SgRNA targeting plagl1 gene dmr, epigenetic editing system and application thereof
By targeting the differentially methylated region of the Plagl1 gene with sgRNA and dCas9-Tet1-CD fusion protein, combined with injectable photocurable silk protein hydrogel, the problem of insufficient osteogenic capacity in the repair of craniofacial bone defects was solved, achieving safe and efficient jawbone regeneration.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI STOMATOLOGICAL HOSPITAL FUDAN UNIV
- Filing Date
- 2026-05-01
- Publication Date
- 2026-07-24
AI Technical Summary
Existing technologies for repairing craniofacial bone defects suffer from problems such as secondary donor site injury, limited bone volume, immune rejection, and insufficient osteogenic capacity, which limit the efficiency and safety of bone regeneration and repair.
By using sgRNA targeting the differentially methylated region of the Plagl1 gene and the dCas9-Tet1-CD fusion protein, combined with an injectable photocurable silk protein hydrogel, osteogenic differentiation of periosteal stem/progenitor cells was induced, and jawbone regeneration was promoted through epigenetic reprogramming.
It achieves efficient and safe jawbone regeneration, improves bone mass and osteogenic capacity, avoids the risk of permanent genomic mutations, and has minimally invasive operation and long-lasting retention effect.
Smart Images

Figure CN122445641A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, and more specifically, to an sgRNA targeting the DMR of the Plagl1 gene, an epigenetic editing system, and its applications. Background Technology
[0002] The craniofacial bone tissue is an important component of the human body, undertaking many key functions such as supporting facial structures, protecting vital organs, and performing mastication and speech. However, factors such as trauma, infection, tumors, and congenital diseases often lead to craniofacial bone defects, which not only affect the normal function of the oral-craniofacial system but also seriously impair patients' facial aesthetics, mental health, and quality of life. Traditional repair methods, such as autologous bone grafting, allogeneic bone grafting, and artificial prosthesis implantation, are widely used, but problems such as secondary damage to the donor site, limited bone volume, immune rejection, and insufficient osteogenic capacity still exist, making it difficult to achieve efficient and stable bone regeneration. With the increasing aging population and the growing number of patients with bone defects caused by trauma and surgery, the clinical demand for rapid, safe, and precise bone tissue regeneration and repair strategies is increasing.
[0003] In recent years, combining the advantages of biology, materials science, and engineering, stem cell-based tissue engineering technology has become a cutting-edge research direction for promoting bone tissue regeneration and repair, and has made significant progress in the treatment of craniofacial bone defects. Skeletal stem cells (SSCs) are crucial for bone development, homeostasis, and regeneration due to their self-renewal and multi-directional differentiation capabilities. In recent years, researchers have identified corresponding SSC populations in different microenvironments such as bone marrow, growth plate, periosteum, and cranial sutures. Unlike long bones derived from the mesoderm, craniofacial bones originate from cranial neural crest cells, primarily driven by intramembranous osteogenic differentiation of SSCs in the periosteum and sutures. Studies have shown that compared to long bones, peristeal stem / progenitor cells (PSPCs) of the jawbone have stronger plasticity and bone regeneration capacity. However, current applications of stem cells still face bottlenecks such as limited sources, difficulties in expansion and preservation, low efficiency of directed differentiation, and immunogenicity, limiting their clinical translational application in bone regeneration and repair.
[0004] Therefore, there is an urgent need in this field to develop a drug or preparation that can promote the regeneration and repair of craniofacial bone tissue defects. Summary of the Invention
[0005] The purpose of this invention is to provide a drug or preparation that can promote the regeneration and repair of craniofacial bone tissue defects.
[0006] In a first aspect of the invention, an sgRNA targeting the differentially methylated region of the Plagl1 gene is provided, wherein the nucleotide sequence of the sgRNA is selected from SEQ ID NO: 1 or SEQ ID NO: 2.
[0007] In another preferred embodiment, the nucleotide sequence of the sgRNA is shown in SEQ ID NO: 1.
[0008] In another preferred embodiment, the sgRNA targets CpG islands in the DMR region of the Plagl1 gene.
[0009] In another preferred embodiment, the sgRNA targets methylation-sensitive sites in the DMR region of the Plagl1 gene.
[0010] In a second aspect of the invention, a complex for epigenetic reprogramming of the Plagl1 gene is provided, the complex comprising:
[0011] (a) the sgRNA described in the first aspect of the present invention; and
[0012] (b) dCas9-Tet1-CD fusion protein.
[0013] In another preferred embodiment, the dCas9-Tet1-CD fusion protein is formed by fusing an inactivated Cas9 protein with the catalytic domain of a Tet1 protein.
[0014] In another preferred embodiment, the dCas9-Tet1-CD fusion protein further includes a nuclear localization signal.
[0015] In another preferred embodiment, the nucleotide sequence encoding the dCas9-Tet1-CD fusion protein is shown in SEQ ID NO: 4.
[0016] In another preferred embodiment, the complex is a non-viral vector delivery system.
[0017] In another preferred embodiment, the complex is in the form of lipid nanoparticle encapsulation.
[0018] In a third aspect of the invention, a recombinant vector is provided, the recombinant vector comprising a first nucleotide sequence encoding the sgRNA described in the first aspect of the invention.
[0019] In another preferred embodiment, the recombinant vector further comprises a second nucleotide sequence encoding the dCas9-Tet1-CD fusion protein.
[0020] In another preferred embodiment, the second nucleotide sequence encoding the dCas9-Tet1-CD fusion protein is shown in SEQ ID NO: 4.
[0021] In another preferred embodiment, the recombinant vector is an adenovirus vector.
[0022] In a fourth aspect of the invention, a recombinant adenovirus is provided, the recombinant adenovirus comprising a nucleotide sequence encoding the sgRNA described in the first aspect of the invention and a nucleotide sequence encoding the dCas9-Tet1-CD fusion protein.
