.89 g, yield 90.0%). Structural data of compound 3b: LC-MS (ESI, M+H) + ) m / z 661.3.

[0221] (4) Synthesis of (S)-2-amino-N-[(2S,3R)-4-[(4-amino-N-isobutylphenyl)sulfonamido]-3-hydroxy-1-phenylbutane-2-yl]-2-[(3S,3aR,6aS)-hexahydrofurano[2,3-b]furan-3-yl]acetamide (amino derivative II-2a) The amino derivative II-1a was prepared according to the preparation method of step (4) in Example 1, the only difference from Example 4 being that compound 3a was replaced with compound 3b, yielding amino derivative compound II-2a (white solid powder, 0.60 g, yield 93.3%). Structural data of amino derivative II-2a: LC-MS (ESI, M+H) + ) m / z 561.3.

[0222] (5) Synthesis of (3R,3aS,6aR)-hexahydrofurano[2,3-b]furan-3-yl((S)-2-[[(2S,3R)-4-[(4-amino-N-isobutylphenyl)sulfonamido]-3-hydroxy-1-phenylbutane-2-yl]amino]-1-[(3S,3aR,6aS)-hexahydrofurano[2,3-b]furan-3-yl]-2-oxoethyl)carbamate (compound I-15) The compound I-1 was prepared according to the preparation method of compound I-1 in step (6) of Example 1. The only difference from Example 1 is that the amino derivative II-1a was replaced with amino derivative II-2a to obtain compound I-15 (white solid powder, 0.20 g, yield 89.5%).

[0223] Structural data of compound I-15: LC-MS (ESI, M+H) + ) m / z 717.3.

[0224] 1 H NMR (500 MHz, Chloroform- d ): d 7.58 - 7.52 (m, 2H), 7.30 - 7.17 (m,6H), 6.65 - 6.59 (m, 2H), 6.08 (d, J = 9.2 Hz, 1H), 5.34 (s, 2H), 5.29 (d, J =4.4 Hz, 1H), 5.11 (d, J = 4.4 Hz, 1H), 5.04 (td, J = 4.5, 3.3 Hz, 1H), 4.77 (dd, J = 9.1, 6.5 Hz, 1H), 4.28 (dd, J = 11.5, 4.4 Hz, 1H), 4.19 - 4.11 (m, 1H), 4.10(dq, J = 8.6, 7.0, 6.6 Hz, 1H), 3.97 (dd, J = 11.5, 3.3 Hz, 1H), 3.90 (ddd, J =11.9, 5.6, 4.7 Hz, 1H), 3.89 - 3.82 (m, 3H), 3.80 (ddd, J = 11.7, 5.6, 4.6 Hz,1H), 3.73 (dd, J = 10.8, 3.7 Hz, 1H), 3.52 (d, J = 6.4 Hz, 1H), 3.20 (dd, J = 9.8, 5.0 Hz, 1H), 3.02 (dd, J = 9.8, 5.0 Hz, 1H), 2.96 (dd, J = 9.3, 5.3 Hz, 1H), 2.89(ddt, J = 14.3, 7.3, 1.0 Hz, 1H), 2.82 (dd, J = 9.3, 5.3 Hz, 1H), 2.76 (ddt, J=14.1, 7.1, 1.0 Hz, 1H), 2.68 (dtd, J = 6.5, 4.4, 3.7 Hz, 1H), 2.52 - 2.42 (m,2H), 2.07 - 1.77 (m, 5H), 0.80 (dd, J = 25.0, 6.9 Hz, 6H).

[0225] 13C NMR (125 MHz, Chloroform- d ) d 172.6, 156.2, 153.3, 137.6, 130.1, 129.3, 129.3, 127.4, 114.4, 108.6, 106.4, 75.1, 71.6, 70.0, 69.2, 67.4, 66.4, 56.1, 55.4, 54.5, 52.4, 49.6, 44.2, 41.2, 36.6, 29.8, 27.0, 26.6, 20.5.