[0023] In a fifth aspect of the invention, a pharmaceutical composition for jawbone regeneration is provided, the pharmaceutical composition comprising the sgRNA of the first aspect of the invention, the complex of the second aspect of the invention, the recombinant vector of the third aspect of the invention, or the recombinant adenovirus of the fourth aspect of the invention.
[0024] In a sixth aspect of the invention, an injectable hydrogel for jawbone regeneration is provided, the hydrogel comprising the sgRNA of the first aspect of the invention, the complex of the second aspect of the invention, the recombinant vector of the third aspect of the invention, the recombinant adenovirus of the fourth aspect of the invention, or the pharmaceutical composition of the fifth aspect of the invention.
[0025] In another preferred embodiment, the hydrogel is a photocurable silk protein hydrogel.
[0026] In another preferred embodiment, the photocurable silk fibroin hydrogel is formed by curing methacrylated silk fibroin under ultraviolet light in the presence of a photoinitiator.
[0027] In another preferred embodiment, the hydrogel further comprises a photoinitiator.
[0028] In another preferred embodiment, the photoinitiator is LAP.
[0029] In another preferred embodiment, the hydrogel is an injectable hydrogel, an in-situ curable hydrogel, or a hydrogel loaded with adenovirus.
[0030] In another preferred embodiment, the hydrogel has a sustained-release function.
[0031] In another preferred embodiment, the hydrogel is in the form of a lyophilized powder and is reconstituted before use.
[0032] In another preferred embodiment, the concentration of sgRNA in the hydrogel is from 0.1 nM to 1000 nM.
[0033] In another preferred embodiment, the concentration of sgRNA in the hydrogel is from 1 nM to 500 nM.
[0034] In another preferred embodiment, the concentration of sgRNA in the hydrogel is from 10 nM to 100 nM.
[0035] In another preferred embodiment, the concentration of the dCas9-Tet1-CD fusion protein in the hydrogel is from 0.01 μg / μL to 10 μg / μL; preferably from 0.1 μg / μL to 5 μg / μL.
[0036] In another preferred embodiment, the titer of recombinant adenovirus in the hydrogel is 1 × 10⁻⁶. 7 PFU / mL up to 1×10 11 PFU / mL; preferably 1×10⁻⁶ 8 PFU / mL up to 1×10 10 PFU / mL; more preferably 5 × 10⁻⁶ 8 PFU / mL up to 5×10 9 PFU / mL.
[0037] In another preferred embodiment, the concentration of methacrylated silk fibroin in the hydrogel is 10% to 50% (w / v); preferably 20% to 40% (w / v); more preferably 30% (w / v).
[0038] In another preferred embodiment, the concentration of the photoinitiator in the hydrogel is 0.1% to 1% (w / v); preferably 0.2% to 0.5% (w / v); more preferably 0.25% (w / v).
[0039] In a seventh aspect of the present invention, a method for preparing the injectable hydrogel described in the sixth aspect of the present invention is provided, the method comprising the step of mixing the sgRNA described in the first aspect of the present invention, the complex described in the second aspect of the present invention, the recombinant vector described in the third aspect of the present invention, or the recombinant adenovirus described in the fourth aspect of the present invention with a methacrylated silk fibroin solution.
[0040] On the eighth aspect of this invention, the use of the sgRNA described in the first aspect of this invention, the complex described in the second aspect of this invention, the recombinant vector described in the third aspect of this invention, the recombinant adenovirus described in the fourth aspect of this invention, the pharmaceutical composition described in the fifth aspect of this invention, or the injectable hydrogel described in the sixth aspect of this invention in the preparation of formulations for promoting jawbone regeneration and / or improving jawbone defects is provided.
[0041] In another preferred embodiment, promoting jawbone regeneration includes promoting osteogenic differentiation of periosteal stem / progenitor cells.
[0042] In another preferred embodiment, the bone stem cells are periosteal stem / progenitor cells.
[0043] In another preferred embodiment, promoting jawbone regeneration includes: increasing bone volume fraction, bone surface area to tissue volume ratio, bone mineral density, and / or reducing porosity.
[0044] In another preferred embodiment, the jawbone is the mandible.
[0045] In another preferred embodiment, the jawbone defect is traumatic, infectious, post-tumor surgery, or congenital.
[0046] In another preferred embodiment, the formulation is an injectable, implantable, or tissue-engineered scaffold.
[0047] In another preferred embodiment, the formulation is an injectable hydrogel.
[0048] In another preferred embodiment, the formulation is a photocurable silk protein hydrogel.
[0049] In another preferred embodiment, the formulation is administered by local injection.
[0050] In another preferred embodiment, the formulation is applied by in-situ curing.
[0051] In another preferred embodiment, the formulation is implanted via minimally invasive surgery.
[0052] In another preferred embodiment, the formulation is used for mammals.
[0053] In another preferred embodiment, the mammals include humans and non-human mammals.
[0054] In another preferred embodiment, the non-human mammals include mice, rats, dogs, cats, and monkeys.
[0055] In another preferred embodiment, the formulation is used for purposes selected from the group consisting of:
[0056] (1) Used to promote jawbone regeneration in conjunction with dental implant placement;
[0057] (2) Used for filling and repairing jawbone defects; or
[0058] (3) Used to guide bone tissue regeneration.
[0059] In another preferred embodiment, the formulation is a single-dose formulation or a multiple-dose formulation.
[0060] In another preferred embodiment, the volume of a single administration of the formulation is from 1 μL to 100 μL; preferably from 2 μL to 50 μL; more preferably from 5 μL to 20 μL.
[0061] In another preferred embodiment, the single-dose dose of the recombinant adenovirus in the formulation is 1 × 10⁻⁶. 8 PFU up to 1×10 10 PFU; preferably 1×10 7 PFU up to 5×10 9 PFU; more preferably 2×10 8 PFU up to 4×10 8 PFU.
[0062] In another preferred embodiment, the single dose of the dCas9-Tet1-CD fusion protein in the formulation is 0.1 μg to 100 μg; preferably 1 μg to 50 μg; more preferably 5 μg to 20 μg.
[0063] In another preferred embodiment, the single dose of sgRNA in the formulation is 0.01 μg to 10 μg; preferably 0.1 μg to 5 μg; more preferably 0.5 μg to 2 μg.
[0064] In another preferred embodiment, the dosage of the formulation is a single dose; preferably once every 1-4 weeks; more preferably once every 2 weeks.
[0065] In a ninth aspect of the invention, a kit is provided for promoting jawbone regeneration and / or improving jawbone defects, the kit comprising the sgRNA of the first aspect of the invention, the complex of the second aspect of the invention, the recombinant vector of the third aspect of the invention, the recombinant adenovirus of the fourth aspect of the invention, the pharmaceutical composition of the fifth aspect of the invention, or the injectable hydrogel of the sixth aspect of the invention.
[0066] In a tenth aspect of the present invention, a method for promoting osteogenic differentiation of periosteal stem / progenitor cells in vitro is provided, the method comprising introducing the sgRNA described in the first aspect of the present invention, the complex described in the second aspect of the present invention, and the recombinant vector described in the third aspect of the present invention into the periosteal stem / progenitor cells.
[0067] In another preferred embodiment, the method further includes a step of osteogenic induction culture of the periosteal stem / progenitor cells.
[0068] In another preferred embodiment, the method is for non-diagnostic and non-therapeutic purposes.
[0069] In an eleventh aspect of the present invention, a method for promoting osteogenic differentiation of periosteal stem / progenitor cells in vitro is provided, the method comprising introducing the sgRNA described in the first aspect of the present invention, the complex described in the second aspect of the present invention, and the recombinant vector described in the third aspect of the present invention into the periosteal stem / progenitor cells.
[0070] In another preferred embodiment, the method further includes a step of osteogenic induction culture of the periosteal stem / progenitor cells.
[0071] In another preferred embodiment, the method is for non-diagnostic and non-therapeutic purposes.
[0072] In another preferred embodiment, the method is used to prepare tissue-engineered bone grafts.
[0073] In another preferred embodiment, the method is used to construct a bone regeneration research model.
[0074] In a twelfth aspect of the present invention, a method for preparing cells for promoting jawbone regeneration is provided, the method comprising introducing the sgRNA described in the first aspect of the present invention, the complex described in the second aspect of the present invention, and the recombinant vector described in the third aspect of the present invention into periosteal stem / progenitor cells to obtain cells with enhanced osteogenic differentiation.
[0075] In another preferred embodiment, the method further includes the step of mixing the cells with a hydrogel material.
[0076] In another preferred embodiment, the method is for non-therapeutic purposes.
[0077] In another preferred embodiment, the method is used to prepare cell therapy products.
[0078] In another preferred embodiment, the method is used to prepare tissue-engineered bone tissue.
[0079] In a thirteenth aspect of the invention, a method for promoting jawbone regeneration is provided, the method comprising administering to a subject in need an effective amount of the sgRNA of the first aspect of the invention, the complex of the second aspect of the invention, the recombinant vector of the third aspect of the invention, the recombinant adenovirus of the fourth aspect of the invention, the pharmaceutical composition of the fifth aspect of the invention, or the injectable hydrogel of the sixth aspect of the invention.
[0080] In another preferred embodiment, the subject is a human or a non-human mammal.
[0081] In another preferred embodiment, the method includes injecting the injectable hydrogel into the jawbone defect and then curing it by light.
[0082] In another preferred embodiment, the illumination is ultraviolet light, visible light, or blue light, and the illumination time is 5 to 60 seconds.
[0083] In another preferred embodiment, the method is a minimally invasive surgical method.
[0084] In another preferred embodiment, the method further includes the step of cleaning, rinsing or pre-treating the defect site before application.
[0085] In another preferred embodiment, the method further includes the step of covering with a biofilm or suturing after application.
[0086] In another preferred embodiment, the method is used for purposes selected from the group consisting of:
[0087] (1) Used to treat traumatic jawbone defects;
[0088] (2) Used to treat post-infectious jawbone defects;
[0089] (3) Treatment of jawbone defects after tumor resection;
[0090] (4) Used to treat congenital jawbone defects;
[0091] (5) Used for jawbone regeneration combined with dental implant placement;
[0092] (6) Used to guide bone tissue regeneration;
[0093] (7) Used to accelerate the bone healing process;
[0094] (8) Used to improve the quality of bone regeneration;
[0095] (9) Used to reduce the formation of fibrous tissue;
[0096] (10) Used to promote osteogenic differentiation of periosteal stem / progenitor cells; and / or
[0097] (11) Used to increase bone volume fraction, bone surface area to tissue volume ratio, bone mineral density, and / or reduce porosity.
[0098] In another preferred embodiment, the method is for non-diagnostic and non-therapeutic purposes.
[0099] In another preferred embodiment, the method is for laboratory research purposes.
[0100] In another preferred embodiment, the single injection volume of the injectable hydrogel is from 1 μL to 100 μL, preferably from 2 μL to 50 μL, more preferably from 5 μL to 20 μL, and most preferably from 6 μL.
[0101] In another preferred embodiment, the recombinant adenovirus content in the injectable hydrogel is 1 × 10⁻⁶. 7 PFU / mL up to 1×10 11 PFU / mL, preferably 1×10⁻⁶ 8 PFU / mL up to 1×10 10 PFU / mL, more preferably 5 × 10⁻⁶ 8 PFU / mL up to 5×10 9 PFU / mL.