[0226] Test Example 1 Compounds I-1 to I-15 prepared in Examples 1 to 15 were dissolved in DMSO and serially diluted with double-distilled water to obtain compound solutions of different concentrations (20 mM (mmol / L), 10 mM, 5 mM, 1 mM, 500 μM (μmol / L), 200 μM, 100 μM, and 50 μM, respectively) as samples. The inhibitory activity of each compound against HIV-1 protease and its cytotoxicity were determined according to the following method.

[0227] Reference (Dong Biao, Zhang Tian, ​​Tao Peizhen. Establishment of a high-throughput fluorescent substrate HIV-1 protease model [J]. Chinese Journal of AIDS and STD, 2006(05): 402-405.) (1) Test of the inhibitory activity of compounds I-1~I-15 against HIV-1 protease Using (Arg-Glu(EDANS)-Ser-Gln-Asn-Tyr-Pro-Ile-Val-Gln-Lys(DABCYL)-Arg) (AnaSpec) as the substrate, Edans and Dabcyl chromophores were labeled on either side of the cleavage site, respectively. The fluorescence chromophore spectrum of Edans overlaps with the absorption spectrum of Dabcyl, and fluorescence quenching occurs through fluorescence resonance energy transfer at a sufficiently close distance, resulting in almost no fluorescence in the intact substrate. When the fluorescent substrate is cleaved by HIV protease, the Edans chromophore moves away from the Dabcyl group, and the fluorescence quenching condition disappears. At this point, Edans fluoresces at 490 nm under excitation light of 340 nm. When the compounds prepared in Examples I-1 to I-15 are added, the stronger the inhibitory activity of the compound on the enzyme, the less the substrate product and the lower the fluorescence intensity; conversely, the weaker the compound, the higher the fluorescence intensity.

[0228] Following the method described in the literature (Dong Biao, Zhang Tian, ​​Tao Peizhen. Establishment of a high-throughput fluorescent substrate HIV-1 protease model [J]. Chinese Journal of AIDS and STD, 2006(05): 402-405), the HIV-1 PR inhibitory activity of samples was determined using a 96-well plate. 185 μL of substrate (5 μM) and buffer solution were added to each well, followed by 5 μL of sample solution. Blank absorbance was measured, and then 10 μL of HIV-1 PR was added. After incubation for 5 min, the absorbance at 490 nm was measured. The inhibition rate of the samples at each concentration was calculated, and the IC50 was calculated using Graphpad software. 50 The value was determined using DRV (Darunavir) (purchased from ARP (American Research Products) in the United States) as a positive control.

[0229] HIV-1 PR was expressed and purified in Escherichia coli according to the method described in (Wang Yunhua et al. Expression, purification and in vitro screening method of HIV-1 protease and its inhibitors. Chinese Journal of Virology, Vol. 21, No. 2, March 2006). HIV-1 PR was desalted using a PD-10 column.

[0230] Using the HIV-1 protease inhibitor DRV (Darunavir) as a positive control, the inhibitory activity against the protease (PR) and cytotoxicity of the compounds prepared in Examples I-1 to I-15 were determined according to the above method. The results are shown in Table 2.

[0231] Table 2 Inhibitory activity of Examples I-1 to I-15 against HIV-1 protease

[0232] As shown in Table 2, compounds I-1 to I-15 all exhibit significant inhibitory activity against HIV-1 protease, with better effects than the positive control drug HIV-1 protease inhibitor DRV, and reaching the pM level.

[0233] (2) Cytotoxicity test The Cell Counting Kit-8 (CCK-8 kit) was used for cytotoxicity testing. 20,000 293T cells were added to each well of a 96-well plate and incubated for 24 hours. Then, 1 μL of the sample was added, and incubation continued for another 24 hours. Next, 10 μL of CCK-8 was added, and after 2 hours, the absorbance was measured at 450 nm. The percentage of surviving cells at each concentration was calculated, and the CCK-8 concentration was calculated using Graphpad software. 50 The values ​​were calculated, with DMSO as a blank control and DRV (Darunavir) as a positive control. The results are shown in Table 3.