[0102] In another preferred embodiment, the single-dose dose of AdV-dCas9-Tet1-CD in the injectable hydrogel is 1×10⁻⁶. 7 PFU up to 1×10 10 PFU, preferably 1×10 8 PFU up to 5×10 9 PFU, more preferably 2×10 8 PFU up to 4×10 8 PFU.
[0103] In another preferred embodiment, the single-dose administration of the AdV-DMR-sgRNA in the injectable hydrogel is 1 × 10⁻⁶. 7 PFU up to 1×10 10 PFU, preferably 1×10 8 PFU up to 5×10 9 PFU, more preferably 2×10 8 PFU up to 4×10 8 PFU.
[0104] In another preferred embodiment, when AdV-dCas9-Tet1-CD and AdV-DMR-sgRNA are administered simultaneously, the dosage ratio of the two is 1:3 to 3:1, preferably 1:2 to 2:1, and more preferably 1:1.
[0105] In another preferred embodiment, the concentration of methacrylated silk fibroin in the injectable hydrogel is 10% to 50% (w / v), preferably 20% to 40% (w / v), and more preferably 30% (w / v).
[0106] In another preferred embodiment, the concentration of the photoinitiator LAP in the injectable hydrogel is 0.1% to 1% (w / v), preferably 0.2% to 0.5% (w / v), and more preferably 0.25% (w / v).
[0107] In another preferred embodiment, the curing time of the injectable hydrogel is 5 to 60 seconds, preferably 10 to 30 seconds, and more preferably 15 seconds.
[0108] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.
[0109] Compared with the prior art, the present invention has the following technical effects:
[0110] (1) Reversibility of Epigenetic Regulation: Epigenetic regulation is a key event in tissue development and regeneration. This invention combines transcription factor regulation with epigenetic regulation, utilizing the CRISPR / dCas9-Tet1-CD system to precisely reprogram Plagl1 differentially methylated regions (DMRs) without the need for exogenous lineage determinants. This method reversibly affects gene expression by regulating chromatin activity without altering the DNA sequence, effectively avoiding the risks associated with accidental permanent mutations and irreversible interference in the target genome.
[0111] (2) Precision of the target: Plagl1 is an imprinted gene, and its expression is tightly regulated by DMR. This invention precisely targets this endogenous regulatory element, with sufficient scientific basis. Existing studies have confirmed that DNA methylation is the main mechanism of PLAGL1 expression inhibition (e.g. in breast cancer cells), and demethylation treatment can restore its expression; the methylation status of PLAGL1 DMR is related to diseases (e.g., transient neonatal diabetes) and can be regulated by maternal environmental factors (e.g., alcohol, vitamin B2), proving that this site is operable; the above evidence shows that PLAGL1 DMR is a natural, druggable epigenetic intervention target, providing a solid theoretical basis for this invention.
[0112] (3) Advanced delivery system: The present invention constructs an injectable, photocurable silk protein hydrogel loaded with CRISPR-dCas9-Tet1-CD system. This delivery system has multiple advantages: Injectability: minimally invasive operation, can be directly filled into the jawbone defect area, conforming to irregular bone surface; Photocurability: after injection, it quickly gels under light, achieving in-situ curing and long-term retention, avoiding loss of effective ingredients; Silk protein biomaterial: has good biocompatibility, degradability and low immunogenicity, and has been widely used in tissue engineering; Sustained release and protection: the hydrogel can provide a physical barrier for the gene editing system, protect its in vivo stability, and achieve continuous and controllable epigenetic modification regulation. Attached Figure Description
[0113] Figure 1Three days after transfection with AdV-dCas9-Tet1-CD, AdV-DMR sgRNA1, AdV-DMR sgRNA2, and AdV-DMR sgRNA3, the expression level of Plagl1 mRNA in PSPCs was measured. n = 4 biologically independent samples. All data in this figure are expressed as mean ± standard deviation. One-way ANOVA combined with Dunnett's multiple comparison test was used.
[0114] Figure 2 Expression levels of Runx2, Sp7, Alpl, and Col1α1 mRNA in PSPCs transfected with AdV-dCas9-Tet1-CD, AdV-DMR sgRNA1, AdV-DMR sgRNA2, or control AdV-EGFP for 3 days after osteogenic induction. n = 4 biologically independent samples. All data in this figure are expressed as mean ± standard deviation. One-way ANOVA combined with Dunnett's multiple comparison test was used.
[0115] Figure 3 The images shown are H&E staining images of hydrogel degradation in the mandibular bone defect area at different time points in this embodiment of the invention. POD 4, 7, 10, and 14 represent 4, 7, 10, and 14 days post-mandibular bone defect surgery, respectively. The image below is a magnified view of the area within the black box in the image above; arrows indicate the hydrogel region. An asterisk (*) marks the area where the hydrogel has completely degraded. Scale bar: 500 μm.