[0234] Table 3. Cytotoxicity of the compounds obtained in Examples I-1 to I-15

[0235] As can be seen from Table 3, compounds I-1 to I-15 prepared in this invention all exhibit low cytotoxicity.

[0236] Test Example 2 The inhibitory activity of the compounds prepared in Examples I-1 to I-15 against HIV-1 protease-resistant strains, especially DRV-resistant strains, was determined according to the following method: HIV-1 viral strains were induced to mutate using the gene synthesis primer tool SBS Genetech, and the amino acid residues V32I, L33F, I54M and I84V on the protease were induced to mutate using pNL4-3-ER- as a plasmid.

[0237] The nucleotide sequences of the primer pairs for the mutants are shown in SEQ ID NO.1 to SEQ ID NO.6: 32 / 33 mutant primer pairs: F'-ACAGGAGCAGATGATACAATATTTGAAGAAATGAATTTGCCA (SEQ ID NO.1), R'-TGGCAAATTCATTTCTTCAAATATTGTATCATCTGCTCCTGT (SEQ ID NO.2); 54 mutant primer pairs: F'-GGGAATTGGAGGTTTTATGAAAGTAAGACAGTATGAT (SEQ ID NO.3); R'-ATCATACTGTCTTACTTTCATAAAACCTCCAATTCCC (SEQ ID NO.4); 84 mutant primer pairs: F'-GGACCTACACCTGTCAACGTAATTGGAAGAAATCTGT (SEQ ID NO.5); R'-ATCATACTG TCTTACTTTCATAAAACCTCCAATTCCC (SEQ ID NO.6).

[0238] After determining the nucleotide sequence of the mutant plasmid, it was cultured in DMEM medium containing 10 wt% FBS. Before transfection, cells were seeded in 96-well plates (cell concentration 1.5 × 10⁶ cells / well). 5 The culture medium ( / mL) was used to incubate the cells in 2 mL of medium. After 24 h, the cells were transfected. Five h after transfection, a certain concentration of the test sample was added, and the cells were incubated at 37 °C for 48 h with 5% CO2. The supernatant was then collected, and the luciferase activity in the infected cells was measured to calculate the inhibitory activity of each sample against HIV-1 protease-resistant strains. The results are shown in Table 4.

[0239] Table 4. Inhibitory activity of compounds obtained in Examples I-1 to I-15 against DRV-resistant strains.

[0240] As shown in Table 4, the compounds of the present invention have significant inhibitory activity against both wild-type HIV-1 drug-resistant strains and highly drug-resistant DRV strains, and are superior to the positive control drug HIV-1 protease inhibitor DRV.

[0241] In summary, the compounds containing non-natural amino acid fragments with the structure shown in Formula I provided by this invention all exhibit significant HIV protease inhibitory activity and significant inhibitory activity against DRV drug-resistant strains. Toxicity studies show that they have good drug-like properties, indicating that these compounds have good application prospects as anti-AIDS drugs.

[0242] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A compound containing non-natural amino acid fragments, having the structure shown in Formula I: Equation I; in, R a include , , , , , , , or ; R b Including -H, , , , , , , , , amino acid residues or dipeptide residues; wherein Ry1 and Ry3 independently include oxygen or sulfur; Ry2 and Ry4~Ry6 independently include C1~C8 alkyl, C2~C8 alkenyl, C2~C9 alkynyl; Ry7 includes , , , , , or ;Ry8~Ry 10 Each is an amino acid side chain group; m1, m2, and o are independent integers from 1 to 3; R c include , , , , , , , , , , , , or ; R includes , , or ; Among them, R x1 ~R x14 Independently includes hydrogen, hydroxyl, methoxy, amino, halogen, C1-C8 alkyl, C1-C8 alkenyl, C3-C8 cycloalkenyl, C1-C8 alkoxy, C1-C8 alkoxyacyl, C2-C8 alkoxycycloyl, C3-C8 alkoxyalkenyl or C3-C8 alkoxycycloalkenyl; X includes -CH2- or oxygen.

2. The benzoheterocyclic sulfonamide compound according to claim 1, characterized in that, The amino acid residues include The dipeptide residues include Among them, Ry8~Ry 10 It can be a natural amino acid side chain group or a non-natural amino acid side chain group.