[0116] Figure 4The figures shown represent experimental results of promoting in vivo and in vitro mandibular bone regeneration and repair by targeting Plagl1 DMR in embodiments of the present invention. Figure a shows representative micro-CT images of mandibular bone defects treated with different adenoviruses at 14 days post-surgery (POD 14). Black and red dashed lines mark the defect areas. Yellow dashed lines indicate the cross-sectional direction in the right image. Figure b shows the quantification of bone volume / total volume (BV / TV), bone surface / total volume (BS / TV), bone mineral density (BMD), and porosity percentage (Po) of the mandibular bone defect areas in each group. n = 6 biologically independent samples. Figures c and d show H&E staining images (c) and Masson trichrome staining images (d) of the mandibular bone defect areas in each adenovirus treatment group, with white dashed lines outlining the bone surface. Red dashed lines mark the defect areas. Scale bar: 500 μm. All data in the figures are expressed as mean ± standard deviation. Among them, b uses one-way ANOVA combined with Tukey's multiple comparison test. Detailed Implementation
[0117] To make the objectives, technical solutions, beneficial effects, and significant advancements of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, all the described embodiments are only some embodiments of the present invention, and not all embodiments; based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0118] the term
[0119] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0120] As used herein, “including” or “containing” includes “comprising,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”
[0121] The appearance modification reprogramming of Plagl1 DMR of the present invention
[0122] As an imprinted gene, the differentially methylated region (DMR) of PLAGL1 provides a precise epigenetic intervention target, offering innovative strategies for potential disease treatment and tissue regeneration applications. Studies have found that DNA methylation, rather than genetic mutation, is a crucial mechanism for the suppression of PLAGL1 expression in breast cancer patients; treatment with methylation inhibitors can restore PLAGL1 expression in some breast cancer cell lines. Other studies have shown that PLAGL1 DMR demethylation is associated with transient neonatal diabetes, and maternal environmental factors such as alcohol and vitamin B2 intake can participate in DMR methylation regulation. These studies all demonstrate that the PLAGL1 DMR is an epigenetic modification site that can be modulated. In 2023, the FDA approved the first CRISPR gene-editing therapy for the treatment of sickle cell disease, marking a milestone in CRISPR gene therapy. Unlike direct gene insertion or knockout strategies, CRISPR / dCas9-Tet1-CD technology can precisely regulate genes through targeted demethylation modification and has already achieved initial success in several fields. CRISPR / dCas9-Tet1-CD technology is a CRISPR-based epigenetic editing tool that achieves precise demethylation of specific gene sites by fusing the nuclease-inactive Cas9 protein (dCas9) with the catalytic domain (CD) of the DNA demethylase Tet1. This activates the expression of the target gene. dCas9 (deadCas9): Point mutations cause Cas9 to lose its DNA cleavage activity, but it retains its ability to bind to single-stranded guide RNA (sgRNA) and target specific DNA sequences. TET1CD (TET1 catalytic domain): Tet1 is a DNA demethylase whose catalytic domain progressively oxidizes 5-methylcytosine (5-mC) to 5-hydroxymethylcytosine (5-hmC), ultimately achieving demethylation through DNA repair mechanisms.
[0123] This invention constructs an injectable, photocurable silk protein hydrogel loaded with the CRISPR-dCas9-Tet1-CD system, enabling precise epigenetic modification and reprogramming of PSPCs targeting Plagl1 DMR for the treatment of jaw defects. It is expected to promote jaw regeneration efficiently and safely and has promising clinical translation prospects.
[0124] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents involved in this invention are commercially available.
[0125] Experimental methods:
[0126] 1. In vitro cell culture
[0127] Mandibular bone fragments were isolated from 2-month-old mice. Most of the muscle and connective tissue was removed, and the fragments were washed with pre-cooled PBS to remove blood and bone marrow. Under a dissecting microscope, the periosteum on the bone surface was peeled off. The resulting periosteum was digested for 20 minutes at 37°C in HBSS (Thermo Fisher Scientific, 14175) containing 2 mg / mL type I collagenase (Worthington, LS004194) and 2 mg / mL type II dispersant enzyme (Roche, 04942078001). The digested mixture was filtered through a 70 μm filter, and the resulting cells were cultured in α-MEM medium containing 10% fetal bovine serum (Cyagen Biosciences, OriCellFBSAD-01011-500) and 1% penicillin-streptomycin. For osteoblast differentiation, cells were supplemented with 50 μg / mL ascorbic acid (Sigma-Aldrich, A4544), 5 mM β-glycerophosphate (Sigma-Aldrich, G9422), and 10 μg / mL ascorbic acid (Sigma-Aldrich, G9422). -7 Cultured in complete medium of M dexamethasone (Sigma-Aldrich, D4902). Change the medium every 2 days until the specified time point is reached.
[0128] 2. In vitro cell adenovirus transfection
[0129] Recombinant adenovirus (Hanheng Biotechnology) expressing dCas9-Tet1-CD cDNA (dCas9-SV40 NLS-Tet1-CD) was prepared using the pAdEasy vector system. Recombinant adenovirus (Hanheng Biotechnology) targeting Plagl1 DMRCpG sgRNA1 (AGTCTGGGCTTTACCAGCGA (SEQ ID NO: 1)), Plagl1 DMR CpG sgRNA2 (CCAGGCCCTCCCCGTGAACT (SEQ ID NO: 2)), and Plagl1 DMR CpG sgRNA3 (CCTGGAAGGAAGCGTGCACA (SEQ ID NO: 3)) upstream of Plagl1 DMR (GenBank: AF314094.1) was used as a control. For adenovirus transfection, 2 × 10 5Periosteal mesenchymal cells were seeded in 12-well plates and cultured overnight in α-MEM medium. They were then transfected with adenovirus expressing dCas9-Tet1-CD and DMR sgRNA1, sgRNA2, or sgRNA3, or a control adenovirus (MOI=100). Two days after transfection, the cells were induced to differentiate into osteogenic cells, continuing until the specified time.
[0130] 3. Real-time quantitative PCR (qPCR)
[0131] For qPCR analysis, RNA was extracted using TRIzol (Sigma, T9424) and reverse transcribed using the Prime Script RTMaster Kit (TakaRa Bio Inc., RR036A). The relative amounts of each mRNA transcript were then analyzed using the qPCR SYBR Green MasterMix (Yisheng Bio, 11201) and Roche LightCycler 480 system (v1.5.1.74). β-actin was used as an internal control.