3. The compound containing non-natural amino acid fragments according to claim 1 or 2, characterized in that, The R b Including -H, , , , , , , or .

4. The compound containing non-natural amino acid fragments according to claim 1, characterized in that, The compound containing non-natural amino acid fragments includes the structure shown in any one of I-1 to I-15: 、 、 、 、 、 、 、 、 、 、 、 、 、 、 。 5. The method for preparing the compound comprising non-natural amino acid fragments according to any one of claims 1 to 4, (i) When R b When H = -H, the preparation method includes the following steps: Compound A and amino derivative B were condensed in the presence of an amide catalyst to obtain R. b The compound containing non-natural amino acid fragments of =-H; the compound A includes compound A-1 or compound A-2; ； Rx in compound A-1 includes , or ; (ii) When R b for , , , , , , or The preparation method includes the following steps: R b =-H contains non-natural amino acid fragments and R b -X' undergoes a substitution reaction to obtain the compound containing the non-natural amino acid fragment; the R b In -X', X' represents a halogen; (iii) When R b When the residue is an amino acid residue or a dipeptide residue, the preparation method includes the following steps: R b =H contains a non-natural amino acid fragment compound that undergoes a condensation reaction with a Boc-protected amino acid or a Boc-protected dipeptide, followed by a deprotection reaction to obtain the non-natural amino acid fragment compound.

6. The preparation method according to claim 5, characterized in that, The preparation method of the amino derivative B includes the following steps: condensing an amino compound with a non-natural amino acid fragment compound with a protecting group, followed by a deprotection reaction to obtain amino derivative B; The structural formula of the amino compound is: ; The non-natural amino acid fragment compounds with protective groups include or .

7. The preparation method according to claim 6, characterized in that, The non-natural amino acid fragment compounds with protective groups include , , , , , , , or .

8. The preparation method according to claim 6, characterized in that, When R c for The preparation method of the amino compound includes the following steps: The amino compound B-1 was substituted with p-bromobenzenesulfonyl chloride to give amino compound B-2; The amino compound B-2 was subjected to a substitution reaction with pinacol to obtain amino compound B-3; The amino compound B-3 was subjected to a hydrolysis reaction to obtain amino compound B-4; The amino compound B-4 was subjected to a deprotection reaction to obtain the amino compound; When R c for , , , , , or The preparation method of the amino compound includes the following steps: The amino compound B-1 was substituted with 2-(methylthio)benzo[d]thiazol-6-sulfonyl chloride to give the amino compound B-5. The amino compound B-5 was oxidized in the presence of an oxidizing catalyst to obtain an oxidation intermediate. The oxidation intermediate was reacted with NH2-R O A substitution reaction was carried out to give amino compound B-6; the NH2-R O Chinese R O Including methyl, cyclopropyl, isopropyl, isobutyl, or formate groups; The amino compound B-6 was subjected to a deprotection reaction to obtain the amino compound; When R c for or The preparation method of the amino compound includes the following steps: The amino compound B-1 was subjected to a substitution reaction with 3-chloro-4-aminobenzenesulfonyl chloride to obtain the amino compound B-7. The amino compound B-7 was subjected to a substitution reaction with isoselenic cyanide to obtain amino compound B-8; the isoselenic cyanide was R. p -N=C=Se, where R p Including methyl or cyclopropyl; The amino compound B-8 was subjected to a deprotection reaction to obtain the amino compound; 。 9. A pharmaceutical composition, characterized in that, It includes an active ingredient and pharmaceutically acceptable excipients; the active ingredient includes the compound containing non-natural amino acid fragments as described in any one of claims 1 to 4 or the compound containing non-natural amino acid fragments prepared by the method described in any one of claims 5 to 8.

10. The use of the compound containing non-natural amino acid fragments according to any one of claims 1 to 4, the compound containing non-natural amino acid fragments prepared by the preparation method according to any one of claims 5 to 8, or the pharmaceutical composition according to claim 9 in the preparation of HIV protease inhibitors.

Images