[0132] 4. Establishment of a mouse mandibular bone defect model:
[0133] 1) Under anesthesia, make an incision at the angle of the mandible and bluntly dissect the muscles to expose the mandible of the mouse;
[0134] 2) Prepare a 0.8 mm diameter hole defect using a ball drill at a position approximately 1 mm from the lower border of the mandible and distal to the incisors;
[0135] 3) Rinse the bone fragments with a sterile 0.9% sodium chloride solution;
[0136] 4) Inject 6 μl of hydrogel containing different adenoviruses or blank controls into the defect sites according to the experimental groups;
[0137] 5) Irradiate with ultraviolet light for 15 seconds to solidify the hydrogel in situ;
[0138] 6) Suture the wound in layers.
[0139] 5. Sample collection, fixation, and decalcification:
[0140] 1) The mice in each group were euthanized at the corresponding time points after surgery;
[0141] 2) Remove the mandible and fix it in 4% paraformaldehyde for 24 hours;
[0142] 3) The fixed mandibular bone sample was rinsed with PBS to remove residual fixative;
[0143] 4) Replace with 10% EDTA decalcification solution, place on a shaker at 4°C and shake slowly, changing the solution every other day;
[0144] 5) The decalcification time depends on the sample size and can range from one to three weeks.
[0145] 6. Micro-CT scan:
[0146] 1) Euthanize the mice in each group at the corresponding time points after surgery;
[0147] 2) Dissect the mandible and fix it with 4% paraformaldehyde for 24 hours;
[0148] 3) Wash with PBS to remove residual paraformaldehyde fixative;
[0149] 4) Micro-CT scans of the fixed mandible were performed using a Skyscan 1176 (Bruker, Kontich, Belgium) at a resolution of 50 kVp, 450 µA and 9 μm.
[0150] 5) The acquired images were reconstructed using NRecon software (v1.7.1.0, Bruker, Kontich, Belgium);
[0151] 6) Use CTAn software (v1.16, Bruker, Kontich, Belgium) to analyze the bone volume fraction (BV / TV), bone surface area fraction (BS / TV), bone mineral density (BMD), and porosity (Po) of the defect area.
[0152] 7. Paraffin embedding and sectioning:
[0153] 1) Sample collection, fixation, and decalcification are the same as above;
[0154] 2) After decalcification, dehydration and rewaxing are performed in a fully automatic dehydrator;
[0155] 3) Paraffin embedding machine embedding;
[0156] 4) Perform continuous sections with a thickness of 4 μm on the mandibular bone defect area;
[0157] 5) Spread the paraffin sections in a 45℃ water bath;
[0158] 6) After the slides are lifted by adhering to the slides, they are placed on a slide drying table for baking;
[0159] 7) Store the obtained slices in a refrigerator at 4°C.
[0160] 8. H&E staining:
[0161] 1) Remove the paraffin slices from the 4°C freezer; bake them in a 65°C oven for 1 hour;
[0162] 2) Dewaxing is performed in a xylene solution, followed by rehydration in a gradient of alcohols;
[0163] 3) Soak in hematoxylin stain for 5 minutes; rinse with tap water until the water runs clear;
[0164] 4) Differentiate in hematoxylin differentiation solution for 5 seconds; rinse with tap water until the tissue turns purple;
[0165] 5) After rinsing with alcohol, soak in eosin staining solution for 1 minute; treat with gradient alcohol and xylene;
[0166] 6) Mount the slide with neutral resin; dry overnight in a fume hood;
[0167] 7) Take photos and observe under a microscope.
[0168] 9. MASSON tricolor staining:
[0169] 1) Remove the paraffin slices from the 4°C freezer; bake them in a 65°C oven for 1 hour;
[0170] 2) Dewaxing is performed in a xylene solution, followed by rehydration in a gradient of alcohols;
[0171] 3) Immerse the sections in Bouin's solution and incubate overnight at room temperature or in a 37°C oven for 2 hours as a mordant; rinse with tap water until the yellow color on the sections disappears;
[0172] 4) Stain with lapis lazuli blue solution for 3 minutes, then rinse briefly with water; stain with Mayer hematoxylin solution for 3 minutes, then rinse briefly with water; differentiate with acidic ethanol solution for a few seconds, then rinse with running water for 10 minutes; stain with poinsettia and magenta solution for 10 minutes, then rinse briefly with distilled water.
[0173] 5) Treat with phosphomolybdic acid solution for 10-15 minutes; pour off the supernatant, and directly add aniline blue staining solution for 5 minutes;
[0174] 6) Treat with a weak acid solution for 2 minutes; then treat with a gradient of alcohol and xylene;
[0175] 7) Mount the slide with neutral resin; dry overnight in a fume hood;
[0176] 8) Take photos and observe under a microscope.
[0177] Example 1
[0178] In vitro validation of promoting osteogenic differentiation of PSPCs through epigenetic modification reprogramming targeting Plagl1 DMR, the specific steps are as follows:
[0179] Step 1: Two-month-old mice were used to isolate mandibular bone fragments. Most of the muscle and connective tissue were removed, and the fragments were rinsed with pre-cooled PBS to remove blood and bone marrow. Under a dissecting microscope, the periosteum on the bone surface was peeled off. The resulting periosteum was placed in HBSS (Thermo Fisher Scientific, 14175) containing 2 mg / mL type I collagenase (Worthington, LS004194) and 2 mg / mL type II dispersant enzyme (Roche, 04942078001) and digested at 37°C for 20 minutes. The digested mixture was filtered through a 70 μm filter, and the resulting cells were cultured in α-MEM. The culture medium was α-MEM containing 10% fetal bovine serum (Cyagen Biosciences, OriCell FBSAD-01011-500) and 1% penicillin-streptomycin.
[0180] Step 2: Recombinant adenovirus (Hanheng Biotechnology) expressing dCas9-Tet1-CD cDNA (dCas9-SV40 NLS-Tet1-CD) was prepared using the pAdEasy vector system. Recombinant adenovirus (Hanheng Biotechnology) targeting the upstream of Plagl1 DMR (GenBank: AF314094.1) of Plagl1 DMR CpG sgRNA1 (AGTCTGGGCTTTACCAGCGA (SEQ ID NO: 1), hereinafter referred to as sgRNA1), Plagl1 DMRCpG sgRNA2 (CCAGGCCCTCCCCGTGAACT (SEQ ID NO: 2), hereinafter referred to as sgRNA2), and Plagl1 DMR CpG sgRNA3 (CCTGGAAGGAAGCGTGCACA (SEQ ID NO: 3), hereinafter referred to as sgRNA3) was also prepared. Adenovirus carrying green fluorescent protein (AdV-EGFP) (Hanheng Biotechnology) was used as a control. For adenovirus transfection, 2×10 5 Periosteal mesenchymal cells were seeded in 12-well plates and cultured overnight in α-MEM medium, followed by transfection with adenovirus expressing dCas9-Tet1-CD and DMR sgRNA1, sgRNA2, or sgRNA3, or a control adenovirus (MOI=100). Two days after transfection, cells were induced to differentiate into osteoblasts, continuing until a specified time. For osteoblast differentiation, cells were supplemented with 50 μg / mL ascorbic acid (Sigma-Aldrich, A4544), 5 mM β-glycerophosphate (Sigma-Aldrich, G9422), and 10... -7 Cultured in complete medium of M dexamethasone (Sigma-Aldrich, D4902). Change the medium every 2 days until the specified time point is reached.
[0181] Using the above experimental methods, this invention first verified the effect of a CRISPR / dCas9-based targeted DNA demethylation system on the expression level of the Plagl1 gene in in vitro mouse PSPCs. Figure 1 After transfecting CRISPR dCas9-Tet-CD and sgRNA1 or sgRNA2 with an adenovirus vector (AdV), the transcription level of the Plagl1 gene was significantly upregulated, while no significant change was observed in the sgRNA3 treatment group.
[0182] Based on this, sgRNA1 and sgRNA2 were selected for subsequent in vitro validation of the osteogenic function of PSPCs. Figure 2 The results showed that after osteogenic induction, the gene-targeting editing system effectively activated osteoblast differentiation, and the transcriptional levels of osteogenic-related genes such as Runx2, Sp7, Alpl and Col1α1 were significantly increased, with sgRNA1 showing the best effect.
[0183] Therefore, sgRNA1 was chosen for further investigation in subsequent in vivo experiments.
[0184] Example 2:
[0185] Based on the above embodiments, the preparation of an injectable photocurable silk protein hydrogel that promotes mandibular bone regeneration through epigenetic modification reprogramming targeting Plagl1 DMR is as follows:
[0186] Step 1: Boil silkworm cocoons in 0.05 M Na₂CO₃ solution to remove sericin. The degummed silk fibers are thoroughly dried and then dissolved in 9.3 M LiBr solution at 60°C. After complete dissolution, 424 mM GMA is added, and the reaction is carried out at 60°C with continuous stirring for 3 hours. The resulting reaction mixture is transferred to a dialysis tube with a molecular weight cutoff of 10 kDa and dialyzed with distilled water for 3 days. After dialysis, the mixture is centrifuged to remove precipitates, frozen, and then lyophilized to obtain Sil-MA powder, which is stored at -80°C for future use. Step 2: Dissolve the lyophilized Sil-MA powder in PBS containing 0.25% (w / v) photoinitiator LAP to prepare a 30% (w / v) stock solution. Store at 4°C protected from light for later use.
[0187] Step 3: Using the pAdEasy vector system, recombinant adenovirus (Hanheng Biotechnology) expressing dCas9-Tet1-CD cDNA (dCas9-SV40NLS-Tet1-CD) was prepared. A recombinant adenovirus (Hanheng Biotechnology) targeting Plagl1 DMR CpG sgRNA1 (AGTCTGGGCTTTACCAGCGA, SEQ ID NO: 1) upstream of Plagl1 DMR (GenBank: AF314094.1) and an adenovirus carrying green fluorescent protein (AdV-EGFP) were also prepared as controls. Methacrylated silk fibroin (Sil-MA) solution was mixed with a specific virus mixture at a volume ratio of 1:2. All operations were performed on ice, prepared fresh, and used immediately to avoid repeated freeze-thaw cycles.
[0188] The nucleotide sequence encoding the dCas9-Tet1-CD fusion protein involved in this invention is shown in SEQ ID NO: 4:
[0189]
[0190] Ultimately, an injectable, photocurable silk protein hydrogel was obtained that promotes mandibular bone regeneration through epigenetic modification and reprogramming targeting Plagl1 DMR.
[0191] Example 3:
[0192] Based on the above embodiments, a CRISPR dCas9-based targeted DNA demethylation system, combined with CRISPR dCas9-Tet1 CD and sgRNA, was used to target the upstream region of Plagl1 DMR to activate the imprinting function of the maternal allele. This epigenetic editing system was loaded into an injectable methacrylated silk fibroin (Sil-MA) hydrogel system, ultimately yielding an injectable, light-cured silk fibroin hydrogel that promotes mandibular bone regeneration through epigenetic modification and reprogramming targeting Plagl1 DMR. This hydrogel was injected into the defect area, and in vivo mandibular bone regeneration experiments were conducted to further verify its potential therapeutic application value in bone regeneration. The specific experimental procedure is as follows:
[0193] Step 1: Based on the above experimental method, a mouse mandibular bone defect model was established. Under anesthesia, an incision was made at the angle of the mandible, and the muscles were bluntly dissected to expose the mouse's mandible; a hole with a diameter of 0.8 mm was prepared using a ball bur at a position about 1 mm from the lower edge of the mandible and distal to the incisors; the bone fragments were rinsed with sterile 0.9% sodium chloride solution.
[0194] Step 2: Inject 6 μL of silk protein hydrogel containing the corresponding adenovirus into each defect according to the group. Two-month-old healthy mice were randomly divided into a control group (each defect containing 4 × 10^8 PFU AdV-EGFP), a dCas9-only group (each defect containing 4 × 10^8 PFU AdV-dCas9-Tet1-CD), and an experimental group (each defect containing 2 × 10^8 PFU AdV-dCas9-Tet1-CD + 2 × 10^8 PFU AdV-DMR-sgRNA). For degradation experiments, 6 μL of blank injectable photocurable silk protein hydrogel without adenovirus was injected.
[0195] Step 3: Immediately after injection, irradiate the defect with ultraviolet light for 15 seconds to solidify the hydrogel in situ; then suture the wound in layers.
[0196] Using the above experimental method, the present invention collected mandibular bone samples of mice injected with blank hydrogel at different time points (4 days after surgery (POD4), 7 days after surgery (POD7), 10 days after surgery (POD10), and 14 days after surgery (POD14)) and performed H&E staining to observe the degradation of hydrogel.
[0197] The results are as follows Figure 3 As shown, at POD 4, the hydrogel was abundant in the defect area and remained intact; at POD 7, the hydrogel at the defect had partially degraded, and the volume of the remaining gel decreased; at POD 10, most of the hydrogel had degraded, with only a small portion remaining at the edge of the bone defect; at POD 14, no hydrogel was visible in the defect area, indicating that the gel had completely degraded.
[0198] Micro-CT and quantitative analysis results showed that, compared with the dCas9-Tet1-CD group or the EGFP group alone, the dCas9-Tet1-CD + DMR-sgRNA group had significantly higher bone volume fraction (BV / TV), bone surface area to tissue volume ratio (BS / TV), and bone mineral density (BMD) in the defect area, while significantly lower porosity. This indicates that the CRISPR / dCas9-based targeted DNA demethylation system can significantly promote rapid regeneration of the mandible in the early stage of mandibular bone defect surgery on day 14 (POD14). Figure 4 ab).
[0199] H&E staining and Masson's trichrome staining showed that new bone formation and collagen deposition were observed at the mandibular bone defect site in the targeted DNA demethylation group, while the defect site in the control group was mainly composed of fibrous tissue. Figure 4 cd).
[0200] These results demonstrate that the CRISPR / dCas9-based targeted DNA demethylation system of this invention can promote osteoblast differentiation and bone regeneration (especially in the mandible), representing a promising strategy that combines transcription factor regulation with epigenetic regulation, and holds promise for future applications in regenerative medicine.
[0201] The preferred embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and the devices and structures not described in detail should be understood as being implemented in a conventional manner in the art. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the scope of the present invention. This does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the present invention's technical solutions still fall within the protection scope of the present invention.
Claims
1. An sgRNA targeting the differentially methylated region of the Plagl1 gene, characterized in that, The nucleotide sequence of the sgRNA is selected from SEQ ID NO: 1 or SEQ ID NO:
2.
2. A complex for epigenetic reprogramming of the Plagl1 gene, characterized in that, The complex includes: (a) the sgRNA of claim 1; and (b) dCas9-Tet1-CD fusion protein; The dCas9-Tet1-CD fusion protein is formed by fusing an inactivated Cas9 protein with the catalytic domain of a Tet1 protein.
3. A recombinant vector, characterized in that, The recombinant vector contains a first nucleotide sequence encoding the sgRNA of claim 1; The recombinant vector also contains a second nucleotide sequence encoding the dCas9-Tet1-CD fusion protein; The second nucleotide sequence encoding the dCas9-Tet1-CD fusion protein is shown in SEQ ID NO:
4.
4. A recombinant adenovirus, characterized in that, The recombinant adenovirus comprises a nucleotide sequence encoding the sgRNA of claim 1 and a nucleotide sequence encoding the dCas9-Tet1-CD fusion protein.
5. A pharmaceutical composition for jawbone regeneration, characterized in that, The pharmaceutical composition comprises the sgRNA of claim 1, the complex of claim 2, the recombinant vector of claim 3, or the recombinant adenovirus of claim 4.
6. An injectable hydrogel for jawbone regeneration, characterized in that, The hydrogel comprises the sgRNA of claim 1, the complex of claim 2, the recombinant vector of claim 3, or the recombinant adenovirus of claim 4; The hydrogel is a photocurable silk protein hydrogel.
7. A method for preparing the injectable hydrogel of claim 6, characterized in that, The method includes the step of mixing the sgRNA of claim 1, the complex of claim 2, the recombinant vector of claim 3, or the recombinant adenovirus of claim 4 with a methacrylated silk fibroin solution.
8. The use of the sgRNA of claim 1, the complex of claim 2, the recombinant vector of claim 3, the recombinant adenovirus of claim 4, the pharmaceutical composition of claim 5, or the injectable hydrogel of claim 6 in the preparation of formulations for promoting jawbone regeneration and / or improving jawbone defects.
9. A kit for promoting jawbone regeneration and / or improving jawbone defects, characterized in that, The kit comprises the sgRNA of claim 1, the complex of claim 2, the recombinant vector of claim 3, the recombinant adenovirus of claim 4, the pharmaceutical composition of claim 5, or the injectable hydrogel of claim 6.
10. A method for promoting osteogenic differentiation of periosteal stem / progenitor cells in vitro, characterized in that, The method includes introducing the sgRNA of claim 1, the complex of claim 2, and the recombinant vector of claim 3 into the periosteum stem / progenitor cells.